Home | Community | Message Board

Cannabis Seeds UK
Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Kraken Kratom Red Vein Kratom   North Spore Cultivation Supplies, North Spore Mushroom Grow Kits & Cultivation Supplies   Left Coast Kratom Buy Kratom Extract, Kratom Powder For Sale   PhytoExtractum Buy Bali Kratom Powder, Kratom Powder for Sale, Maeng Da Thai Kratom Leaf Powder

Jump to first unread post Pages: 1 | 2 | Next >  [ show all ]
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 47,421
Last seen: 1 hour, 4 minutes
Trusted Identifier
Inocybe insignis from Ohio tests positive for psilocybin * 9
    #27391788 - 07/17/21 10:18 PM (11 months, 2 days ago)

Just finished working on a sample of Inocybe insignis sent to me from Ohio - not only does it have beautiful microscopic features, but it strongly stains blue and is the first Inocybe from North America to test positive for psilocybin.

https://mushroomobserver.org/460068

I used a psilocybin test from Miraculix, which showed nearly two percent, about three times as much as standard Psilocybe cubensis.

This species is also known from Illinois, Indiana and Indiana again, Missouri, Virginia and another find in Ohio.

Gill edge: 



Spores darkfield



Spores brightfield





More photos: https://mushroomobserver.org/460068

See also https://mycokeys.pensoft.net/article/5604/list/6 and https://www.mushroomexpert.com/inocybe_insignis.html

ITS sequence, from Steve Russell:  TAGGTGAACCTGCGGAAGGATCATTATTGAATAAAATTTGAACAGGCTGTTTTTGCTGGCCCCCCCTAGGGCATGTGCACGCTTGTCATTTTTTTGTTTCTCCAACCATGTGCACACATTGTAGACTCCCTGGTTTAGAATTGTACAGATTTGATTGAGGACTGCGCTATGCCGCTTTCCTTGCAAAAAAGGGGTCTATGCTTTTCACTACCTTTATTTTGTTTTTTGAAATGGCAATAATAAAATTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAAGCTTCTCAAAGCCCCATGTTATATATGTATATGATTGTGGCTTTGGATGATGGGGGTTTTTGCAGGCTTTAGAAAAAGGTCRGCTCTCCTGAAATGTATTAGTGGTATCCAAGGGGGGGGACTACTTTTGGGCATGATAAAATTTGTCTATGTCTCTAAGTTCCAATATGAGTGCCACTTAAAAAATCACTTTTGTTGACTGACCTCAAATCAG

LSU sequence: https://www.ncbi.nlm.nih.gov/nuccore/KP170913

RPB2 sequence: https://www.ncbi.nlm.nih.gov/nuccore/KM245989

More photos: https://mycomap.com/reports/single-report/inocybe-fiber-caps-10378-r10378


Extras: Filter Print Post Top
InvisibleIcyurmt
Strange
 Unread Journal


Registered: 04/02/20
Posts: 1,282
Loc: 5a
Re: Inocybe insignis from Ohio tests positive for psilocybin [Re: Alan Rockefeller]
    #27391890 - 07/17/21 11:29 PM (11 months, 2 days ago)

Well that’s pretty cool! Beautiful spore photos, really incredible actually!  How were you able to get such clearity?

Is there anything known about other potential toxins in this sp?


--------------------
👁️ 🌊 why you are empty.

Hunt for the habitat not the mushroom.


Extras: Filter Print Post Top
InvisibleNitro87
Living the Dream
Male User Gallery


Registered: 07/08/20
Posts: 1,127
Loc: The Clouds
Trusted Identifier
Re: Inocybe insignis from Ohio tests positive for psilocybin [Re: Alan Rockefeller]
    #27391917 - 07/17/21 11:55 PM (11 months, 2 days ago)

:myman:  Awesome work!


--------------------
Life is worth living




Extras: Filter Print Post Top
Offlinethe man
still tappin caps
Other User Gallery


Registered: 08/13/99
Posts: 5,825
Loc: C A N A D A
Last seen: 10 minutes, 28 seconds
Re: Inocybe insignis from Ohio tests positive for psilocybin [Re: Nitro87]
    #27391991 - 07/18/21 01:03 AM (11 months, 2 days ago)

quality glass makes amazing difference :wink: very cool!


Extras: Filter Print Post Top
Offlinevelho
 User Gallery

Registered: 11/01/11
Posts: 722
Loc: Finland Flag
Last seen: 1 day, 18 hours
Re: Inocybe insignis from Ohio tests positive for psilocybin [Re: the man]
    #27392007 - 07/18/21 01:22 AM (11 months, 2 days ago)

Great work! Those spores are so pretty.


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 47,421
Last seen: 1 hour, 4 minutes
Trusted Identifier
Re: Inocybe insignis from Ohio tests positive for psilocybin [Re: Icyurmt] * 1
    #27392011 - 07/18/21 01:36 AM (11 months, 1 day ago)

Quote:

Icyurmt said:
How were you able to get such clearity?




The images look good because I used an Olympus BX41 microscope, put plan apo objectives on it, switched out the condenser for a plan achromat condenser that has a numerical aperture that matches the objectives, used spores from a spore print so the coverslip sits flat, pressed down firmly on the coverslip, sealed the coverslip with nail polish, put immersion oil both on the bottom of the side/top of the condenser and on top of the coverslip, and took a whole lot of photos by holding down the shutter while slowly turning the fine focus then stacked them in Helicon.

For the ones with a black background I put a homemade darkfield stop on the condenser and closed the objective iris. 

Quote:


Is there anything known about other potential toxins in this sp?




None of the psilocybin mushrooms have other toxins - even the ones in sketchy genera like Inocybe, Galerina and Pholiotina.


Extras: Filter Print Post Top
InvisibleMadMuncher
trespasser
 User Gallery


Registered: 10/27/12
Posts: 7,820
Loc: conformatorium
Re: Inocybe insignis from Ohio tests positive for psilocybin [Re: Alan Rockefeller]
    #27392029 - 07/18/21 02:13 AM (11 months, 1 day ago)

even gymns? what about gymnopilin?


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 47,421
Last seen: 1 hour, 4 minutes
Trusted Identifier
Re: Inocybe insignis from Ohio tests positive for psilocybin [Re: MadMuncher]
    #27392032 - 07/18/21 02:16 AM (11 months, 1 day ago)

Quote:

MadMuncher said:
even gymns? what about gymnopilin?




Not much is known about that molecule, but there aren't any Gymnopilus species which consistently cause toxicity.


Extras: Filter Print Post Top
InvisibleCHUCK.HNTR
feral urbanite
Male


Registered: 09/30/19
Posts: 1,584
Loc: SF, CA, USA
Re: Inocybe insignis from Ohio tests positive for psilocybin [Re: Alan Rockefeller]
    #27392370 - 07/18/21 12:38 PM (11 months, 1 day ago)

Wow excellent pics! Great work, exciting news.
:wizard:
Has anyone eaten them?


--------------------
"What is the practical application of a million universes?" -Alan Watts
:mushroom2::mushroom2::mushroom2::mushroom2::mushroom2:


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 47,421
Last seen: 1 hour, 4 minutes
Trusted Identifier
Re: Inocybe insignis from Ohio tests positive for psilocybin [Re: CHUCK.HNTR]
    #27392627 - 07/18/21 05:48 PM (11 months, 1 day ago)

Quote:

CHUCK.HNTR said:
Has anyone eaten them?




One guy who found one in Missouri yesterday ate one stem - this is the first time it's been consumed that I know of.  He is going to send me the cap for study.


Extras: Filter Print Post Top
OfflineAnglerfishM
hearing things
Male User Gallery


Registered: 09/08/10
Posts: 16,847
Loc: Norvegr Flag
Last seen: 6 hours, 25 minutes
Trusted Identifier
Re: Inocybe insignis from Ohio tests positive for psilocybin [Re: Alan Rockefeller]
    #27392642 - 07/18/21 06:06 PM (11 months, 1 day ago)

Quote:

Alan Rockefeller said:
Quote:

CHUCK.HNTR said:
Has anyone eaten them?




One guy who found one in Missouri yesterday ate one stem - this is the first time it's been consumed that I know of.  He is going to send me the cap for study.




It seems to be really potent. Exciting.

Half a gram should knock pretty good, I believe.

So exciting to see this, since Inocybe rarely seems to be on anyones "to-do" list.
Was this a sudden discovery, or have you worked on this for a while?


--------------------




Extras: Filter Print Post Top
Invisiblevandago
 User Gallery

Registered: 07/08/04
Posts: 19,864
Loc: .
Re: Inocybe insignis from Ohio tests positive for psilocybin [Re: Alan Rockefeller]
    #27392672 - 07/18/21 06:40 PM (11 months, 1 day ago)

Always love a new bucket list mush. Awesome work!


Extras: Filter Print Post Top
Offlinebloodycarcass
Stranger Danger
Male


Registered: 12/16/13
Posts: 2,638
Loc: the sticks in GA
Last seen: 13 hours, 51 minutes
Re: Inocybe insignis from Ohio tests positive for psilocybin [Re: Anglerfish]
    #27392678 - 07/18/21 06:44 PM (11 months, 1 day ago)

Quote:

Anglerfish said:
Quote:

Alan Rockefeller said:
Quote:

CHUCK.HNTR said:
Has anyone eaten them?




One guy who found one in Missouri yesterday ate one stem - this is the first time it's been consumed that I know of.  He is going to send me the cap for study.




It seems to be really potent. Exciting.

Half a gram should knock pretty good, I believe.

So exciting to see this, since Inocybe rarely seems to be on anyones "to-do" list.
Was this a sudden discovery, or have you worked on this for a while?





Ill definitely try them.. if I find some


--------------------
Back at it like a crack addict, with asthmatic lung disease


Extras: Filter Print Post Top
OnlineMoria841
Male User Gallery


Registered: 07/02/18
Posts: 3,926
Loc: NJ Flag
Last seen: 3 minutes, 52 seconds
Trusted Identifier
Re: Inocybe insignis from Ohio tests positive for psilocybin [Re: bloodycarcass]
    #27392699 - 07/18/21 07:03 PM (11 months, 1 day ago)

Wait, 2%? Wouldn't that make this mushroom rival even P. azurescens in potency??


--------------------


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 47,421
Last seen: 1 hour, 4 minutes
Trusted Identifier
Re: Inocybe insignis from Ohio tests positive for psilocybin [Re: Moria841]
    #27392725 - 07/18/21 07:27 PM (11 months, 1 day ago)

Quote:

Anglerfish said:
Was this a sudden discovery, or have you worked on this for a while?




It just arrived in the mail on Friday.


Quote:

Moria841 said:
Wait, 2%? Wouldn't that make this mushroom rival even P. azurescens in potency??




I think so, though I wouldn't trust any of the published potencies for Psilocybe at all.  I'll run some of my Psilocybe azurescens collections and see how they come out.


Extras: Filter Print Post Top
Invisiblemind.at.large
Myconerd


Registered: 12/13/16
Posts: 990
Loc: Floating in liquid garden...
Re: Inocybe insignis from Ohio tests positive for psilocybin [Re: Alan Rockefeller]
    #27393121 - 07/19/21 01:15 AM (11 months, 1 day ago)

Very cool Alan! It’s so fascinating to see that mycorrhizal mushrooms produce psilocybin as well

Oh and those spores are soooo cool!

Last year, I found some mushrooms in a redwood forest, that appeared to blue pretty heavily. I posted here and got some good tips that lead me to believe it was Inocybe calimastrata (just looked it up and I guess it’s now named Inosperma calamistratum) I couldn’t find any definitive info on whether it actually contains psilocybin, but would love to know what you think. I may be completely wrong on my ID as the mushrooms were not in the best shape, but here’s the thread I made about it last year. https://www.shroomery.org/forums/showflat.php/Number/26750100

Maybe there’s more Inocybe (or closely related) that contain psilocybin! Thanks for all the work you do Alan! You rock


--------------------
Mind's Easy Bag 2 Bag Grain Transfers


...the doll's trying to kill me and the toaster's been laughing at me...


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 47,421
Last seen: 1 hour, 4 minutes
Trusted Identifier
Re: Inocybe insignis from Ohio tests positive for psilocybin [Re: mind.at.large]
    #27393151 - 07/19/21 02:15 AM (11 months, 23 hours ago)

Quote:

mind.at.large said:
Very cool Alan! It’s so fascinating to see that mycorrhizal mushrooms produce psilocybin as well




Yes - I spoke with Dr. Matheny about this and he said that if these results are correct, "then this would increase the number of independent origins of psilocybin in Inocybe to three (once in sect. Lactiferae, again in I. aeruginascens, and then I. insignis).  Dentinger and his group have argued for convergent evolution of the psilocybin gene cluster, I think, in I. corydalina (as opposed to horizontal gene transfer), but their work has not yet been published after peer review."


Quote:

Last year, I found some mushrooms in a redwood forest, that appeared to blue pretty heavily. I posted here and got some good tips that lead me to believe it was Inocybe calimastrata (just looked it up and I guess it’s now named Inosperma calamistratum) I couldn’t find any definitive info on whether it actually contains psilocybin, but would love to know what you think. I may be completely wrong on my ID as the mushrooms were not in the best shape, but here’s the thread I made about it last year. https://www.shroomery.org/forums/showflat.php/Number/26750100






Those aren't active - all of the active Inocybe species are still in Inocybe, while this has been kicked out into Inosperma.  While they are very blue, they don't get any bluer when you damage them.  I've added more info in your thread.


Extras: Filter Print Post Top
InvisibleIcyurmt
Strange
 Unread Journal


Registered: 04/02/20
Posts: 1,282
Loc: 5a
Re: Inocybe insignis from Ohio tests positive for psilocybin [Re: Alan Rockefeller] * 1
    #27393559 - 07/19/21 12:43 PM (11 months, 12 hours ago)

Quote:

Alan Rockefeller said:.

The images look good because I used an Olympus BX41 microscope, put plan apo objectives on it, switched out the condenser for a plan achromat condenser that has a numerical aperture that matches the objectives, used spores from a spore print so the coverslip sits flat, pressed down firmly on the coverslip, sealed the coverslip with nail polish, put immersion oil both on the bottom of the side/top of the condenser and on top of the coverslip, and took a whole lot of photos by holding down the shutter while slowly turning the fine focus then stacked them in Helicon.

For the ones with a black background I put a homemade darkfield stop on the condenser and closed the objective iris.




Quality equipment aside, that’s a brilliant idea with the fine focus tuning and Helicon stack.. I’m guessing that adds to the amazing 3-D quality you were able to capture.  A lot of spore photos come out fairly flat looking where as these seem to jump out at you. Well done; really beautiful images! Thank you for sharing them!

Also super interesting about the lack of other toxins even  in the sketchy genera.


--------------------
👁️ 🌊 why you are empty.

Hunt for the habitat not the mushroom.


Extras: Filter Print Post Top
Invisiblemind.at.large
Myconerd


Registered: 12/13/16
Posts: 990
Loc: Floating in liquid garden...
Re: Inocybe insignis from Ohio tests positive for psilocybin [Re: Icyurmt]
    #27394231 - 07/19/21 08:56 PM (11 months, 4 hours ago)

Quote:

Alan Rockefeller said:
Dentinger and his group have argued for convergent evolution of the psilocybin gene cluster, I think, in I. corydalina (as opposed to horizontal gene transfer), but their work has not yet been published after peer review."



Convergent evolution is mind blowing when describing physical characteristics, like wings. To have it happen with incredibly specific chemicals like psilocybin is hard to even comprehend. I mean I still haven’t gotten over the Massaspora/psilocybin news from a couple years ago haha. I’ll be on the lookout for a publication from Dentinger!

Quote:

Alan Rockefeller said:
I've added more info in your thread.



Thanks dude!!


--------------------
Mind's Easy Bag 2 Bag Grain Transfers


...the doll's trying to kill me and the toaster's been laughing at me...


Extras: Filter Print Post Top
InvisibleBagels
Huntress
Female User Gallery

Registered: 07/11/14
Posts: 1,028
Loc: NZ
Re: Inocybe insignis from Ohio tests positive for psilocybin [Re: mind.at.large] * 1
    #27395116 - 07/20/21 03:19 PM (10 months, 30 days ago)

Just had to say what beautiful images these are.


Extras: Filter Print Post Top
Jump to top Pages: 1 | 2 | Next >  [ show all ]

Shop: Kraken Kratom Red Vein Kratom   North Spore Cultivation Supplies, North Spore Mushroom Grow Kits & Cultivation Supplies   Left Coast Kratom Buy Kratom Extract, Kratom Powder For Sale   PhytoExtractum Buy Bali Kratom Powder, Kratom Powder for Sale, Maeng Da Thai Kratom Leaf Powder


Similar ThreadsPosterViewsRepliesLast post
* inocybe calamistrata. viscid 7,081 9 11/02/02 09:28 PM
by viscid
* Panaeolus papilionaceus baltazar 15,784 7 08/27/04 04:34 PM
by ivi
* Psilocybin shrooms spreading in Europe spores 5,858 2 06/20/01 11:29 AM
by spores
* Possible Inocybe Find... Need ID Help, Please RebelSteve33 1,810 6 06/20/03 09:59 AM
by ToxicMan
* Experiences with hunting in Ohio... Richard_D_James 1,411 2 02/15/02 08:57 PM
by Richard_D_James
* inocybe does any one have eat these before cactu 4,171 10 09/25/06 09:16 PM
by cactu
* Ohio Big Laughing Gyms HELP!!!! vandago 3,371 18 07/22/04 06:19 PM
by RoKiSdEaD
* inocybes wallace 1,083 4 06/25/05 10:43 PM
by PSiFr33k

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: ToxicMan, karode13, inski, Alan Rockefeller, Duggstar, TimmiT, Anglerfish, Tmethyl, Lucis, Doc9151
2,583 topic views. 7 members, 31 guests and 13 web crawlers are browsing this forum.
[ Print Topic | ]
Search this thread:

Copyright 1997-2022 Mind Media. Some rights reserved.

Generated in 0.045 seconds spending 0.01 seconds on 17 queries.