Home | Community | Message Board


This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Myyco.com Golden Teacher Liquid Culture For Sale   Mushroom-Hut Mono Tub Substrate   North Spore Bulk Substrate   MagicBag.co All-In-One Bags That Don't Suck   Original Sensible Seeds Bulk Cannabis Seeds   PhytoExtractum Kratom Powder for Sale   Kraken Kratom Red Vein Kratom   Left Coast Kratom Buy Kratom Extract   OlympusMyco.com Olympus Myco Bulk Substrate

Jump to first unread post Pages: 1
Offlinesemilancreator
Stranger
 User Gallery

Registered: 03/24/21
Posts: 64
Last seen: 2 days, 14 hours
The possible cultivation of Psilocybe Fimetaria * 1
    #27267578 - 03/24/21 02:34 PM (3 years, 1 month ago)

This is my first post on shroomery so first let me introduce myself.

I have been interested in psychdelic fungi for a solid 10 years now. In this time I have lurked a lot on shroomery and mycotopia for info about them but never posted nor did I take any effort in growing fungi myself. I did learn a lot about ID'ing in the wild and I found liberty caps a couple of times as well as some wavy caps but nothing much apart from 1 good trip.

Now to this year with the covid I searched for a new hobby and there was mushroomgrowing and hunting again. I felt it was my year and I went out to some spots I had a good feeling about. I found a bunch of libertycaps and panaeolus cinctulus but then I found as well, rare in the world but here in Netherlands common, Psilocybe Fimetaria:

Through facebook I contacted Alan who macroscopically confirmed the find. I took around 4 good and another 4 vague prints.

I have now put one of these prints to agar (LME+yeast) in a SAB. I just made one plate just to see if the print I used had any obvious contamination issues. The plate was inoculated at the 21st of March 2021 and now the 24th I see the tinies bit of growth. I am not able to capture it well on camera but surely there is something going on.Now as soon as I am able to get a better picture and a transfer I will post it here.

I have a plan in mind to see if I can get a solid agar culture going and then to put that to a bulk of manure and straw. CaptainFuture has done a similar thing with Psilocybe Liniformans and threw this sub (which was contaminated I believe) outside in the garden and alas that year Liniformans grew in his garden. Since Liniformans and Fimetaria are so close I figure a same kind of idea will be mine. First get a substrate going and then just toss this outside to see what happens. Also I might want to try a tub and maybe some flowering pots.

However, I am a fair noob when it comes to cultivation. Although I have a ton of theory in my head a lot of practical knowledge is missing and this is where maybe some of you guys can give tips on how to approach the cultivation of this species. Right now I have done 1 succesful cubensis grow from spores (agar>rye>coir/verm monotub) and am currently trying to recreate the indoor ovoid experiment by making a 'river bank' in thaw in a tub with spawn (if this pulls off as I hope I will post on this forum) as well as some more cube and tampanensis on rye on the way. I do know how to use a PC and how to agar however thats where it basicly ends. If you have any suggestions on how to approach the cultivation of Psilocybe Fimetaria it would be greatly admired.

Thanks a lot in advance,
Semilancreator

Edited by semilancreator (03/24/21 03:15 PM)

Extras: Filter Print Post Top
Offlinesemilancreator
Stranger
 User Gallery


Registered: 03/24/21
Posts: 64
Last seen: 2 days, 14 hours
Re: The possible cultivation of Psilocybe Fimetaria [Re: semilancreator] * 1
    #27276666 - 03/31/21 05:03 AM (3 years, 1 month ago)

Part two of this journey:

After a good week of nice slow but steady growth I woke up to see a tiny spot turned green. Probably I coudl have noticed it earlier (I thought it was just a normal tiny white myc spot before she turned trichey on me) and I also should not have waited so long with making a transfer.

So back to step one and inoculate a new plate. The plan is to make a transfer at day 5 only two days after germination (be it that the speedrate will be the same this time) and to keep transferring every 5 days or so for 3 plates or more to see if we can get a clean culture going on. If you have any tips on transfering plates made from wild prints let me know pls.

Mush love,
Semilancreator





https://

Extras: Filter Print Post Top
OfflineDERRAYLD
Constructus
Male User Gallery

Registered: 05/13/02
Posts: 10,170
Loc: South Africa
Last seen: 11 hours, 26 minutes
Trusted Cultivator
Re: The possible cultivation of Psilocybe Fimetaria [Re: semilancreator] * 1
    #27276671 - 03/31/21 05:15 AM (3 years, 1 month ago)

Is there not a portion that can be saved and transferred further rather than starting over?
Chances are you'll get trich again due to the dirty print.

Edited by DERRAYLD (03/31/21 05:15 AM)

Extras: Filter Print Post Top
Offlinesemilancreator
Stranger
 User Gallery


Registered: 03/24/21
Posts: 64
Last seen: 2 days, 14 hours
Re: The possible cultivation of Psilocybe Fimetaria [Re: DERRAYLD] * 1
    #27276691 - 03/31/21 05:52 AM (3 years, 1 month ago)

Quote:

DERRAYLD said:
Is there not a portion that can be saved and transferred further rather than starting over?
Chances are you'll get trich again due to the dirty print.




I was thinking about this but first I am a bit clumsy so I think I have a high chance of ruining my SAB if I transfer. Secondly I ve handled the plate and it even fell of its shelf once so prolly the whole inside is sporulated.
So I guess starting a new is my best guess. I still have enough prints and plates and am only 1.5 week into the project so I am not minding. Besides... this is more of an experiment/proof of concept rather than a serious grow.

Nonetheless thanks for the feedback!

Extras: Filter Print Post Top
Offlinesemilancreator
Stranger
 User Gallery


Registered: 03/24/21
Posts: 64
Last seen: 2 days, 14 hours
Re: The possible cultivation of Psilocybe Fimetaria [Re: semilancreator] * 1
    #27280393 - 04/24/21 12:30 PM (3 years, 25 days ago)

Hi people,

I hope you all have survived the fallout and have now safely returned to the mothership.
In Fimetaria land we have had some developments mainly that of unwantend moulds and bacteria :smile:.

This was the plate that got trich. I made one transfer which seemed to do good for a while but suddenly developed a shine.

From this plate I took two little samples which both grew but developed some bacteria of their own.


From the first I took one transfer. From the other which had tumbled over which made the transfer "coat" the agar which resulted in multiple new spots of mycelium I took 3 transfers.
I left the one of the older plates and touched it a couple of times to introduce contamination just to see how the mycelium will fair.

For science I will let this one sit for a month or so and take another picture to see what has happened.
That was it for now. I hope you like what you see and if you have any questions or remarks let me know.

Mush love,

Extras: Filter Print Post Top
Offlinesemilancreator
Stranger
 User Gallery


Registered: 03/24/21
Posts: 64
Last seen: 2 days, 14 hours
Re: The possible cultivation of Psilocybe Fimetaria [Re: semilancreator] * 1
    #27551973 - 11/21/21 04:03 AM (2 years, 5 months ago)

Well guys You van see by my abscense that something got in the way. Last year I dealt with some personal stuff and the whole fimetaria project went to ****.
This year however I did Find quite a bunch of fimetaria (for this check my thread in hunting and identification) and I brought home a small piece of dung to see if it would do something.

After some weeks in a small ceramic flower pot on my roof terrace left to the Dutch elements. Now after some weeks it has fruited. Although superduper tiny (like a lot of wild fimetaria) I think this is one of the first semi-cultivated fimetaria pictures out there.






In the coming month me and some others are gonna work on fimetaria again. I hope this thread can get going once more and this time with more contributors.

For now cheers,
Semi

Extras: Filter Print Post Top
InvisibleAssyrian
Stranger
Registered: 11/17/21
Posts: 159
Re: The possible cultivation of Psilocybe Fimetaria [Re: semilancreator] * 1
    #27552316 - 11/21/21 10:51 AM (2 years, 5 months ago)

Did you manage to get a clear plate? Or spore prints? The latter might help other experienced members try this challenge.

Extras: Filter Print Post Top
Offlinesmalltalk_canceled
Babnik
 User Gallery

Registered: 07/13/20
Posts: 2,906
Last seen: 6 hours, 25 minutes
Re: The possible cultivation of Psilocybe Fimetaria [Re: Assyrian] * 1
    #27723182 - 04/06/22 12:17 PM (2 years, 1 month ago)

well they can be grown! but mine seemed very weak

https://www.shroomery.org/forums/showflat.php/Number/27723181/vc/1#27723181


--------------------
Willpower is the one true virtue


Extras: Filter Print Post Top
Offlinesmalltalk_canceled
Babnik
 User Gallery

Registered: 07/13/20
Posts: 2,906
Last seen: 6 hours, 25 minutes
Re: The possible cultivation of Psilocybe Fimetaria [Re: smalltalk_canceled] * 1
    #27723306 - 04/06/22 02:04 PM (2 years, 1 month ago)

my cultivation project didnt use manure - maybe this is important in why firmetaria becomes potent or bruising. sounds completely random, but its all i have


--------------------
Willpower is the one true virtue


Extras: Filter Print Post Top
OfflineBobbins
Stranger
Registered: 02/02/22
Posts: 445
Last seen: 1 year, 7 months
Re: The possible cultivation of Psilocybe Fimetaria [Re: smalltalk_canceled] * 1
    #27729735 - 04/11/22 01:36 AM (2 years, 1 month ago)

Your found fruits look exactly like a liberty cap lookalike (except gills aren't dark of course) we get here that is non-psycoactive. Are you absolutely sure your source has been correctly identified?


--------------------
DeALeRsHrOoMs

Extras: Filter Print Post Top
Offlinesmalltalk_canceled
Babnik
 User Gallery

Registered: 07/13/20
Posts: 2,906
Last seen: 6 hours, 25 minutes
Re: The possible cultivation of Psilocybe Fimetaria [Re: Bobbins] * 1
    #27730307 - 04/11/22 01:53 PM (2 years, 1 month ago)

i dont have the competence to argue with a DNA test. all I know is I sent spores, cap fragments, to Alan, and the microscopy suggested semilanceata, while the dna sequence says fimetaria

how the fimetaria ended up in the picked collection (if you have read the thread) is unknown to me

but its obviously a lookalike fruiting under similar conditions


--------------------
Willpower is the one true virtue


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,392
Last seen: 2 days, 17 hours
Re: The possible cultivation of Psilocybe Fimetaria [Re: smalltalk_canceled] * 1
    #27732712 - 04/13/22 11:18 AM (2 years, 1 month ago)

Psilocybe fimetaria is closely related to Psilocybe semilanceata, and closely related species usually have the same or overlapping microscopic features.  Psilocybe fimetaria is very weak, and some collections don't have any psilocybin at all.

Here is the ITS sequence:  ACTTGGCTCGGTTGCAGCTGGTCCTCTCGAGGGCATGTGCTCGCCGTGTCATCTTTATCTCTCCACCTGTGCACCCTTTGTAGACCTGGATTAGTTAACTTTCCGAGGAAACTCGGTCGGGAGGATTGCTTTCACGAGCTCTCCTTGCAATTAAGCCCAGGCCTACGTTTTCATATACCCCAAAGTATGTAACAGAATGTATCATATGGCCTTGTGCCTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTCTTTTGCTGGCTTCGTCAAGAGGTCTGCTCCCCTTAAATGTATTAGCCGGTGCCCCGCGCAGAGCCGTCTATTGGTGTGATAATTATCTACGCCGTGGACGTCTGCATGAATGGGATTGCGCTGCTTCTAACCGTCCTTCACTGGACAACACAAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCAT

Extras: Filter Print Post Top
Offlinesemilancreator
Stranger
 User Gallery


Registered: 03/24/21
Posts: 64
Last seen: 2 days, 14 hours
Re: The possible cultivation of Psilocybe Fimetaria [Re: Alan Rockefeller] * 1
    #27738098 - 04/17/22 03:53 AM (2 years, 1 month ago)

What kind of research is there on non active fimetaria ? Have not seen any results on potent other than my very own test with miraculix. Would love to see more evidence!

Edited by semilancreator (04/17/22 03:54 AM)

Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,392
Last seen: 2 days, 17 hours
Re: The possible cultivation of Psilocybe Fimetaria [Re: semilancreator] * 1
    #27739286 - 04/17/22 07:42 PM (2 years, 1 month ago)

Quote:

semilancreator said:
What kind of research is there on non active fimetaria ? Have not seen any results on potent other than my very own test with miraculix. Would love to see more evidence!




I am a coathor on a new paper that has been submitted for publication which discusses it.

Extras: Filter Print Post Top
Jump to top Pages: 1

Shop: Myyco.com Golden Teacher Liquid Culture For Sale   Mushroom-Hut Mono Tub Substrate   North Spore Bulk Substrate   MagicBag.co All-In-One Bags That Don't Suck   Original Sensible Seeds Bulk Cannabis Seeds   PhytoExtractum Kratom Powder for Sale   Kraken Kratom Red Vein Kratom   Left Coast Kratom Buy Kratom Extract   OlympusMyco.com Olympus Myco Bulk Substrate


Similar ThreadsPosterViewsRepliesLast post
* Eric's Guide to Cultivating Psilocybe Azurescens/Cyanescens BigJohnson 4,098 2 03/09/03 03:21 AM
by BigJohnson
* Cultivated Psilocybe baeocystis WorkmanV 3,659 10 10/19/23 06:08 PM
by murderlabz
* Progress on the cultivation of Psilocybe violacea
( 1 2 3 4 all )
WorkmanV 12,001 62 07/19/02 10:20 AM
by DarkTranquility
* Non-Cubensis Indoor cultivations? Raadt 2,507 3 10/31/02 10:00 AM
by Raadt
* Psilocybe hispanica
( 1 2 3 4 5 6 all )
WorkmanV 23,764 112 11/05/23 12:38 PM
by smalltalk_canceled
* Psilocybe venenata - Japan
( 1 2 all )
WorkmanV 10,754 34 06/27/05 03:50 PM
by Schwip
* Cultivating Pans..Trops and Cyans.. ralphster44 2,790 13 06/05/01 06:02 PM
by WhereAbouts
* Re: thoughts on the cultivation psilocybe azurescens. John 1,255 1 01/20/00 07:37 PM
by Crobih

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: RogerRabbit, Pastywhyte, bodhisatta
2,060 topic views. 0 members, 2 guests and 4 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.02 seconds spending 0.004 seconds on 12 queries.