Home | Community | Message Board


High Mountain Compost
Please support our sponsors.

Mushrooms, Mycology and Psychedelics >> Advanced Mycology

Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Kraken Kratom Red Vein Kratom   Unfolding Nature Unfolding Nature: Being in the Implicate Order   Left Coast Kratom Buy Kratom Capsules, Buy Kratom Extract, Kratom Powder For Sale   Bridgetown Botanicals Bridgetown Botanicals, CBD Edibles   Original Sensible Seeds Bulk Cannabis Seeds, High THC Strains, USA West Coast Strains   PhytoExtractum Buy Bali Kratom Powder, Kratom Powder for Sale, Maeng Da Thai Kratom Leaf Powder   North Spore Cultivation Supplies, Injection Grain Bag, North Spore Mushroom Grow Kits & Cultivation Supplies   Amazon Agar, Autoclave, Cordyceps, Paul Stamets, Petri Dish, pH Test Strips, Reagent Testing Kit, Scales

Jump to first unread post. Pages: 1 | 2 | 3 | 4  [ show all ]
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
DNA barcoding class / interview with Adam Haritan * 7
    #26489902 - 02/17/20 02:19 PM (1 year, 2 months ago)

Adam Haritan creates excellent nature videos called Learn Your Land (https://www.facebook.com/learnyourland) and recently  attended one of my DNA barcoding classes and interviewed me afterwards, and made a really cool video about it. 

Even mentions the Shroomery in the introduction.

https://youtube.com/watch?feature=share&v=jWP0340LCP0


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
InvisibleThe_Brown_Wizard
what?
Male


Registered: 12/27/19
Posts: 188
Loc: Southeastern Carpathians Flag
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
    #26491102 - 02/18/20 05:18 AM (1 year, 2 months ago)

:popcorn:

good stuff man


--------------------
:scaryshroom: There's a weird fuck lurking in these woods :scaryshroom:


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineeLeSDenesS
Mycelium Expander
Male User Gallery


Folding@home Statistics
Registered: 05/25/11
Posts: 920
Last seen: 7 hours, 46 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: The_Brown_Wizard]
    #26491941 - 02/18/20 05:12 PM (1 year, 2 months ago)

nice man. Any chance you could make videos of these seminars?:smile:


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
Offlinefeldman114
Stragler


Registered: 09/06/19
Posts: 3,365
Loc: Bravos
Last seen: 1 year, 12 days
Re: DNA barcoding class / interview with Adam Haritan [Re: eLeSDenes]
    #26491950 - 02/18/20 05:18 PM (1 year, 2 months ago)

Thoroughly impressed here!
:thatsinteresting::tellmeastory:


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineSolipsis
m̶a̶d̶ disappointed scientist
Male User Gallery


Registered: 12/28/09
Posts: 3,343
Loc: the Neitherlands Flag
Last seen: 19 hours, 18 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: feldman114]
    #26492866 - 02/19/20 08:03 AM (1 year, 2 months ago)

That's really great, I noticed that video and posted it on 2 Discord servers i "officiate".
(Adam and Alan put together thats what i call something of a win-win)


Edited by Solipsis (02/19/20 08:04 AM)


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
InvisibleAndyHinton


Registered: 12/05/16
Posts: 434
Re: DNA barcoding class / interview with Adam Haritan [Re: Solipsis]
    #26506094 - 02/27/20 10:30 AM (1 year, 2 months ago)

Nice interview, thanks for posting. Glad to see you using the blueGel electrophoresis system, it's so compact and delightful. Your video of the class at CCL got me into community biology, which also took me away from an electronics interest. :wink:

I'm about to finish up my high fidelity implementation of this and hoped you would please weigh in on something. I have two sets of primer pairs: ITS 1F/ITS4 and NS7/LR3 according to the primer map below (source).



Given the ~1 kb read limit of Sanger sequencing and the need to trim junk off the ends, how feasible do you think it would be to splice together reads of NS7/ITS4 and ITS 1F/LR3? This is Subset 1 through Subset 2, and Subset 2 through Subset 3, with a big overlap in the region of interest. Would it run too close to the Sanger limit to produce worthwhile data in the SSU/LSU regions?

Please see the draft writeup and note that the PCR program is outdated. I must recalculate the parameters once I finalize the primer selection. I can buy more primers to sequence the subsets as shown, but it means an extra 30 assays of everything downstream of the PCR and an extra $150 in sequencing costs.


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: AndyHinton]
    #26507494 - 02/28/20 02:36 AM (1 year, 2 months ago)

Not many people use ssu anymore.    Its1f and lr3 work if DNA quality is good.  Usually people do its1f / its4 and l0r / lr7 and keep them separate. That gives a more useful part of LSU.


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
Offlinedark-goblin
Stranger


Registered: 01/16/20
Posts: 13
Last seen: 7 months, 27 days
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
    #26510521 - 03/01/20 12:38 AM (1 year, 2 months ago)

Any plans to take this to Europe? :-)


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: dark-goblin]
    #26511274 - 03/01/20 01:44 PM (1 year, 2 months ago)

Quote:

dark-goblin said:
Any plans to take this to Europe? :-)




Perhaps in November.


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
InvisibleAndyHinton


Registered: 12/05/16
Posts: 434
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
    #26512534 - 03/02/20 11:51 AM (1 year, 2 months ago)

Quote:

Alan Rockefeller said:
Not many people use ssu anymore.    Its1f and lr3 work if DNA quality is good.  Usually people do its1f / its4 and l0r / lr7 and keep them separate. That gives a more useful part of LSU.



Thanks. ITS 1F/LR3 it is, then. The DNA extracts are good quality, coming from pure cultures. The PCR product should also be fine, as I'm going to use Q5 high fidelity master mix.


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: AndyHinton] * 1
    #26513477 - 03/02/20 09:19 PM (1 year, 2 months ago)

Sounds good, if you don't get amplification with ITS1F/LR3 then try again with ITS1F/ITS4.  The shorter amplicon improves chances of success - works pretty well with LR3 if I use fresh mushrooms with lots of DNA.

ITS1F/ITS4 (I use the ITS1 sequencing primer) gives about 650 bases, while a forward read with ITS1 when you ran PCR with LR3 will get you around 1050 bases, including about 400 of the LSU.  If your goal is phylogeny with lots of sequences you generate, the additional LSU can improve bootstrap values.  If you are using lots of sequences from Genbank, the additional part of the LSU won't help much because most sequences in Genbank don't have the LSU tacked on to the end of the ITS.

BLASTing an ITS sequence with LSU attached is more difficult, because even 100% matches in Genbank will have a low query coverage and therefore be scored low in the BLAST results.  Often 100% matches won't make it into your top 100 BLAST matches.  There are two ways to work around this.  One is to tell BLAST to give you more like 1000 or 5000 results, and then sort by the ident column.  The other is to use a program like ITSx to parse the LSU out of your sequence and BLAST just the ITS1, 5.8S and ITS2.


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
InvisibleAndyHinton


Registered: 12/05/16
Posts: 434
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
    #26521385 - 03/06/20 11:52 PM (1 year, 1 month ago)

Thanks. It helps to have real numbers to go on, especially since I assumed 550 bp for ITS alone. The material I'm working with is pure identified mycelium, weighed out to the 330 mg parameters of the bead extraction. The production run PCRs will be with Q5 hifi enzymes.

I also quantified it at every step and want to start recording the average of three Qubit reads per sample. Then I can dilute the purified product in Tris-EDTA to the amount MGH DNA Core requires. Reading quickly at the sequencing primer guidelines it looks like the ITS 1F may be fine.

Thanks also for telling me about ITSx. My goal is to essentially to make bcrypt hashes of files on disk. I'm also looking at what ratio of saline : DMSO : glycerol would vitrify at minus 20 and have the least osmotic stress, just enough to stimulate the MAPK pathways. So a way to quickly extract ITS and make sure nobody labelled a tube wrong is great.


Edited by AndyHinton (03/06/20 11:55 PM)


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflinePTreeDish


Registered: 04/23/18
Posts: 317
Last seen: 7 hours, 3 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
    #26528291 - 03/11/20 12:29 AM (1 year, 1 month ago)

Hey Alan, congrats. After seeing the vid, I really want to take your Molecular Mycology class. It's exactly the information I've been researching and trying to piece together for the last couple of weeks.

Do you have any plans to teach a course in LA or publish one online for purchase? Could you direct me to any alternative learning sources with similar info that I could explore in the meantime?

Thanks in advance! :thumbup:


--------------------
@EverymanBio | EverymanBio Podcast | YouTube


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
    #26531986 - 03/13/20 03:18 AM (1 year, 1 month ago)

No immediate plans to head to southern California.  There isn't a lot of alternate learning material.

Some info I wrote on DNA sequencing is here:  https://ccl.miraheze.org/wiki/DNA_sequencing


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflinePTreeDish


Registered: 04/23/18
Posts: 317
Last seen: 7 hours, 3 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
    #26532013 - 03/13/20 04:07 AM (1 year, 1 month ago)

I found your FB group and nearly drove to Oakland to come attend the sequencing class once I found out it was the next day. :laugh:

I ended up watching the YouTube stream instead since it was cancelled. One part I really liked is how you would explain the procedure, but when you'd step away to check on something, the other guy (sorry, didn't catch his name), would add a little more background explanation behind what was actually happening.

We've got to get something going down here. The "biohackers meetup" in LA seems to be the largest semi-related group but they seem only focused on optimizing the self and not so much synthetic biology or microbiology science for that matter. I think we also have one lab that allows independent researchers but the fees are over $400/month and they don't advertise any sort of public educational training or events like you folks.


--------------------
@EverymanBio | EverymanBio Podcast | YouTube


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
    #26532015 - 03/13/20 04:17 AM (1 year, 1 month ago)

Hmm I don't know much about the LA biohacker scene, if they exist they are pretty quiet.


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflinePTreeDish


Registered: 04/23/18
Posts: 317
Last seen: 7 hours, 3 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
    #26537496 - 03/15/20 11:02 PM (1 year, 1 month ago)

Do you know if the CC labs wiki is down? I haven't been able to access your write-up or the dyi extract-n-amp protocol shown in the stream. Sent an email to the generic info@ but no response so far - it is the weekend and beer virus is a thing.


--------------------
@EverymanBio | EverymanBio Podcast | YouTube


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish] * 1
    #26545343 - 03/19/20 09:13 PM (1 year, 1 month ago)

It's a DNS issue, will get fixed eventually but for now you can use this address:

https://ccl.miraheze.org/wiki/DNA_sequencing


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflinePTreeDish


Registered: 04/23/18
Posts: 317
Last seen: 7 hours, 3 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
    #26545510 - 03/19/20 10:50 PM (1 year, 1 month ago)

Fantastic. Thanks.


--------------------
@EverymanBio | EverymanBio Podcast | YouTube


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflinePTreeDish


Registered: 04/23/18
Posts: 317
Last seen: 7 hours, 3 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
    #26956707 - 09/26/20 11:08 PM (7 months, 4 days ago)

I just got back my first set of sequences from MCLab and 4/8 came back all NNNN and the remainder don't appear to be usable (returned 0% match in BLAST). This was the gel.

Is there any place where I could get some help troubleshooting? I'm not on Facebook unfortunately.


--------------------
@EverymanBio | EverymanBio Podcast | YouTube


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
    #26957810 - 09/27/20 07:52 PM (7 months, 3 days ago)

I don't see any bands at all on the gel, so it's no surprise that the sequences didn't work.

Try PCR again with more cycles, different primers, lower annealing temperature, new DNA extraction, more template and 10x diluted template.  You can also load some 100 bp DNA ladder or just some primer + loading dye on to an unused lane on the gel to make sure the gel is working.  I usually keep re-running PCR until I get good bands on the gel, and then send it in.


Edit:  I saw your other thread and the bands look fine in the video, so the PCR is good.

Or maybe what you are seeing is just primer - try loading some primer in a lane and see how that goes.  The PCR bands you want should travel slower than primer.

Try sending the PCR products to Genewiz and see how that works.

How did you store the PCR products, and for how long, before sending them in?

Which PCR primers and sequencing primer did you use?


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflinePTreeDish


Registered: 04/23/18
Posts: 317
Last seen: 7 hours, 3 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
    #26958039 - 09/27/20 11:43 PM (7 months, 3 days ago)

The first lane was a ladder but I think I loaded it incorrectly so it didn't separate out correctly.

>  try loading some primer in a lane and see how that goes. The PCR bands you want should travel slower than primer.
Roger. Good idea for control.

> Try sending the PCR products to Genewiz and see how that works.
I wanted to but I think they require an affiliation with an institution to order, which I unfortunately don't have. Maybe that's changed or you know a workaround?

FYI, I also paid a little extra for MCLab to do PCR cleanup before sequencing.

> How did you store the PCR products, and for how long, before sending them in?
They sat for an hour while I ran the gel then I froze them -30c for couple of days before mailing.

> Which PCR primers and sequencing primer did you use?
I used the ITS 1F+4R from Odin.

As far as primers, lanes 2-4 were molds, 5 cordycep, 6 paneoulus, 7 polypore, 8 panellus and 9 psilocybe.

I'm reading that molds may def need diff primers and even diff extraction techniques. Any thoughts there?

I also made my own Tris HCL buffer but there was no EDTA in the mix and my pH meter was a cheap one on Amazon so I just bought some proper TE buffer for next round. I also didn't autoclave my mix.

What's the best way to get a sample from growth on agar into the tube? I tried a scalpel but it's hard to not get a little agar along with it. Was thinking to try sterile toothpicks next time.

Pestles are expensive so I tried melting a pipette tip, mashing it flat and using that. Bad idea? What do you think about glass rods?

How many times can I freeze/unfreeze my primers and taq before they start to degrade and become an issue?

Ever have any issues with your distilled water source?

Thanks man. If you have a Patreon or PayPal, happy to send you a donation for your time.


--------------------
@EverymanBio | EverymanBio Podcast | YouTube


Edited by PTreeDish (09/27/20 11:50 PM)


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
    #26958133 - 09/28/20 01:04 AM (7 months, 3 days ago)

Anyone can send samples to Genewiz.  PCR cleanup is necessary.

You can also get primers from Genewiz.

Molds work well with the same primers and DNA extraction.    If you want the PCR to ignore mold and ascomycete DNA, you can use the ITS4-B reverse primer.

I use a razor blade that has been sterilized with fire to scrape up a little mycelium from the top of the petri dish.

Pipette tips work well, glass rods sound like a great idea.

You can freeze/unfreeze them a lot of times, though it's best to minimize that.  I do that by keeping about a months worth of PCR master mix/primers in the fridge and keep the rest in the freezer.    Some freezers have a defrost cycle which melts everything periodically, which isn't ideal.

One time I forgot the PCR water when I was teaching a class so I just used tap water and it worked fine.

I have both Patreon and Paypal but I never charge for DNA sequencing or microscopy help.


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflinePTreeDish


Registered: 04/23/18
Posts: 317
Last seen: 7 hours, 3 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
    #26958825 - 09/28/20 03:26 PM (7 months, 2 days ago)

OK - I'm ordering the primers today. Few quick follow-ons if you don't mind.

> I use a razor blade that has been sterilized with fire to scrape up a little mycelium from the top of the petri dish.
How do you get the accumulated mycelium off the blade into the tube? Do you just scrape it off using the edge of the tube?

> Pipette tips work well, glass rods sound like a great idea.
Is using a paper towel + 2% bleach solution good enough for cleaning the rods between samples?

I mentioned freezing my PCR product before shipping. Good idea or bad? How do you keep your products before shipping?

Primers I'm ordering:
ITS1-F: CTTGGTCATTTAGAGGAAGTAA (fungi-specific)
ITS4B-R: CAGGAGACTTGTACACGGTCCAG (basidiomycete specific)
ITS4-R: TCCTCCGCTTATTGATATGC (general fungi reverse)

Genewiz questions:
* For pcr cleanup + sequencing, it looks like I need to make two separate orders for each but I can just send in one set of samples so long as all of the well labels match and are marked?
* What oligo format do you prefer, wet or dry? If wet, what matrix? Probably more useful is to know why I would want either.
* Not sure what the "normalization" option means but options are None, 100um or 50um.
* What is "scale"? Options are 25nm or 50nm. Guessing that is concentration of primer and will dictate dilution?
* I checked the box "retain oligos for sequencing". Is it still necessary to send in primer for sequencing then?

I know you didn't ask for it, but I sent you a Patron payment for your time. It's not much but I'll send more as I make progress.


--------------------
@EverymanBio | EverymanBio Podcast | YouTube


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflinePTreeDish


Registered: 04/23/18
Posts: 317
Last seen: 7 hours, 3 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
    #26968172 - 10/03/20 10:10 PM (6 months, 28 days ago)

For others who may find the thread, here are some of the answers to the Genewiz-specific questions:

> For pcr cleanup + sequencing, it looks like I need to make two separate orders for each but I can just send in one set of samples so long as all of the well labels match and are marked?
Yes.

> What oligo format do you prefer, wet or dry? If wet, what matrix? Probably more useful is to know why I would want either.
If dry, then you have to make your own dilution. I'm going with wet and h20 as the matrix. Removes one extra step for me.

> Not sure what the "normalization" option means but options are None, 100um or 50um.
This is the concentration. 100um is good to use because it will make dilution maths easier. For barcoding, 10uM primer is needed so I will create a dilution from the 100um.

> What is "scale"? Options are 25nm or 50nm.
Scale is quantity - the amount of total primer.

> I checked the box "retain oligos for sequencing". Is it still necessary to send in primer for sequencing then?
No - but it will cost a little more to have them make and retain the primer. They do already have some on-hand so check.


--------------------
@EverymanBio | EverymanBio Podcast | YouTube


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflinePTreeDish


Registered: 04/23/18
Posts: 317
Last seen: 7 hours, 3 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
    #27006963 - 10/27/20 08:58 PM (6 months, 4 days ago)

I finally had some success!

Here's a little infographic I created for the first specimen I ever successfully barcoded with the actual sequence and chromatogram:



Planning to publish the data for all my results on Genbank and iNaturalist this week.

Learning barcoding has helped me advance my skills and confidence to move onto my next milestone: synthesize psilocybin with yeast. I'm sharing the entire process on @everymanbio Instagram and YouTube.

Thanks Alan!


--------------------
@EverymanBio | EverymanBio Podcast | YouTube


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
    #27007322 - 10/27/20 11:57 PM (6 months, 4 days ago)

Quote:

PTreeDish said:
How do you get the accumulated mycelium off the blade into the tube? Do you just scrape it off using the edge of the tube?




Yes, or you can use a pipette tip or plastic pestle.  I use a plastic pestle to grind the mycelium.


Quote:

Is using a paper towel + 2% bleach solution good enough for cleaning the rods between samples?





I don't know - I put them in 10% bleach until I am ready to clean them, then autoclave.

Quote:

I mentioned freezing my PCR product before shipping. Good idea or bad? How do you keep your products before shipping?




Frozen unless I am shipping them right away.

Quote:

Primers I'm ordering:
ITS1-F: CTTGGTCATTTAGAGGAAGTAA (fungi-specific)
ITS4B-R: CAGGAGACTTGTACACGGTCCAG (basidiomycete specific)
ITS4-R: TCCTCCGCTTATTGATATGC (general fungi reverse)




Those are good.  Other good ones are ITS2 and ITS3, which you only use if you can't get the others to work.

Quote:


Genewiz questions:
* For pcr cleanup + sequencing, it looks like I need to make two separate orders for each but I can just send in one set of samples so long as all of the well labels match and are marked?




You just make one order - for the order type you select PCR product - Unpurified, which includes PCR cleanup.


Quote:

* What oligo format do you prefer, wet or dry? If wet, what matrix? Probably more useful is to know why I would want either.





Dry, because they are more stable that way.  I dilute to 100 micromolar with the cleanest water I can find, and store that in the coldest freezer I can find.  I keep 10 micromolar aliquots in the fridge for easy access and so I don't need to thaw the primer often.

Quote:

* Not sure what the "normalization" option means but options are None, 100um or 50um.




Not sure, that's not an option on IDT, which is where I order primers. 


Quote:

* What is "scale"? Options are 25nm or 50nm. Guessing that is concentration of primer and will dictate dilution?




That is how much total primer you are ordering.  25 is enough for around 2000 PCR reactions so it's probably enough.

Quote:


* I checked the box "retain oligos for sequencing". Is it still necessary to send in primer for sequencing then?




No.  But maybe you want them to send you the primer so you can use them in PCR, and then you'd send in some - except that they have the ITS primers in-house, so you don't need to send those, you can select them from a dropdown when you order sequencing.

Quote:

I know you didn't ask for it, but I sent you a Patron payment for your time. It's not much but I'll send more as I make progress.




Oh cool very much appreciated, though I am happy to help anyone sequence stuff any time.


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
    #27007331 - 10/28/20 12:02 AM (6 months, 4 days ago)

Congratulations on the success!

Could you post the sequence in text format so I can BLAST it too and see what I think about that ID?

You could also attach the chromatogram so I can verify that, but be aware that chromatograms contain your real name (or whatever name you gave Genewiz).  You can use sed or a hex editor to change that if you want to post chromatograms and still be anonymous.


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflinePTreeDish


Registered: 04/23/18
Posts: 317
Last seen: 7 hours, 3 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
    #27008018 - 10/28/20 12:07 PM (6 months, 3 days ago)

Sure thing.

1. Penicillium rubidurum

https://everymanbio.com/Myster.Mold-ITS1-F.ab1

NNNNNNNNNNNNNTNNGTNNTGACCTGCGGAGGATCATTACCGAGTGAGGACCCTCTGGGTCCAACCTCCCACCCGTGTT
TATCGTACCTTGTTGCTTCGGCGGGCCCGCCGCAAGGCCGCCGGGGGGCTTCCGTCCCCGGGCCCGTGCCCGCCGAAGAC
ACCTGTGAACGCTGTATGAAGATTGCAGTCTGAGCGACAAGCTAAATTTGTTAAAACTTTCAACAACGGATCTCTTGGTT
CCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACG
CACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGG
CCCTCGTCCCCCGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGC
TCTGTAGGCCCGGCCGGCGCCTGCCGACACCATCAATCTTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCT
GAACTTAAGCATNNNNNNNNNNNNNNNNNN


2. Penicillium camemberti

https://everymanbio.com/Cordycep-ITS1-F.ab1

NNNNNNNNNNTNGTAGGTGACCTGCGGAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTAT
TTTACCTTGTTGCTTCGGCGGGCCCGCCTTAACTGGCCGCCGGGGGGCTCACGCCCCCGGGCCCGCGCCCGCCGAAGACA
CCCTCGAACTCTGTCTGAAGATTGAAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTC
CGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCA
CATTGCGCCCCCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCC
CCGTCCTCCGATCTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTC
ACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATAC
CCGCTGAACTTAAGNNNNNNNNANNNGGGNNGNNANAAA

3. Cordyceps militaris

https://everymanbio.com/White.Mold-ITS1-F.ab1

NNNNNNNGNNTCGTTGGTGACCNGCGGAGGGANCATTAACGAGTTTTCCAACTCCCAACCCTTTGTGAACATACCTATCG
TTGCTTCGGCGGACTCGCCCAGCGCCTGGACGCGGGCCTGGGCGGCGGCCGTCGGGGGCCCCAAACACTGTATCTACCGG
TTTTTCTGAATCCGCCGCAAGGCAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAG
AACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCC
AGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACGTCCCCTGGGGGATGTCGGCGTTGGGGACCGGC
AGCACACCGCCGCCCCCGAAATGAAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTACCCCAACTCGCACCGGGACCC
AGACGTGGCCACGCCGTAAAACGCCCAACTCTGAACGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAANNNNN
NNNANNGGNNNNNNNAAAAAN


None of my basidiomycetes worked using ITS1F + ITS4B primer combo. They all came back "No Priming". Probably a user error on my part. I will try again next week.

I do really enjoy molds and am thinking of making them an area of focus. Do you have any thoughts on where I could contribute to the sciences in molds or where I may discover new molds?

Edit:

Side note, the-odin's fungal primer page lists the forward primer as ITS1F (TCCGTAGGTGAACCTGCGG) but that isn't ITS1F, it's ITS1. I emailed Josiah about it a couple of times because I think it might confuse people but he hasn't gotten back to me. Am I missing something or is the primer mislabeled on the page?


Edited by PTreeDish (10/29/20 11:14 PM)


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
Invisibleteknix
ﱞﱞﱞﱞﱞﱞﱞﱞﱞﱞﱞﱞﱞﱞﱞﱞﱞﱞﱞﱞﱞﱞﱞﱞﱞﱞﱞﱞﱞﱞﱞ
 User Gallery


Registered: 09/16/08
Posts: 11,814
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
    #27009315 - 10/28/20 11:18 PM (6 months, 3 days ago)

If you wanna sequence dueteromycota, it would be cool to get statistics from the soil samples morels are growing in. I think if you compared all the data from many various soil samples there might be a common denominator.


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: teknix]
    #27009385 - 10/29/20 12:09 AM (6 months, 3 days ago)

I went through your data and corrected it, here are the fixed sequences.

I had a friend film what I was doing - I am camped out in the middle of nowhere and the film is 2.5 gigs, I'll upload it when I am back in town.

The most exciting findings were in sequence # 1 - it's Penicillium labradorum, a recently described species of Penicillium that causes fungal infections in Labrador retrievers!  See this paper for details.

1) ACCTGCGGAaGGATCATTACCGAGTGAGGACCCTCTGGGTCCAACCTCCCACCCGTGTTTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGCAAGGCCGCCGGGGGGCTTCCGTCCCCGGGCCCGTGCCCGCCGAAGACACCTGTGAACGCTGTATGAAGATTGCAGTCTGAGCGACAAGCTAAATTTGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCTCGTCCCCCGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTGTAGGCCCGGCCGGCGCCTGCCGACACCATCAATCTTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCAT

2) TTGGTGAaCCaGCGGAGGGAtCATTAACGAGTTTTCCAACTCCCAACCCTTTGTGAACATACCTATCGTTGCTTCGGCGGACTCGCCCAGCGCCTGGACGCGGGCCTGGGCGGCGGCCGTCGGGGGCCCCAAACACTGTATCTACCGGTTTTTCTGAATCCGCCGCAAGGCAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACGTCCCCTGGGGGATGTCGGCGTTGGGGACCGGCAGCACACCGCCGCCCCCGAAATGAAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTACCCCAACTCGCACCGGGACCCAGACGTGGCCACGCCGTAAAACGCCCAACTCTGAACGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAgc

3) TAGGTGAACCTGCGGaAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTT
TACCTTGTTGCTTCGGCGGGCCCGCCTTAACTGGCCGCCGGGGGGCTCACGCCCCCGGGCCCGCGCCCGC
CGAAGACACCCTCGAACTCTGTCTGAAGATTGAAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAA
CAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAAAT
TCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGAGGGCATGCCTGTCCGAGC
GTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATCTCCGGGGGACGGGCCCGAA
AGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCG
GCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTA
AG


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflinePTreeDish


Registered: 04/23/18
Posts: 317
Last seen: 7 hours, 3 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
    #27009415 - 10/29/20 12:33 AM (6 months, 3 days ago)

Aw, thanks man. I had already done the cleanup per your video with snapgene but this will give me a chance to compare and see if I missed anything.

I saw that about the dog but not the paper! Poor dog. The paper says they euthanized him. :/ The paper is amazing though - super cool that I found this and it was only recently published! Def. makes me want to go out there and keep searching.

Do you have any opinions about whether to use iNaturalist vs. MushroomObserver for observations and GenBank cross-referencing? Seems superfluous to publish observations in two places. :shrug:


--------------------
@EverymanBio | EverymanBio Podcast | YouTube


Edited by PTreeDish (10/29/20 12:44 AM)


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
    #27009437 - 10/29/20 12:50 AM (6 months, 3 days ago)

Quote:

PTreeDish said:
None of my basidiomycetes worked using ITS1F + ITS4B primer combo. They all came back "No Priming". Probably a user error on my part. I will try again next week.




The ITS4-B primer gets about 200 more bases than ITS1 - it gets the first part of the LSU too.  It takes a bit longer to copy these extra bases, so try a longer extension time in your PCR program.  If that doesn't work, try lowering the annealing temperature so the primers stick a little harder.

You can also use gel electrophoresis to check to see if the PCR worked so you aren't sending in PCR products that aren't going to give you data.  Gel electrophoresis will show a band if you have a lot of DNA that is all the same length, indicating that the PCR was successful.    I use about 8 uL of the PCR product for a gel run, and then send in the rest if the gel indicates that it was successful.

Quote:

I do really enjoy molds and am thinking of making them an area of focus. Do you have any thoughts on where I could contribute to the sciences in molds or where I may discover new molds?




You almost did discover one here - but you were three years too late.  There's so many out there to be discovered, so keep doing what you are doing.

Quote:

Side note, the-odin's fungal primer page lists the forward primer as ITS1F (TCCGTAGGTGAACCTGCGG) but that isn't ITS1F, it's ITS1. I emailed Josiah about it a couple of times because I think it might confuse people but he hasn't gotten back to me. Am I missing something or is the primer mislabeled on the page?




ITS1-F is a forward primer for fungi - the F indicates that it's just for fungi, and it'll ignore other DNA like plant DNA.  Often people put a F at the end of a primer name to indicate that it's a forward primer.  The ODIN labeling means that it's the forward ITS primer rather than it being the ITS1-F fungal primer.  If they don't fix it I'll mention it to Josiah in person next time I stop by The Odin to pick up supplies.

Regarding iNaturalist and Mushroom Observer, they both work really well and I use both websites a lot.  Use which ever one you feel more comfortable with.  Mushroom Observer is a much lower volume website, with a more dedicated user base, so your observations are more likely to be seen by someone who will care about it.  With iNaturalist there are a lot more observations, so a lot of observations never get seen.

What I do is upload to Mushroom Observer, and then I periodically run the MO to iNaturalist import tool.  That way I only need to upload them once to get them on both sites.


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: teknix]
    #27009457 - 10/29/20 01:10 AM (6 months, 3 days ago)

Quote:

teknix said:
If you wanna sequence dueteromycota, it would be cool to get statistics from the soil samples morels are growing in. I think if you compared all the data from many various soil samples there might be a common denominator.





The best way to do that is next generation sequencing, which is quite a bit more expensive than the Sanger sequencing we are doing here.  It'll show you all of the DNA in the soil at once, you'll get many thousands of reads per run.

Sanger sequencing sequences one fungus at a time - you could plate out the soil and sequence what grows, though a lot of soil fungi won't grow on agar so you wouldn't get a full picture, and it'd be time consuming.


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflinePTreeDish


Registered: 04/23/18
Posts: 317
Last seen: 7 hours, 3 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
    #27009465 - 10/29/20 01:19 AM (6 months, 3 days ago)

Quote:

Gel electrophoresis will show a band if you have a lot of DNA that is all the same length, indicating that the PCR was successful. I use about 8 uL of the PCR product for a gel run, and then send in the rest if the gel indicates that it was successful.




I always use a gel - Genewiz also requires it to estimate DNA concentration. Here was the one for this run. Lane 1 is the ladder, 2-4 are the molds and 4-9 are the basiomycetes. They all looked good to me so I'm not sure what's up. Even if I mistakenly used the wrong reverse primer, I'd think I wouldn't get a band at all. I used 5uL of product with 2uL dye.



Quote:

You almost did discover one here - but you were three years too late.  There's so many out there to be discovered, so keep doing what you are doing.




Sweet. :thumbup:

Quote:

The ODIN labeling means that it's the forward ITS primer rather than it being the ITS1-F fungal primer.  If they don't fix it I'll mention it to Josiah in person next time I stop by The Odin to pick up supplies.




Totally makes sense. Just found it confusing as a newb. Sounds good re: Josiah. I saw you poking around the racks in one of his live streams not too long ago haha.

Quote:

What I do is upload to Mushroom Observer, and then I periodically run the MO to iNaturalist import tool.  That way I only need to upload them once to get them on both sites.





Oh, wow. Didn't know about that tool. That's a good strategy.


--------------------
@EverymanBio | EverymanBio Podcast | YouTube


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
    #27009558 - 10/29/20 03:55 AM (6 months, 3 days ago)

Since you got a band the PCR worked - occasionally the PCR will work but the sequencing will fail however.  You could try a different sequencing primer - its4b and its3 are options.  Its3 will only give you half the read, so only do that in case of emergency.

You can also talk to Genewiz tech support about it, they are pretty good and can help you find ways to make it work.


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflinePTreeDish


Registered: 04/23/18
Posts: 317
Last seen: 7 hours, 3 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
    #27010276 - 10/29/20 02:25 PM (6 months, 2 days ago)

I think what I'll try is its1-f/its4, its1-f/its4b, and its1/its4 for the same specimen and see what happens.

Genewiz support is great, especially Brittany who basically does the support for sequencing. They're giving me half-off on my sequencing this next round since I had so many failures.

I noticed in the sequences that you cleaned up that you flipped some of those bits such that it made the blast match 100%. How did you make the determination for the nucleotides that were either N or different from the closest match?


--------------------
@EverymanBio | EverymanBio Podcast | YouTube


Edited by PTreeDish (10/29/20 02:44 PM)


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
    #27010561 - 10/29/20 04:38 PM (6 months, 2 days ago)

Quote:

PTreeDish said:
I noticed in the sequences that you cleaned up that you flipped some of those bits such that it made the blast match 100%. How did you make the determination for the nucleotides that were either N or different from the closest match?





What I do is BLAST the sequence, then go through the alignment with the BLAST match with the highest ident value and check the chromatogram in the spots where my sequence differs from the closest BLAST match.  Often I can see something in the chromatogram that indicates that it needs to be changed to make the data as accurate as possible.

It's explained well in the video I made, I'll try to get it online today.


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflinePTreeDish


Registered: 04/23/18
Posts: 317
Last seen: 7 hours, 3 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
    #27010569 - 10/29/20 04:43 PM (6 months, 2 days ago)

Got it. Do you often encounter natural mutations though that might make an identical species vary slightly? Or are the variations from say a new strain not-so-subtle, meaning a higher standard deviation if that makes sense?


--------------------
@EverymanBio | EverymanBio Podcast | YouTube


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
    #27010639 - 10/29/20 05:24 PM (6 months, 2 days ago)

Quote:

PTreeDish said:
Got it. Do you often encounter natural mutations though that might make an identical species vary slightly? Or are the variations from say a new strain not-so-subtle, meaning a higher standard deviation if that makes sense?




ITS has no function, so mutations here won't affect the organism.  Mutations in the ITS do imply that there will be mutations elsewhere in the genome that will affect it, but the exact amount is random.  If you have a very different ITS, you can be sure there are lots of changes all over the genome.  Slight changes may or may not mean there are more meaningful mutations elsewhere.


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
    #27022057 - 11/04/20 08:14 PM (5 months, 27 days ago)

Here's the sequence analysis video I made the other day.



Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflinePTreeDish


Registered: 04/23/18
Posts: 317
Last seen: 7 hours, 3 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
    #27023013 - 11/05/20 12:32 PM (5 months, 26 days ago)

Wow, very cool! So thankful that you took the time to create this video and continue to educate us. 🙏 Seeing an example that is so close to home really helps the knowledge to connect.

Do you mind if I share the video on my socials?

I'm working on a GMO yeast to produce baeocystin and psilocybin. I set a goal to have a prototype in the next 90 days. Any interest in testing it or providing feedback? You've already done so much so I won't be offended if you stay on the sidelines!

Thanks again man.


--------------------
@EverymanBio | EverymanBio Podcast | YouTube


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
    #27023482 - 11/05/20 05:33 PM (5 months, 26 days ago)

Go ahead and share the video.

It would be fun to test your yeast.  Are those separate strains to produce baeocystin and psilocybin, or one strain does both?    Would be really neat if they were separate.


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflinePTreeDish


Registered: 04/23/18
Posts: 317
Last seen: 7 hours, 3 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
    #27023565 - 11/05/20 06:21 PM (5 months, 26 days ago)

There are five genes that define the metabolic process of converting glucose to psilocybin. Baeocystin is produced as the final precursor the last gene uses to produce psilocybin. The plan is to omit the final gene from the plasmid, mostly for legal reasons, but also because it should mean I generate an abundance of baeocystin and norbaocystin since there will be nothing to metabolize it. Adding the final gene to produce psilocybin will be trivial at that point.

Lot's of work to get there but it's currently 100% of where I'm spending my time. I'm pretty excited to see if I can get a pure sample of baocystin, try it and give it out for research.


--------------------
@EverymanBio | EverymanBio Podcast | YouTube


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflinePTreeDish


Registered: 04/23/18
Posts: 317
Last seen: 7 hours, 3 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
    #27031512 - 11/10/20 01:58 PM (5 months, 21 days ago)

How long does it usually take for a new Genbank sequence to process and be approved? I published a sequence to GenBank yesterday and it's still processing.

I'm wondering if it's delayed because I put Penicillium labradorum as the locus and source origin but it isn't in the NCBI taxonomy database yet.


--------------------
@EverymanBio | EverymanBio Podcast | YouTube


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
    #27032283 - 11/10/20 10:32 PM (5 months, 21 days ago)

Quote:

PTreeDish said:
How long does it usually take for a new Genbank sequence to process and be approved? I published a sequence to GenBank yesterday and it's still processing.

I'm wondering if it's delayed because I put Penicillium labradorum as the locus and source origin but it isn't in the NCBI taxonomy database yet.




It takes one week.

They'll add it to the database.


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflinePTreeDish


Registered: 04/23/18
Posts: 317
Last seen: 7 hours, 3 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
    #27032410 - 11/11/20 12:22 AM (5 months, 21 days ago)

Cool. I was just notified it finished processing. Says it'll be live on 11/15. When it's live, would you mind checking the record to ensure I added the appropriate metadata to be useful? Accession AMW241166


--------------------
@EverymanBio | EverymanBio Podcast | YouTube


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflinePTreeDish


Registered: 04/23/18
Posts: 317
Last seen: 7 hours, 3 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
    #27043996 - 11/17/20 04:41 PM (5 months, 14 days ago)

My GenBank submission is live.

Sadly, the baeocystin yeast project isn't feasible for a one-man team. It would cost over $10K just in gene synthesis and plasmid construction. :/ I'll need to find a simpler project to learn genetic engineering.


--------------------
@EverymanBio | EverymanBio Podcast | YouTube


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineBlueMushies
Lurker
I'm a teapot

Registered: 04/22/19
Posts: 134
Last seen: 1 month, 30 days
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
    #27061774 - 11/28/20 05:06 PM (5 months, 3 days ago)

I’m really interested in this and was wondering if you guys and point me in the direction on where to start and any equipment I can get my hands on to start learning will be great. Keep up the awesome work you guys truly inspiring.


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: BlueMushies]
    #27074401 - 12/06/20 01:45 AM (4 months, 27 days ago)

Quote:

BlueMushies said:
I’m really interested in this and was wondering if you guys and point me in the direction on where to start and any equipment I can get my hands on to start learning will be great. Keep up the awesome work you guys truly inspiring.





https://wiki.counterculturelabs.org/wiki/DNA_sequencing


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineBlueMushies
Lurker
I'm a teapot

Registered: 04/22/19
Posts: 134
Last seen: 1 month, 30 days
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
    #27075224 - 12/06/20 02:37 PM (4 months, 26 days ago)

Thank you Alan


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
InvisibleJawn876
 User Gallery
Registered: 09/12/18
Posts: 77
Re: DNA barcoding class / interview with Adam Haritan [Re: BlueMushies]
    #27095667 - 12/18/20 01:07 PM (4 months, 14 days ago)

Hey y'all, Just got some results back from Genewiz and half of my samples came back with the issue "no priming", while the rest look great. Just wondering where to go from here for troubleshooting? Most of the genewiz troubleshooting suggestions seem to be based around issues with the primers used. I used the ITS1F and ITS4R primers from the Odin, which worked great for half my samples and seem to work for everyone else. My gel electrophoresis results seem fine. Should I mess with annealing temperature/time? Or is it more likely issues with my extraction process? I used the protocol by Sigrid Jakob (https://docs.google.com/document/d/13B9OSE_ar_vWWZnHZegr2FROnMak78qHZxEZXc1E9jk/edit) Any suggestions/feedback are appreciated. Thanks and happy holidays


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflinePTreeDish


Registered: 04/23/18
Posts: 317
Last seen: 7 hours, 3 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: Jawn876]
    #27096707 - 12/18/20 11:20 PM (4 months, 14 days ago)

I've done ~25+ sequences now and I have about a 50% success rate. I do wonder how typical this is. I've not talked to a single person than claims a near perfect success rate.

You are welcome to see what all I've tried by looking at my sequencing data tracker:
https://docs.google.com/spreadsheets/d/1cVpw745ZRqTKRAINBVLIgbKZ4y4a-mXCbfuWa0cO9jw/edit#gid=0

It doesn't include my first 8 samples with MCLab which all failed. :smile:

Genewiz has a troubleshooting guide that covers the myriad of potential reasons for the "no priming" error here:
https://web.genewiz.com/hubfs/GA_Diagnosis_Sanger-sept19.pdf

I've found some of them difficult to test for, like DNA concentration, without additional equipment - most of which is out of my reach for a diyer working at-home. Like yourself, I've had good gels for every sample.

My understanding could be completely wrong here, but I think in the case of contaminations, where maybe you PCR'd more than one specie's ITS gene unintentionally, there appears to be only one band since bands from both organisms will be pretty close to the same size. I don't know of anyway to test for this ahead of time.

Do you know how to read the chromatographs? At some least some of my errors have been caused by contamination as evident by many overlapping base peaks.

Brittany at Genewiz has been incredible with helping me. She reruns a lot of my stuff multiple times and gives me discounts on retries. Unfortunately, I've not had a single retry ever work.

Happy Holidays!


--------------------
@EverymanBio | EverymanBio Podcast | YouTube


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
InvisibleJawn876
 User Gallery
Registered: 09/12/18
Posts: 77
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
    #27098369 - 12/19/20 09:50 PM (4 months, 13 days ago)

Quote:

I do wonder how typical this is. I've not talked to a single person than claims a near perfect success rate.




Me too, seems we have about the same success rate. I wonder what the success rate is in professional laboratories.
Thanks for sharing your tracker, cool to see. And thanks for that genewiz link, it has different troubleshooting suggestions than the one I get linked to from them ( https://clims4.genewiz.com/Common/TroubleShooting/en-US/No%20Priming.pdf )

Quote:

I think in the case of contaminations, where maybe you PCR'd more than one specie's ITS gene unintentionally, there appears to be only one band since bands from both organisms will be pretty close to the same size.




Solid theory. I have been doing the process in front of my flowhood but contamination is most likely present. Im pretty certain that if I put the same sample tissue on an agar dish it would not be perfectly clean mycelium. Maybe I'll do a run of all mycelium cultures from clean dishes and see if the results are better. I've been using tissue samples from wild specimens.

I think I understand how to clean up a good chromatogram but I don't really know much about analyzing the bunk ones. I'll do some reading, any suggested resources are appreciated.

I'd really like to get a better success rate with this. Maybe this is a shitty perspective but it feels like when factoring in a 50% success rate, it basically doubles the price of success so its almost $20 per result. I'm really interested in this but I'm not sure how sustainable this is for my budget. However, I am confident a better success rate is possible. Still not really sure what to do differently but I'll keep trying and learning.

Thanks for your thoughts!


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: Jawn876]
    #27101229 - 12/21/20 06:40 PM (4 months, 11 days ago)

No priming is a common problem, and I don't know what causes it.  Genewiz offers free repeats, and sometimes that helps but not usually.  Also try sequencing it in the reverse direction with the ITS4 primer.

Sometimes it's a bad DNA purification at Genewiz, which they can redo, but when you order a repeat or additional sequencing, they use the same DNA template and don't usually redo the purification step, though they can if they think it might be an issue.

It's a good idea to email them and send them a photo of the gel and ask what went wrong.  They might be able to help, and at the very least they'll give you some free sequences on your next order.

Re-running PCR is a good idea, with the same or different primers.  You could switch out ITS1F for ITS1 or ITS3, and switch out ITS4 for ITS2 or ITS5 or ITS4B or TW13.

You could also try a different gene like LSU or TEF1 or beta-tubulin, though if there aren't many sequences in Genbank for your genus then you might not have data to compare against.  It's always a good idea to check what's in Genbank before deciding what gene you want - for basidiomycetes, ITS is the right answer 90% of the time.


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineeLeSDenesS
Mycelium Expander
Male User Gallery


Folding@home Statistics
Registered: 05/25/11
Posts: 920
Last seen: 7 hours, 46 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
    #27101266 - 12/21/20 07:01 PM (4 months, 11 days ago)

Hey Alan,

You mentioned in your tutorial that genewiz offers sequencing after PCR. Does minION sequencer does the same thing?


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: eLeSDenes]
    #27101938 - 12/22/20 04:43 AM (4 months, 11 days ago)

Quote:

eLeSDenes said:
You mentioned in your tutorial that genewiz offers sequencing after PCR. Does minION sequencer does the same thing?




Sort of - A Minion run is expensive, $1000 if you use the whole flow cell.  Genewiz charges $8 to purify and sequence a PCR product.

The sequencing methodology is also different - the Sanger sequencing that Genewiz offers gives you an average of all of the copies of the DNA in the sample.  Minion reads DNA one strand at a time, so you get the individual data instead of the average of all data.  The data is usually similar, perhaps the same, it will be interesting to see how different it is. 

It is possible to run PCR with tags the attach to each strand of DNA, then pool a lot of PCR runs and sequence them all at once with the Minion, then use the tags to separate the data into each individual sample.  I am not sure how the price of doing that would compare to Sanger runs, it depends on how long you run it (how much of the flow cell you use up).


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineeLeSDenesS
Mycelium Expander
Male User Gallery


Folding@home Statistics
Registered: 05/25/11
Posts: 920
Last seen: 7 hours, 46 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
    #27103089 - 12/22/20 10:31 PM (4 months, 10 days ago)

Thanks for taking the time to answer. I though that the consumables for the minion are much cheaper - a single flow sell is $1000 as you said. I guess I just have to stick with sending the samples in for sequencing.


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflinePTreeDish


Registered: 04/23/18
Posts: 317
Last seen: 7 hours, 3 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
    #27181373 - 02/01/21 06:48 PM (3 months, 12 hours ago)

Hey Alan, I'm just finishing up another batch of 20 sequences and I've come across a few use-cases with using BLAST that have me stumped. I was hoping you might lend a hand.

The first one involves a mold I captured on an unidentified polypore. Here is the trace file:
https://github.com/EverymanBio/chromatograms/blob/main/trace_files/batch_3/16_dark.spider.web.mold-ITS1-F.ab1

The sequenced I BLASTED (lowercase are my edits):

>16_dark.spider.web.mold-ITS1-F
gtTTNCGTaGTGACCTGCGGAAGGAtCATTACCGAGTGAGGACCCTCTGGGTCCAACCTCCCACCCGTGTTTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGAAGACACCTGTGAACGCTGTATGAAGATTGCAGTCTGAGCGACAAGCTAAATTTGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCTCGTCCCCCGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTGCAGGCCCGGCCGGCGCCTGCCGACACCATCAATCTTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATAtca

The closest match is 99.07% to Penicillium rubidurum with what look like very clear differences between the top matches. What should I do in this case?

I have another sample just like this, matches 99% to Sistotrema sernanderi but with very clear single nucleotide differences.

Also, what do you when you have multiple 100% matches with different stated species in the results?

Finally, I have another one where it's not super clear in the trace file if I should have a single A or double AA in one place and having the AA would greatly improve the number of identical matches, even though there are also 100% matches with single A. What do you do here?

Thanks!


--------------------
@EverymanBio | EverymanBio Podcast | YouTube


Edited by PTreeDish (02/01/21 09:56 PM)


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
    #27181887 - 02/02/21 12:09 AM (3 months, 6 hours ago)

Here's the type collection sequence of Penicillium parvum:  https://www.ncbi.nlm.nih.gov/nuccore/NR_121241.1

Looks like your sequence is 4 bases away from that, ignore the mismatch where it's just a different number of repeating T's, as Sanger often has issues sequencing repeated bases.

It looks like some of the Penicillium rubidurum and P. parvum sequences in Genbank aren't accurately named, look for the sequences that say "from TYPE material". 

You also may want to check additional gene regions like LSU and beta-tubulin, you can check to see which genes of the type collection were sequenced.  If you really care that much.  If it's not critical you could just call it Penicillium parvum group or something like that.

Sistotrema is in the Hydnaceae so the Sistotrema sequence that you are matching is misnamed, probably a Sistotrema that had Penicillium growing on it.  Sometimes when I see these I email the sequence authors and let them know that they could update their record.  Often they do bulk uploads and contaminates like this slip through the cracks.

When you have multiple 100% matches to different species, you could look into the metadata of the sequences and see which ones you trust most.  Some might be from researchers actually studying that group and others from hard partying grad students who aren't paying a lot of attention to what they are uploading.  Getting sequences from reliable taxonomic papers is a good idea.  If you are interested in a certain genus you could build a FASTA file with sequences you have vetted so you don't have to sift through all of the misnamed stuff.   

Don't put too much stock in those names, they are helpful pointers but they are just suggestions for the most part.  Even sequences uploaded with the wrong name are useful as you can see where else in the world your organism occurs and get an idea of how much the sequence of a certain species can vary.

Sometimes the gene you are using isn't enough to ID to species - like with Fusarium ITS will get you just to group and you need both ITS and TEF1 to get to species.


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflinePTreeDish


Registered: 04/23/18
Posts: 317
Last seen: 7 hours, 3 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
    #27182987 - 02/02/21 04:07 PM (2 months, 30 days ago)

Thank you sir! A few follow-up questions if you don't mind.

What does "from TYPE material" indicate?
How can you tell some of the P. rubidurum and P. parvum aren't accurately named?
You said I could just call it "Penicillium parvum group" but isn't Penicillium parvum it's own species? Why would it be denoted as a group and why wouldn't it be "P. rubidurum group" or just "Penicillium sp."?

Much of these questions come from my desire to publish accurate data myself, so it is helpful.

Finally, under what circumstances is it worthwhile to go the extra distance and use other regions to get a more clear ID? For example, I have several that don't match 100%. Isn't there some possibility that it's a new species or new strain that others might want to know about?

I do wonder how useful my work and data are to the community. Is publishing my data all that useful?


--------------------
@EverymanBio | EverymanBio Podcast | YouTube


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
    #27183958 - 02/03/21 06:51 AM (2 months, 30 days ago)

"from TYPE material" means it's the holotype collection, so those sequences are guaranteed to be identified correctly.  There were other sequences with the same names as the type sequences, but different sequences, so those are probably misnamed.  Or they may not be misnamed but the sequence has errors, or it's a species with a variable sequence.

See https://en.wikipedia.org/wiki/Type_(biology)

Penicillium parvum is closely related to Penicillium rubidurum, so it's equally correct to call your mold Penicillium parvum group, P. rubidurum group or just Penicillium sp.

Whether it's worthwhile to sequence additional genes depends on which other genes are available in Genbank and how badly you want to know its identity.  If the type collection has other genes available it's more important to go for the other genes than if the data from the other genes is from other collections, since those might not be named correctly. 

It's very valuable to add your data to Genbank so other people can see what parts of the world that fungus exists in.    Even if you put a name on that is wrong, others might know the right name and still be able to use the data.  It also allows other people to contact you, perhaps you have something someone wants to study.

It happened twice today that someone else found the same thing I sequenced and put in Genbank and commented letting me know that an additional collection of my find turned up.

https://mushroomobserver.org/observer/show_observation/330293
https://mushroomobserver.org/observer/show_observation/116307


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
Offlinerud_dudl
Stranger
 User Gallery
Registered: 10/16/18
Posts: 78
Last seen: 1 day, 12 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
    #27184285 - 02/03/21 12:43 PM (2 months, 29 days ago)

Hi PTD and AR,
I hope it's ok to jump in on this conversation. I did some DNA work on P. cyanescens and P. azurescens many years ago (like over 20) hoping to find that they were identical (but only looking at LSU & SSU rDNA). They were not identical (but there were some unusual aberrations in the P. azurescens sequences), and although I submitted the sequences to NCBI's Genbank I never published the work. In fact, I was almost kicked out of my program for doing it and took a very long break from professional mycology due to the backlash. Anyway, at the time I had a number of chats about the molecular phylogenetics trend in mycology with a good friend who is an "amateur" mycologist (who incidentally specializes in our favourite genus). He is a more accomplished taxonomist than many trained mycologists that I know. I'll never forget what he told me: there are so many people submitting incorrectly labelled sequences to Genbank because they do not have the taxonomic skills. Focusing on type specimens is a good way around this problem (if the type has been sequenced) for sequence-based IDs and phylogenetic work (but the problem remains for population-level work)...anyway, I just wish that more people took taxonomy more seriously. R_D


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: rud_dudl]
    #27185493 - 02/04/21 02:48 AM (2 months, 29 days ago)

Quote:

rud_dudl said:
I hope it's ok to jump in on this conversation.





Welcome!

Quote:

I did some DNA work on P. cyanescens and P. azurescens many years ago (like over 20) hoping to find that they were identical (but only looking at LSU & SSU rDNA). They were not identical (but there were some unusual aberrations in the P. azurescens sequences), and although I submitted the sequences to NCBI's Genbank I never published the work.




I can't find your sequences in Genbank - are they still there?

Fortunately type ITS sequences of both Psilocybe cyanescens (an epitype collection designated in http://czechmycology.org/_cmo/CM64207.pdf) and Psilocybe azurescens (holotype) are in Genbank.  I agree with your finding that they are different.


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
Offlinerud_dudl
Stranger
 User Gallery
Registered: 10/16/18
Posts: 78
Last seen: 1 day, 12 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
    #27186459 - 02/04/21 04:48 PM (2 months, 28 days ago)

Hi Alan,
Quote:

Welcome!




Thanks, and great to be on this site (the shroomery)...there are lots of knowledgeable people here and the reach is amazing with people from all over the world harvesting Psilocybes (and allies)...incredible opportunities for furthering our understanding of psychoactive fungi...

Quote:

I can't find your sequences in Genbank - are they still there?




They are still there, I looked on Genbank for the first time in about 20 years (!). Only, I misrepresented my work (not intentionally), I only worked with 28S rDNA with those samples. I will pm you the link. In a nutshell we found two paralogous 28S sequences in the P. azurescens sample (only one of which was posted on Genbank) which suggests a possible recent speciation event.

Quote:

Fortunately type ITS sequences of both Psilocybe cyanescens (an epitype collection designated in http://czechmycology.org/_cmo/CM64207.pdf) and Psilocybe azurescens (holotype) are in Genbank.




Excellent to have solid ID's for reference standards...

Quote:

I agree with your finding that they are different.




Most definitely different, at least from my limited work. Myself and colleagues originally thought that Paul Stamets (in naming P. azurescens) was unnecessarily "splitting" what are more-or-less identical fungi, at least microscopically.


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: rud_dudl]
    #27189981 - 02/06/21 06:01 PM (2 months, 26 days ago)

I think P. azurescens is a good species because it's quite a bit larger than P. cyanescens/allenii, stronger, and has a very limited range while these other species spread all over the west coast.

It's common for closely related species to be the same microscopically.

It's also common for different copies of the nuclear ribosomal DNA repeat regions to not be synced up.  I haven't heard that this could be due to recent speciation, but you might be on to something.


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
Offlinerud_dudl
Stranger
 User Gallery
Registered: 10/16/18
Posts: 78
Last seen: 1 day, 12 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
    #27193469 - 02/08/21 12:50 PM (2 months, 24 days ago)

Hi Alan, I agree with you that P. azurescens is a solid species. At the time (20 years ago), myself and colleagues weren't sure.

Quote:

It's common for closely related species to be the same microscopically.




Totally, and on a related note, I am always amazed by the vast lexicon of descriptors for minute (if at all) differences in cystidia shape. Superficially what reads as totally different shapes (e.g. lageniform or sub-lageniform vs fusoid ampullaceous), may not be that different at all. 

Quote:

It's also common for different copies of the nuclear ribosomal DNA repeat regions to not be synced up.




I wish I could track down the alternate P. azurescens sequence because it was quite different from the 28S we published on Genbank (and the sample was clean, so no contaminating fungal DNA present, as far as I can remember). Anyway, if I can find the draft paper or that other sequence, I'll let you know.


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: rud_dudl]
    #27197009 - 02/10/21 11:08 AM (2 months, 22 days ago)

Here is a good reference for cystidia shape:  https://www.shroomery.org/forums/showflat.php/Cat/0/Number/9654208/an/0/page/0

Given the low variation in SSU sequences for Psilocybe, I am thinking that the highly divergent sequence was probably from a different organism.


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
Offlinerud_dudl
Stranger
 User Gallery
Registered: 10/16/18
Posts: 78
Last seen: 1 day, 12 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
    #27198726 - 02/11/21 09:03 AM (2 months, 21 days ago)

Hi Allan, thank you for the link to the Flora Agaricina Neerlandica excerpt. I really admire Else Vellinga's work. I have used those volumes to better understand some of the NA species that conform to more European expectations (e.g. Hygrophoraceae in Newfoundland and other parts of the North Atlantic). But never for the macro- and micro-morphology drawings. Her work seems more comprehensive than the Mushrooms to Genus series which is my "go to".

I haven't had any luck locating my work (yet) on P. cyanescens and P. azurescens but when I do, I'm happy to share that info!
R_D


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflinePTreeDish


Registered: 04/23/18
Posts: 317
Last seen: 7 hours, 3 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: rud_dudl]
    #27213666 - 02/18/21 09:14 PM (2 months, 14 days ago)

I wanted to quickly share some advice for folks like myself who had been seeing around a 50% success rate in sequencing...until now.

Having just completed my roughly 100th sequence attempt, I recently learned that my gels weren't working right and I was misreading them. Gel not working or not being interpreted correctly == lost time+money.

For a long time, I kept seeing fluorescent bands and interpreting them as the ITS band. Unfortunately, after quite a bit of troubleshooting (and some help from Damon Tighe), I discovered that most of the items I had purchased from Odin were defective.

I had been using their anhydrous TAE buffer mix. Turns out the dry stuff, especially the EDTA, doesn't dissolve in water all that well. This was causing large pH differentials in the buffer at each end of my gel box which resulted in the gels heating up to the point of melting. The fix was to buy pre-mixed 10x TAE concentrate. No more melting.

The other big issue was that I discovered in my testing that my loading dye was throwing off fluorescent bands without any PCR product. Once I replaced the loading dye from a new vendor, my untrained eye could immediately notice how much clearer and more differentiated the bands were. Also when I realized every gel I read up to that point was suspect.

I also bought two of the same DNA ladders from Odin and neither of them worked. They would either only form a single band, smear or just not show up at all.

I'm thankful for Josiah -  without his store, the higher price-of-entry to some diybio stuff might have scared me off. But I've spoken to a handful of folks now who've also had hit-or-miss quality issues and ended up recommending buying from a different vendor. Speaking of which, I would like to highly recommend: http://bioland-sci.com/

Finally, I've been sequencing a lot of molds lately and there have been a couple that I've had repeated PCR failures. I was advised that the pigmentation in the sample can impede the polymerase reaction. To combat this, I've tried diluting the sample in water some and that helps a little. It's something to keep in mind when working with cultured fungi.


Edited by PTreeDish (02/18/21 10:49 PM)


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
    #27214555 - 02/19/21 11:52 AM (2 months, 13 days ago)

Quote:

Speaking of which, I would like to highly recommend: http://bioland-sci.com




Have you tried contacting Josiah?

The Odin gets their products from other companies and they use it themselves often, so it's unlikely their stuff is the issue.  But if so they'll replace it.



Post Extras: Filter  Print Post  Remind Me! Notify Moderator
Offlinejzayner
Stranger
Registered: 02/19/21
Posts: 2
Last seen: 2 months, 13 days
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
    #27214673 - 02/19/21 12:51 PM (2 months, 13 days ago)

Hey, this is Josiah Zayner. CEO of The ODIN.

If anyone ever had issues with our products please contact us and we will gladly help you troubleshoot or replace your products or give a complete refund if you believe they are completely defective.

A few comments that might help with your issues

Generally, when a gel heats up it is because of resistance. A current is trying to flow between the electrodes and when there is a lack of electrolytes to carry the current or something creating a large resistance you get heat. Usually, if you are running your gel at too high a voltage(should be 150V or less generally) or current or don't have enough buffer in your gel or electrolytes in your buffer it will heat up.

We add 1mM EDTA to the buffer which is equal to about about 0.3g / liter. The Tris should make the pH above 8 and the EDTA should relatively dissolve easily. We have been using the same recipe for our buffer for years and it has run thousands of gels with no issue. I personally use the same materials we ship when running experiments and have never had issues with it. This does not to mean it couldn't have been a bad batch. If so please contact us and we will gladly replace it for free or give a refund.


The gel loading dye we use contains glycerol and bromophenol blue. Pretty much every dye on the market contains bromophenol blue(including bioland scientific). So seeing a difference between our dye is strange but maybe it was a bad batch? and we would gladly provide a refund or send you more.

Separation of DNA ladder depends on alot including the voltage used, length of time you run the gel and concentration of agar in the gel. We buy our ladder from a manufacturer and ship it exactly as we receive it. Usually ladders run strange because one used water instead of TAE in the gel or didn't run the gel long enough at a low enough voltage. Not adding enough ladder or DNA stain or method of visualization can all effect how you see it. It is possible we received a bad batch from our manufacturer and would gladly give you a refund or supply more.

As far as I can tell you never contacted us. Please do and we will gladly refund you for the products you think are defective. My team is going to perform QC again on the products you mentioned just to make sure we didn't miss something the first time.

Glad the other products you purchased from us worked great. We are doing our best as a small business to provide products at an affordable price and we appreciate your support.


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflinePTreeDish


Registered: 04/23/18
Posts: 317
Last seen: 7 hours, 3 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: jzayner]
    #27214827 - 02/19/21 02:49 PM (2 months, 13 days ago)

Hey Josiah, appreciate you jumping in.

Let me first say that I thank you for what you've done for the diy community. As mentioned before, I doubt I would have gotten up to speed so quickly without your store and videos. I also have a ton of respect for small businesses and I know how challenging it can be, especially in this last year. Kudos for addressing these issues head-on.

I do want to address a few quality issues that I've had. With one exception, you or someone on your team addressed it each time. Other times, I just replaced the product and that resolved my issues.

The first issue I had was with my first order. I was sent several reagents and somewhere between packaging and shipping, one or more lids came loose and the contents spilled into the zip-lock. I emailed you about it and you replaced it all, no questions asked.

On another occasion, I emailed you because one sticker said "Freeze immediately" and another instruction set said to leave at room temp. Someone on your staff clarified that for me.

I also reached out to ask if you could clarify whether the fungal ITS1F primer was ITS1 (forward) or a different primer that also happens to go by the ITS1F name but has a different sequence. A couple of times I emailed to follow up on this and no one responded. There is more color behind this confusion somewhere earlier in this thread and Alan said he would try and mention it to you directly. I never heard anything back.

I also recently ordered a refill kit and the E. coli was dead on arrival. I didn't email you because well, its possible maybe I did something wrong? But I ordered a culture of E. coli from Carolina and it worked right off the bat. So who knows what happened there.

In regards to the TAE, if it isn't fully dissolved, it will cause a large measurable pH differential at ends of the electrode and that will result in the gel melting. Is that a problem with your mix? I don't know. It could be that the TAE mix needs a bit of heat for it to fully dissolve, though I didn't see that mentioned anywhere. I do know that once I replaced it with a premixed aqueous solution from another vendor, my gels stopped melting. FYI, I use a 1% gel and I use a minipcr bluegel with fixed voltage. No issues at all with your agarose.

When I run a gel with just your loading dye (no PCR product) and the loading dye from another vendor, the Odin loading dye shows a fluorescent band, the other does not.

I've also tried two of the ladders from you and both did not perform well. Here's a video that actually demonstrates the issues with the Odin ladder (first lane) and loading dye:
https://www.youtube.com/watch?v=LIiFxp9hLEI

You can see how all of the lanes show a fluorescent band, but if you look closely (lane #4 for example), you'll see the real ITS band faintly underneath the bright band. As I mentioned before, using a different loading dye from another vendor reveals completely different results. With the Odin loading dye, I always see a fluorescent band even without any PCR product mixed in.

Quote:

Glad the other products you purchased from us worked great. We are doing our best as a small business to provide products at an affordable price and we appreciate your support.





I really appreciate you jumping in and I respect the challenges that come with what you're doing and the kinds of people (noobs like myself) you are working with.

I hope this adds some color to the conversation. And since we are both working on a similar mission to make science more accessible to all, I'm happy to help in whatever way I can to build you up - not tear you down.

Best,

Josh


--------------------
@EverymanBio | EverymanBio Podcast | YouTube


Edited by PTreeDish (02/19/21 02:57 PM)


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
Offlinejzayner
Stranger
Registered: 02/19/21
Posts: 2
Last seen: 2 months, 13 days
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
    #27215109 - 02/19/21 05:42 PM (2 months, 13 days ago)

I have been this stuff for near 20 years now and have had alot of things go wrong. Some or them unexplained. I think alot of times we want to go for the simplest explaination, "It probably wasn't me so it must be the reagent." The truth is that it can be so many things that we might have missed at the time. Why I recommend reaching out to our company as we can help you with maybe something you are missing. Maybe some insight and advice from 20 years of messing up.

We quality control everything we produce in house. Extensively. Obviously, we aren't perfect we make mistakes but your supplies are one of hundreds we send out each week and the majority of those don't have issues. Again, we make mistakes. It's impossible to do anything at scale and not make mistakes.

Honestly, I have never seen anything like that gel in that video. It looks like DNA stain is moving through the gel as you can see the differential in fluorescence between the rest of the gel and the loaded lanes. Are you sure it is the loading dye and not something in your PCR reaction? Have you run the dye by itself? It could also have something to do with your excitation/emission wavelengths for your gel stain visualization. Which could also be the reason you aren't seeing the ladder? Maybe?

What excitation wavelength/ emission filter wavelength are you using? Have you been able to visualize anything yet on your gels well? Have you tried loading extra ladder? I use the same ladder we sell all the time. I have left the ladder out on the bench for months at a time with no ill effect. It's a pretty damn robust ladder. We buy it bulk from a major manufacturer so you can imagine the last thing I personally would blame would be the ladder. Though it is a possibility.

We ship freeze dried E. coli that is extensively quality controlled, like extensively because it is such a unique procedure. We remake it every few weeks even though it lasts months. We have tested how well it survives in different temperatures with the lid on and off and many other variables. So it is strange that it was dead but it is possible. Carolina ships stabs I think, so the methods for growing are completely different. If it is your first time working with freeze dried bacteria I can understand but if you contacted us we could help or ship more!

The sequence for the ITS primers are on our website page you ordered from and so can be compared to whatever paper or document you want. That was probably not responded to because of that.

I wouldn't recommend using TAE or any buffer that's not fully dissolved. Shake it and heat it until it is dissolved. It doesn't make any sense why that alone would cause a pH differential. Agarose gel electrophoresis is a continuous buffer system meaning that diffusion alone would move molecules across the gel box and so a pH differential from small amounts of undissolved buffer being located at just one side of the box doesn't seem likely. Are you sure you're not just measuring the oxidation of the electrodes or miss-measured the pH? Again, myself and lots of others use this buffer all the time and have never had issues. Same recipe for years. Not saying it's not possible that the issue is on our end.

As you become more battle worn you start to realize that it's usually not the reagents that are the problem but something else that is maybe not your fault but maybe you missed. This is why I ask to email me/us. We can help make sure you didn't miss anything even if you are an expert.

I'm not trying to rip you off or sell you defective product. We don't sell faulty products but our products might have a learning curve because we optimize for things like price, shelf and shipping stability. And if by chance something bad made it past our quality control we will definitely make it right by you. Honestly, our documentation and protocols could be better but we don't have unlimited money and humans to get that done. We are doing our best.

I just swung by this forum because someone mentioned this post and won't be back to read a response so please email me at case@the-odin.com so I can make things right. I will personally help you troubleshoot so you can have functional working products. Same goes for anyone who reads this who wants help, email me. We make mistakes but even if we don't we will try and help you.


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflinePTreeDish


Registered: 04/23/18
Posts: 317
Last seen: 7 hours, 3 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: jzayner]
    #27215254 - 02/19/21 07:00 PM (2 months, 13 days ago)

I answered many of your questions in my aforementioned post and some of your other responses, well, I won't get into anymore. Based on how you responded to some of what I said, you either didn't read what I wrote or we're just not understanding one another. It's cool. It's clear where you stand and let's just leave it at that.


--------------------
@EverymanBio | EverymanBio Podcast | YouTube


Edited by PTreeDish (02/19/21 07:05 PM)


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
    #27215988 - 02/20/21 05:28 AM (2 months, 13 days ago)

The Odin's ITS1F primer is ITS1, the F in this case means forward.  There is also an ITS1-F forward primer that is different and selects for just fungi.  ITS1 can be used to sequence plants as well, and ITS1-F can sequence the fungi in a plant/fungi mixture by ignoring the plant DNA.  Most people use ITS1-F to sequence fungi since it's more specific, but ITS1 works just as well 99% of the time.

Regarding the gel, it will melt if the resistance of the buffer is too low, causing excess current to flow.  Measuring it with an ohm meter can tell you how much current will flow at the voltage you are using.    You could also put an ammeter in series with your gelbox to see how much current really is flowing. 

The DNA migrates through the gel based on voltage rather than current, so using higher resistance buffers allows you to turn up the voltage without melting the gel.  Lower voltages give nicer gels, but when testing PCR products you are only looking for a yes/no answer, so turning up the voltage is fine, as long as the gel doesn't melt.


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflinePTreeDish


Registered: 04/23/18
Posts: 317
Last seen: 7 hours, 3 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
    #27217148 - 02/20/21 07:26 PM (2 months, 12 days ago)

We hashed out the ambiguity about the primers earlier in the thread. For newcomers, it can be confusing to disambiguate and I just thought some sort of clarification on the page might of been helpful.

As I mentioned before, I use the MiniPCR Bluegel box which has an unmodifiable fixed voltage. After much troubleshooting, I realized that my gel was melting because my TAE mix wasn't fully dissolving. No matter how hard or how long I shook it, I could still see tiny particles suspended in solution. This was confirmed by placing a pH probe at each end of the gel box after running for a while and observing a large differential, confirming the high resistance as you mentioned.

Once I replaced the buffer with an aqueous premix, the gel stopped melting and there was no longer a pH differential. I was told the EDTA in the dry mix is known to require a higher temp for solubility. I'm not blaming the vendor or saying the only solution is to replace your buffer. I just wanted to share my learning that one should double check their buffer is fully dissolved. That was a costly lesson for me.


--------------------
@EverymanBio | EverymanBio Podcast | YouTube


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflinePTreeDish


Registered: 04/23/18
Posts: 317
Last seen: 7 hours, 3 minutes
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
    #27285781 - 04/29/21 12:02 AM (7 days, 7 hours ago)

Does anyone have an issue with the borate in their TBE running buffer routinely dropping out of solution? Borate has such a high melting point, I find it annoying to have to reheat the solution to such a high temp to get it re-dissolve every time I want to barcode something.

Also, this might be too complex of a question here, but I want to learn more about generating phylogenetic trees. Is there a beginner-friendly tutorial? I don't wish to just generate a pretty graph - I'd like to understand it.

One form of question I'd like to be able to answer is: which species is a closer genetic relative to P. cubensis: A. bisporus or L. edodes? There seem to be many ways to go about solving this that are over my head. Even a "go read up on blah" would be helpful. Thanks!


--------------------
@EverymanBio | EverymanBio Podcast | YouTube


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 46,539
Last seen: 1 day, 13 hours
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
    #27292847 - 05/03/21 09:55 PM (2 days, 10 hours ago)

I haven't had that problem with TBE, but you could also just use borax as the buffer and it actually works better.  I wonder if your concentration is too high, perhaps you are using a stock solution meant to be diluted?

See http://bitesizebio.com/25078/faster-even-cooler-dna-gels/

and https://bitesizebio.com/507/faster-gels/


Post Extras: Filter  Print Post  Remind Me! Notify Moderator
Jump to top. Pages: 1 | 2 | 3 | 4  [ show all ]

Shop: Kraken Kratom Red Vein Kratom   Unfolding Nature Unfolding Nature: Being in the Implicate Order   Left Coast Kratom Buy Kratom Capsules, Buy Kratom Extract, Kratom Powder For Sale   Bridgetown Botanicals Bridgetown Botanicals, CBD Edibles   Original Sensible Seeds Bulk Cannabis Seeds, High THC Strains, USA West Coast Strains   PhytoExtractum Buy Bali Kratom Powder, Kratom Powder for Sale, Maeng Da Thai Kratom Leaf Powder   North Spore Cultivation Supplies, Injection Grain Bag, North Spore Mushroom Grow Kits & Cultivation Supplies   Amazon Agar, Autoclave, Cordyceps, Paul Stamets, Petri Dish, pH Test Strips, Reagent Testing Kit, Scales

Mushrooms, Mycology and Psychedelics >> Advanced Mycology

Similar ThreadsPosterViewsRepliesLast post
* Video: DNA Barcoding of Mushrooms Alan RockefellerM 837 9 06/29/19 10:18 AM
by Alan Rockefeller
* Video: Using DNA Barcoding to Identify Mushrooms, starring Alan Rockefeller Alan RockefellerM 1,819 15 12/08/17 06:30 PM
by fishy1
* PCR & DNA Barcoding PTreeDish 504 11 11/03/20 06:52 PM
by PTreeDish
* Amplifying DNA from Prints or Syringes 24sevenZed 1,147 12 09/05/17 01:14 AM
by Cheriwalsh7
* The Shroomery Strain DNA-Length Analysis Project!
( 1 2 3 all )
BlimeyGrimey 8,353 46 11/28/10 10:54 AM
by Feelers
* DNA Analysis: A practical howto
( 1 2 all )
Alan RockefellerM 5,203 25 11/27/10 02:37 PM
by IGNVS
* Junk DNA in Ps. Cubesnis c10h12n2o 1,491 17 06/18/17 10:40 AM
by bodhisatta
* Mushroom DNA question MushroomMarkk 1,300 5 01/11/10 12:56 AM
by MushroomMarkk

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: RogerRabbit, cronicr, Pastywhyte, bodhisatta
3,699 topic views. 1 members, 2 guests and 4 web crawlers are browsing this forum.
[ Print Topic ]
Search this thread:
Cannabis Seeds - Original Sensible Seeds
Please support our sponsors.

Copyright 1997-2021 Mind Media. Some rights reserved.

Generated in 0.061 seconds spending 0.012 seconds on 16 queries.