|
Alan Rockefeller
Mycologist

Registered: 03/10/07
Posts: 48,276
Last seen: 30 minutes, 52 seconds
|
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
#26957810 - 09/27/20 05:52 PM (3 years, 3 months ago) |
|
|
I don't see any bands at all on the gel, so it's no surprise that the sequences didn't work.
Try PCR again with more cycles, different primers, lower annealing temperature, new DNA extraction, more template and 10x diluted template. You can also load some 100 bp DNA ladder or just some primer + loading dye on to an unused lane on the gel to make sure the gel is working. I usually keep re-running PCR until I get good bands on the gel, and then send it in.
Edit: I saw your other thread and the bands look fine in the video, so the PCR is good.
Or maybe what you are seeing is just primer - try loading some primer in a lane and see how that goes. The PCR bands you want should travel slower than primer.
Try sending the PCR products to Genewiz and see how that works.
How did you store the PCR products, and for how long, before sending them in?
Which PCR primers and sequencing primer did you use?
|
PTreeDish



Registered: 04/22/18
Posts: 353
Last seen: 3 months, 15 days
|
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
#26958039 - 09/27/20 09:43 PM (3 years, 3 months ago) |
|
|
The first lane was a ladder but I think I loaded it incorrectly so it didn't separate out correctly.
> try loading some primer in a lane and see how that goes. The PCR bands you want should travel slower than primer. Roger. Good idea for control.
> Try sending the PCR products to Genewiz and see how that works. I wanted to but I think they require an affiliation with an institution to order, which I unfortunately don't have. Maybe that's changed or you know a workaround?
FYI, I also paid a little extra for MCLab to do PCR cleanup before sequencing.
> How did you store the PCR products, and for how long, before sending them in? They sat for an hour while I ran the gel then I froze them -30c for couple of days before mailing.
> Which PCR primers and sequencing primer did you use? I used the ITS 1F+4R from Odin.
As far as primers, lanes 2-4 were molds, 5 cordycep, 6 paneoulus, 7 polypore, 8 panellus and 9 psilocybe.
I'm reading that molds may def need diff primers and even diff extraction techniques. Any thoughts there?
I also made my own Tris HCL buffer but there was no EDTA in the mix and my pH meter was a cheap one on Amazon so I just bought some proper TE buffer for next round. I also didn't autoclave my mix.
What's the best way to get a sample from growth on agar into the tube? I tried a scalpel but it's hard to not get a little agar along with it. Was thinking to try sterile toothpicks next time.
Pestles are expensive so I tried melting a pipette tip, mashing it flat and using that. Bad idea? What do you think about glass rods?
How many times can I freeze/unfreeze my primers and taq before they start to degrade and become an issue?
Ever have any issues with your distilled water source?
Thanks man. If you have a Patreon or PayPal, happy to send you a donation for your time.
Edited by PTreeDish (09/27/20 09:50 PM)
|
Alan Rockefeller
Mycologist

Registered: 03/10/07
Posts: 48,276
Last seen: 30 minutes, 52 seconds
|
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
#26958133 - 09/27/20 11:04 PM (3 years, 3 months ago) |
|
|
Anyone can send samples to Genewiz. PCR cleanup is necessary.
You can also get primers from Genewiz.
Molds work well with the same primers and DNA extraction. If you want the PCR to ignore mold and ascomycete DNA, you can use the ITS4-B reverse primer.
I use a razor blade that has been sterilized with fire to scrape up a little mycelium from the top of the petri dish.
Pipette tips work well, glass rods sound like a great idea.
You can freeze/unfreeze them a lot of times, though it's best to minimize that. I do that by keeping about a months worth of PCR master mix/primers in the fridge and keep the rest in the freezer. Some freezers have a defrost cycle which melts everything periodically, which isn't ideal.
One time I forgot the PCR water when I was teaching a class so I just used tap water and it worked fine.
I have both Patreon and Paypal but I never charge for DNA sequencing or microscopy help.
|
PTreeDish



Registered: 04/22/18
Posts: 353
Last seen: 3 months, 15 days
|
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
#26958825 - 09/28/20 01:26 PM (3 years, 3 months ago) |
|
|
OK - I'm ordering the primers today. Few quick follow-ons if you don't mind.
> I use a razor blade that has been sterilized with fire to scrape up a little mycelium from the top of the petri dish. How do you get the accumulated mycelium off the blade into the tube? Do you just scrape it off using the edge of the tube?
> Pipette tips work well, glass rods sound like a great idea. Is using a paper towel + 2% bleach solution good enough for cleaning the rods between samples?
I mentioned freezing my PCR product before shipping. Good idea or bad? How do you keep your products before shipping?
Primers I'm ordering: ITS1-F: CTTGGTCATTTAGAGGAAGTAA (fungi-specific) ITS4B-R: CAGGAGACTTGTACACGGTCCAG (basidiomycete specific) ITS4-R: TCCTCCGCTTATTGATATGC (general fungi reverse)
Genewiz questions: * For pcr cleanup + sequencing, it looks like I need to make two separate orders for each but I can just send in one set of samples so long as all of the well labels match and are marked? * What oligo format do you prefer, wet or dry? If wet, what matrix? Probably more useful is to know why I would want either. * Not sure what the "normalization" option means but options are None, 100um or 50um. * What is "scale"? Options are 25nm or 50nm. Guessing that is concentration of primer and will dictate dilution? * I checked the box "retain oligos for sequencing". Is it still necessary to send in primer for sequencing then?
I know you didn't ask for it, but I sent you a Patron payment for your time. It's not much but I'll send more as I make progress.
|
PTreeDish



Registered: 04/22/18
Posts: 353
Last seen: 3 months, 15 days
|
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
#26968172 - 10/03/20 08:10 PM (3 years, 3 months ago) |
|
|
For others who may find the thread, here are some of the answers to the Genewiz-specific questions:
> For pcr cleanup + sequencing, it looks like I need to make two separate orders for each but I can just send in one set of samples so long as all of the well labels match and are marked? Yes.
> What oligo format do you prefer, wet or dry? If wet, what matrix? Probably more useful is to know why I would want either. If dry, then you have to make your own dilution. I'm going with wet and h20 as the matrix. Removes one extra step for me.
> Not sure what the "normalization" option means but options are None, 100um or 50um. This is the concentration. 100um is good to use because it will make dilution maths easier. For barcoding, 10uM primer is needed so I will create a dilution from the 100um.
> What is "scale"? Options are 25nm or 50nm. Scale is quantity - the amount of total primer.
> I checked the box "retain oligos for sequencing". Is it still necessary to send in primer for sequencing then? No - but it will cost a little more to have them make and retain the primer. They do already have some on-hand so check.
|
PTreeDish



Registered: 04/22/18
Posts: 353
Last seen: 3 months, 15 days
|
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
#27006963 - 10/27/20 06:58 PM (3 years, 3 months ago) |
|
|
I finally had some success!
Here's a little infographic I created for the first specimen I ever successfully barcoded with the actual sequence and chromatogram:

Planning to publish the data for all my results on Genbank and iNaturalist this week.
Learning barcoding has helped me advance my skills and confidence to move onto my next milestone: synthesize psilocybin with yeast. I'm sharing the entire process on @everymanbio Instagram and YouTube.
Thanks Alan!
|
Alan Rockefeller
Mycologist

Registered: 03/10/07
Posts: 48,276
Last seen: 30 minutes, 52 seconds
|
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
#27007322 - 10/27/20 09:57 PM (3 years, 2 months ago) |
|
|
Quote:
PTreeDish said: How do you get the accumulated mycelium off the blade into the tube? Do you just scrape it off using the edge of the tube?
Yes, or you can use a pipette tip or plastic pestle. I use a plastic pestle to grind the mycelium.
Quote:
Is using a paper towel + 2% bleach solution good enough for cleaning the rods between samples?
I don't know - I put them in 10% bleach until I am ready to clean them, then autoclave.
Quote:
I mentioned freezing my PCR product before shipping. Good idea or bad? How do you keep your products before shipping?
Frozen unless I am shipping them right away.
Quote:
Primers I'm ordering: ITS1-F: CTTGGTCATTTAGAGGAAGTAA (fungi-specific) ITS4B-R: CAGGAGACTTGTACACGGTCCAG (basidiomycete specific) ITS4-R: TCCTCCGCTTATTGATATGC (general fungi reverse)
Those are good. Other good ones are ITS2 and ITS3, which you only use if you can't get the others to work.
Quote:
Genewiz questions: * For pcr cleanup + sequencing, it looks like I need to make two separate orders for each but I can just send in one set of samples so long as all of the well labels match and are marked?
You just make one order - for the order type you select PCR product - Unpurified, which includes PCR cleanup.
Quote:
* What oligo format do you prefer, wet or dry? If wet, what matrix? Probably more useful is to know why I would want either.
Dry, because they are more stable that way. I dilute to 100 micromolar with the cleanest water I can find, and store that in the coldest freezer I can find. I keep 10 micromolar aliquots in the fridge for easy access and so I don't need to thaw the primer often.
Quote:
* Not sure what the "normalization" option means but options are None, 100um or 50um.
Not sure, that's not an option on IDT, which is where I order primers.
Quote:
* What is "scale"? Options are 25nm or 50nm. Guessing that is concentration of primer and will dictate dilution?
That is how much total primer you are ordering. 25 is enough for around 2000 PCR reactions so it's probably enough.
Quote:
* I checked the box "retain oligos for sequencing". Is it still necessary to send in primer for sequencing then?
No. But maybe you want them to send you the primer so you can use them in PCR, and then you'd send in some - except that they have the ITS primers in-house, so you don't need to send those, you can select them from a dropdown when you order sequencing.
Quote:
I know you didn't ask for it, but I sent you a Patron payment for your time. It's not much but I'll send more as I make progress.
Oh cool very much appreciated, though I am happy to help anyone sequence stuff any time.
|
Alan Rockefeller
Mycologist

Registered: 03/10/07
Posts: 48,276
Last seen: 30 minutes, 52 seconds
|
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
#27007331 - 10/27/20 10:02 PM (3 years, 2 months ago) |
|
|
Congratulations on the success!
Could you post the sequence in text format so I can BLAST it too and see what I think about that ID?
You could also attach the chromatogram so I can verify that, but be aware that chromatograms contain your real name (or whatever name you gave Genewiz). You can use sed or a hex editor to change that if you want to post chromatograms and still be anonymous.
|
PTreeDish



Registered: 04/22/18
Posts: 353
Last seen: 3 months, 15 days
|
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
#27008018 - 10/28/20 10:07 AM (3 years, 2 months ago) |
|
|
Sure thing.
1. Penicillium rubidurum
https://everymanbio.com/Myster.Mold-ITS1-F.ab1
NNNNNNNNNNNNNTNNGTNNTGACCTGCGGAGGATCATTACCGAGTGAGGACCCTCTGGGTCCAACCTCCCACCCGTGTT TATCGTACCTTGTTGCTTCGGCGGGCCCGCCGCAAGGCCGCCGGGGGGCTTCCGTCCCCGGGCCCGTGCCCGCCGAAGAC ACCTGTGAACGCTGTATGAAGATTGCAGTCTGAGCGACAAGCTAAATTTGTTAAAACTTTCAACAACGGATCTCTTGGTT CCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACG CACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGG CCCTCGTCCCCCGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGC TCTGTAGGCCCGGCCGGCGCCTGCCGACACCATCAATCTTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCT GAACTTAAGCATNNNNNNNNNNNNNNNNNN
2. Penicillium camemberti
https://everymanbio.com/Cordycep-ITS1-F.ab1
NNNNNNNNNNTNGTAGGTGACCTGCGGAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTAT TTTACCTTGTTGCTTCGGCGGGCCCGCCTTAACTGGCCGCCGGGGGGCTCACGCCCCCGGGCCCGCGCCCGCCGAAGACA CCCTCGAACTCTGTCTGAAGATTGAAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTC CGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCA CATTGCGCCCCCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCC CCGTCCTCCGATCTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTC ACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATAC CCGCTGAACTTAAGNNNNNNNNANNNGGGNNGNNANAAA
3. Cordyceps militaris
https://everymanbio.com/White.Mold-ITS1-F.ab1
NNNNNNNGNNTCGTTGGTGACCNGCGGAGGGANCATTAACGAGTTTTCCAACTCCCAACCCTTTGTGAACATACCTATCG TTGCTTCGGCGGACTCGCCCAGCGCCTGGACGCGGGCCTGGGCGGCGGCCGTCGGGGGCCCCAAACACTGTATCTACCGG TTTTTCTGAATCCGCCGCAAGGCAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAG AACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCC AGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACGTCCCCTGGGGGATGTCGGCGTTGGGGACCGGC AGCACACCGCCGCCCCCGAAATGAAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTACCCCAACTCGCACCGGGACCC AGACGTGGCCACGCCGTAAAACGCCCAACTCTGAACGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAANNNNN NNNANNGGNNNNNNNAAAAAN
None of my basidiomycetes worked using ITS1F + ITS4B primer combo. They all came back "No Priming". Probably a user error on my part. I will try again next week.
I do really enjoy molds and am thinking of making them an area of focus. Do you have any thoughts on where I could contribute to the sciences in molds or where I may discover new molds?
Edit:
Side note, the-odin's fungal primer page lists the forward primer as ITS1F (TCCGTAGGTGAACCTGCGG) but that isn't ITS1F, it's ITS1. I emailed Josiah about it a couple of times because I think it might confuse people but he hasn't gotten back to me. Am I missing something or is the primer mislabeled on the page?
Edited by PTreeDish (10/29/20 09:14 PM)
|
teknix
𓂀⟁𓅢𓍝𓅃𓊰𓉡 𓁼𓆗⨻



Registered: 09/16/08
Posts: 11,953
|
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
#27009315 - 10/28/20 09:18 PM (3 years, 2 months ago) |
|
|
If you wanna sequence dueteromycota, it would be cool to get statistics from the soil samples morels are growing in. I think if you compared all the data from many various soil samples there might be a common denominator.
|
Alan Rockefeller
Mycologist

Registered: 03/10/07
Posts: 48,276
Last seen: 30 minutes, 52 seconds
|
Re: DNA barcoding class / interview with Adam Haritan [Re: teknix]
#27009385 - 10/28/20 10:09 PM (3 years, 2 months ago) |
|
|
I went through your data and corrected it, here are the fixed sequences.
I had a friend film what I was doing - I am camped out in the middle of nowhere and the film is 2.5 gigs, I'll upload it when I am back in town.
The most exciting findings were in sequence # 1 - it's Penicillium labradorum, a recently described species of Penicillium that causes fungal infections in Labrador retrievers! See this paper for details.
1) ACCTGCGGAaGGATCATTACCGAGTGAGGACCCTCTGGGTCCAACCTCCCACCCGTGTTTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGCAAGGCCGCCGGGGGGCTTCCGTCCCCGGGCCCGTGCCCGCCGAAGACACCTGTGAACGCTGTATGAAGATTGCAGTCTGAGCGACAAGCTAAATTTGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCTCGTCCCCCGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTGTAGGCCCGGCCGGCGCCTGCCGACACCATCAATCTTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCAT
2) TTGGTGAaCCaGCGGAGGGAtCATTAACGAGTTTTCCAACTCCCAACCCTTTGTGAACATACCTATCGTTGCTTCGGCGGACTCGCCCAGCGCCTGGACGCGGGCCTGGGCGGCGGCCGTCGGGGGCCCCAAACACTGTATCTACCGGTTTTTCTGAATCCGCCGCAAGGCAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACGTCCCCTGGGGGATGTCGGCGTTGGGGACCGGCAGCACACCGCCGCCCCCGAAATGAAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTACCCCAACTCGCACCGGGACCCAGACGTGGCCACGCCGTAAAACGCCCAACTCTGAACGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAgc
3) TAGGTGAACCTGCGGaAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTT TACCTTGTTGCTTCGGCGGGCCCGCCTTAACTGGCCGCCGGGGGGCTCACGCCCCCGGGCCCGCGCCCGC CGAAGACACCCTCGAACTCTGTCTGAAGATTGAAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAA CAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAAAT TCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGAGGGCATGCCTGTCCGAGC GTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATCTCCGGGGGACGGGCCCGAA AGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCG GCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTA AG
|
PTreeDish



Registered: 04/22/18
Posts: 353
Last seen: 3 months, 15 days
|
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
#27009415 - 10/28/20 10:33 PM (3 years, 2 months ago) |
|
|
Aw, thanks man. I had already done the cleanup per your video with snapgene but this will give me a chance to compare and see if I missed anything.
I saw that about the dog but not the paper! Poor dog. The paper says they euthanized him. :/ The paper is amazing though - super cool that I found this and it was only recently published! Def. makes me want to go out there and keep searching.
Do you have any opinions about whether to use iNaturalist vs. MushroomObserver for observations and GenBank cross-referencing? Seems superfluous to publish observations in two places.
Edited by PTreeDish (10/28/20 10:44 PM)
|
Alan Rockefeller
Mycologist

Registered: 03/10/07
Posts: 48,276
Last seen: 30 minutes, 52 seconds
|
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
#27009437 - 10/28/20 10:50 PM (3 years, 2 months ago) |
|
|
Quote:
PTreeDish said: None of my basidiomycetes worked using ITS1F + ITS4B primer combo. They all came back "No Priming". Probably a user error on my part. I will try again next week.
The ITS4-B primer gets about 200 more bases than ITS1 - it gets the first part of the LSU too. It takes a bit longer to copy these extra bases, so try a longer extension time in your PCR program. If that doesn't work, try lowering the annealing temperature so the primers stick a little harder.
You can also use gel electrophoresis to check to see if the PCR worked so you aren't sending in PCR products that aren't going to give you data. Gel electrophoresis will show a band if you have a lot of DNA that is all the same length, indicating that the PCR was successful. I use about 8 uL of the PCR product for a gel run, and then send in the rest if the gel indicates that it was successful.
Quote:
I do really enjoy molds and am thinking of making them an area of focus. Do you have any thoughts on where I could contribute to the sciences in molds or where I may discover new molds?
You almost did discover one here - but you were three years too late. There's so many out there to be discovered, so keep doing what you are doing.
Quote:
Side note, the-odin's fungal primer page lists the forward primer as ITS1F (TCCGTAGGTGAACCTGCGG) but that isn't ITS1F, it's ITS1. I emailed Josiah about it a couple of times because I think it might confuse people but he hasn't gotten back to me. Am I missing something or is the primer mislabeled on the page?
ITS1-F is a forward primer for fungi - the F indicates that it's just for fungi, and it'll ignore other DNA like plant DNA. Often people put a F at the end of a primer name to indicate that it's a forward primer. The ODIN labeling means that it's the forward ITS primer rather than it being the ITS1-F fungal primer. If they don't fix it I'll mention it to Josiah in person next time I stop by The Odin to pick up supplies.
Regarding iNaturalist and Mushroom Observer, they both work really well and I use both websites a lot. Use which ever one you feel more comfortable with. Mushroom Observer is a much lower volume website, with a more dedicated user base, so your observations are more likely to be seen by someone who will care about it. With iNaturalist there are a lot more observations, so a lot of observations never get seen.
What I do is upload to Mushroom Observer, and then I periodically run the MO to iNaturalist import tool. That way I only need to upload them once to get them on both sites.
|
Alan Rockefeller
Mycologist

Registered: 03/10/07
Posts: 48,276
Last seen: 30 minutes, 52 seconds
|
Re: DNA barcoding class / interview with Adam Haritan [Re: teknix]
#27009457 - 10/28/20 11:10 PM (3 years, 2 months ago) |
|
|
Quote:
teknix said: If you wanna sequence dueteromycota, it would be cool to get statistics from the soil samples morels are growing in. I think if you compared all the data from many various soil samples there might be a common denominator.
The best way to do that is next generation sequencing, which is quite a bit more expensive than the Sanger sequencing we are doing here. It'll show you all of the DNA in the soil at once, you'll get many thousands of reads per run.
Sanger sequencing sequences one fungus at a time - you could plate out the soil and sequence what grows, though a lot of soil fungi won't grow on agar so you wouldn't get a full picture, and it'd be time consuming.
|
PTreeDish



Registered: 04/22/18
Posts: 353
Last seen: 3 months, 15 days
|
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
#27009465 - 10/28/20 11:19 PM (3 years, 2 months ago) |
|
|
Quote:
Gel electrophoresis will show a band if you have a lot of DNA that is all the same length, indicating that the PCR was successful. I use about 8 uL of the PCR product for a gel run, and then send in the rest if the gel indicates that it was successful.
I always use a gel - Genewiz also requires it to estimate DNA concentration. Here was the one for this run. Lane 1 is the ladder, 2-4 are the molds and 4-9 are the basiomycetes. They all looked good to me so I'm not sure what's up. Even if I mistakenly used the wrong reverse primer, I'd think I wouldn't get a band at all. I used 5uL of product with 2uL dye.

Quote:
You almost did discover one here - but you were three years too late. There's so many out there to be discovered, so keep doing what you are doing.
Sweet. 
Quote:
The ODIN labeling means that it's the forward ITS primer rather than it being the ITS1-F fungal primer. If they don't fix it I'll mention it to Josiah in person next time I stop by The Odin to pick up supplies.
Totally makes sense. Just found it confusing as a newb. Sounds good re: Josiah. I saw you poking around the racks in one of his live streams not too long ago haha.
Quote:
What I do is upload to Mushroom Observer, and then I periodically run the MO to iNaturalist import tool. That way I only need to upload them once to get them on both sites.
Oh, wow. Didn't know about that tool. That's a good strategy.
|
Alan Rockefeller
Mycologist

Registered: 03/10/07
Posts: 48,276
Last seen: 30 minutes, 52 seconds
|
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
#27009558 - 10/29/20 01:55 AM (3 years, 2 months ago) |
|
|
Since you got a band the PCR worked - occasionally the PCR will work but the sequencing will fail however. You could try a different sequencing primer - its4b and its3 are options. Its3 will only give you half the read, so only do that in case of emergency.
You can also talk to Genewiz tech support about it, they are pretty good and can help you find ways to make it work.
|
PTreeDish



Registered: 04/22/18
Posts: 353
Last seen: 3 months, 15 days
|
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
#27010276 - 10/29/20 12:25 PM (3 years, 2 months ago) |
|
|
I think what I'll try is its1-f/its4, its1-f/its4b, and its1/its4 for the same specimen and see what happens.
Genewiz support is great, especially Brittany who basically does the support for sequencing. They're giving me half-off on my sequencing this next round since I had so many failures.
I noticed in the sequences that you cleaned up that you flipped some of those bits such that it made the blast match 100%. How did you make the determination for the nucleotides that were either N or different from the closest match?
Edited by PTreeDish (10/29/20 12:44 PM)
|
Alan Rockefeller
Mycologist

Registered: 03/10/07
Posts: 48,276
Last seen: 30 minutes, 52 seconds
|
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
#27010561 - 10/29/20 02:38 PM (3 years, 2 months ago) |
|
|
Quote:
PTreeDish said: I noticed in the sequences that you cleaned up that you flipped some of those bits such that it made the blast match 100%. How did you make the determination for the nucleotides that were either N or different from the closest match?
What I do is BLAST the sequence, then go through the alignment with the BLAST match with the highest ident value and check the chromatogram in the spots where my sequence differs from the closest BLAST match. Often I can see something in the chromatogram that indicates that it needs to be changed to make the data as accurate as possible.
It's explained well in the video I made, I'll try to get it online today.
|
PTreeDish



Registered: 04/22/18
Posts: 353
Last seen: 3 months, 15 days
|
Re: DNA barcoding class / interview with Adam Haritan [Re: Alan Rockefeller]
#27010569 - 10/29/20 02:43 PM (3 years, 2 months ago) |
|
|
Got it. Do you often encounter natural mutations though that might make an identical species vary slightly? Or are the variations from say a new strain not-so-subtle, meaning a higher standard deviation if that makes sense?
|
Alan Rockefeller
Mycologist

Registered: 03/10/07
Posts: 48,276
Last seen: 30 minutes, 52 seconds
|
Re: DNA barcoding class / interview with Adam Haritan [Re: PTreeDish]
#27010639 - 10/29/20 03:24 PM (3 years, 2 months ago) |
|
|
Quote:
PTreeDish said: Got it. Do you often encounter natural mutations though that might make an identical species vary slightly? Or are the variations from say a new strain not-so-subtle, meaning a higher standard deviation if that makes sense?
ITS has no function, so mutations here won't affect the organism. Mutations in the ITS do imply that there will be mutations elsewhere in the genome that will affect it, but the exact amount is random. If you have a very different ITS, you can be sure there are lots of changes all over the genome. Slight changes may or may not mean there are more meaningful mutations elsewhere.
|
|