Home | Community | Message Board


This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Original Sensible Seeds Bulk Cannabis Seeds   North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   Left Coast Kratom Buy Kratom Extract   Unfolding Nature Unfolding Nature: Being in the Implicate Order   Mushroom-Hut Liquid Cultures   Myyco.com Isolated Cubensis Liquid Culture For Sale   Kraken Kratom Red Vein Kratom   Bridgetown Botanicals Bridgetown Botanicals   PhytoExtractum Buy Bali Kratom Powder

Jump to first unread post Pages: < Back | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | Next > | Last >
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
InvisibleLizardWizard
GnomeGrower
I'm a teapot User Gallery


Folding@home Statistics
Registered: 01/07/15
Posts: 13,717
Loc: the parking lot
Re: CORDYCEPS MILITARIS FIND - how to grow it out?? (moved) [Re: FishLevelMidnight]
    #24773235 - 11/10/17 09:30 AM (6 years, 4 months ago)

Oh dude, you lost me after your first question. To which the answer is no, absolutely not. It looked like a normal Cordyceps specimen, and hopefully it will lead to a fruiting strain. Other than that, your guess is as good as mine. The mycelium goes nicely orange after a good week, with some cultures going a much deeper orange than others. We'll see how it goes...

But the A is probably not lost, it was most likely a mistake. The GGA/GGG difference is the only REAL difference as far as we know.


--------------------
The best things in life
can be smelled on one's fingers.

Extras: Filter Print Post Top
OfflineFishLevelMidnight
Aquaman
Male User Gallery


Registered: 09/01/17
Posts: 2,328
Last seen: 7 months, 22 days
Re: CORDYCEPS MILITARIS FIND - how to grow it out?? (moved) [Re: LizardWizard]
    #24773246 - 11/10/17 09:34 AM (6 years, 4 months ago)

Try pasting your sequence into here and see what comes up!

https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch

or send me that email with your file and I'll play around with it


--------------------





Trade List




Extras: Filter Print Post Top
InvisibleLizardWizard
GnomeGrower
I'm a teapot User Gallery


Folding@home Statistics
Registered: 01/07/15
Posts: 13,717
Loc: the parking lot
Re: CORDYCEPS MILITARIS FIND - how to grow it out?? (moved) [Re: FishLevelMidnight]
    #24773304 - 11/10/17 09:58 AM (6 years, 4 months ago)

I don't know if you missed it, but I posted it in this thread. You can download it, and change the extension back to .ab1 when you've got it. At least according to RogerSmith :tongue:

Figured it saves me sending out emails to several ppl.


--------------------
The best things in life
can be smelled on one's fingers.

Extras: Filter Print Post Top
InvisibleLizardWizard
GnomeGrower
I'm a teapot User Gallery


Folding@home Statistics
Registered: 01/07/15
Posts: 13,717
Loc: the parking lot
Re: CORDYCEPS MILITARIS FIND - how to grow it out?? (moved) [Re: LizardWizard]
    #24773322 - 11/10/17 10:06 AM (6 years, 4 months ago)

Quote:

Message ID#69 Error: Error occurred while trying to set up a Blast Object from CGI context: CFastaReader: Near line 1, there's a line that doesn't look like plausible data, but it's not marked as defline or comment.




That's what I get when I do it. I'm guessing you'll be more successful.


--------------------
The best things in life
can be smelled on one's fingers.

Extras: Filter Print Post Top
OfflineFishLevelMidnight
Aquaman
Male User Gallery


Registered: 09/01/17
Posts: 2,328
Last seen: 7 months, 22 days
Re: CORDYCEPS MILITARIS FIND - how to grow it out?? (moved) [Re: LizardWizard]
    #24773376 - 11/10/17 10:31 AM (6 years, 4 months ago)

I can't open that pdf anyways.

Can you send me the ab1 or whatver file?

And for the NCBI blast, you need to put in the base pairs, not load in a file.


--------------------





Trade List




Extras: Filter Print Post Top
InvisibleLizardWizard
GnomeGrower
I'm a teapot User Gallery


Folding@home Statistics
Registered: 01/07/15
Posts: 13,717
Loc: the parking lot
Re: CORDYCEPS MILITARIS FIND - how to grow it out?? (moved) [Re: FishLevelMidnight]
    #24773565 - 11/10/17 11:54 AM (6 years, 4 months ago)

You shouldn't open the pdf, it's not meant to be opened. It's meant to be downloaded, then the .pdf extension changed into .ab1, then opened in a DNA sequencing program.


--------------------
The best things in life
can be smelled on one's fingers.

Extras: Filter Print Post Top
OfflineFishLevelMidnight
Aquaman
Male User Gallery


Registered: 09/01/17
Posts: 2,328
Last seen: 7 months, 22 days
Re: CORDYCEPS MILITARIS FIND - how to grow it out?? (moved) [Re: LizardWizard]
    #24773577 - 11/10/17 11:59 AM (6 years, 4 months ago)

Does it work like that? I don't know enough about file types but I feel like the information wouldn't be transferred...

I tried to change the file name to include .ab1 but it is still a pdf
:shrug:


--------------------





Trade List




Extras: Filter Print Post Top
InvisibleRogerSmith


Registered: 01/29/15
Posts: 365
Re: CORDYCEPS MILITARIS FIND - how to grow it out?? (moved) [Re: LizardWizard]
    #24773626 - 11/10/17 12:19 PM (6 years, 4 months ago)

Quote:

LizardWizard said:
Quote:

RogerSmith said:
Well, you could change file extension (.ab1) to .pdf manually. And then whoever downloads it changes it back.




Could you try it out for me RogerSmith?



It works perfect. I just can't open it, don't have software for .ab1.

Extras: Filter Print Post Top
InvisibleLizardWizard
GnomeGrower
I'm a teapot User Gallery


Folding@home Statistics
Registered: 01/07/15
Posts: 13,717
Loc: the parking lot
Re: CORDYCEPS MILITARIS FIND - how to grow it out?? (moved) [Re: FishLevelMidnight]
    #24773630 - 11/10/17 12:20 PM (6 years, 4 months ago)

it was never transferred in the first place. I'll see if I still have the program and check if it works.


--------------------
The best things in life
can be smelled on one's fingers.

Extras: Filter Print Post Top
InvisibleLizardWizard
GnomeGrower
I'm a teapot User Gallery


Folding@home Statistics
Registered: 01/07/15
Posts: 13,717
Loc: the parking lot
Re: CORDYCEPS MILITARIS FIND - how to grow it out?? (moved) [Re: LizardWizard]
    #24773638 - 11/10/17 12:24 PM (6 years, 4 months ago)

Damn it you're right, it's not working. I'm not all too comfy sending out mails willy nilly, my name is in there. If anyone has another option to send it out, go ahead and tell me, if not, wait for the upload on GenBank (can you even download it from there??)


--------------------
The best things in life
can be smelled on one's fingers.

Extras: Filter Print Post Top
OfflineFishLevelMidnight
Aquaman
Male User Gallery


Registered: 09/01/17
Posts: 2,328
Last seen: 7 months, 22 days
Re: CORDYCEPS MILITARIS FIND - how to grow it out?? (moved) [Re: LizardWizard]
    #24773653 - 11/10/17 12:32 PM (6 years, 4 months ago)

This isn't an active thread or species, so why the worry?

You could make a throw away email account to send from if sketched out.

You can also try to DL some free software that would allow you to export as a fasta or txt (that way you can just paste us the basepairs to work with).
I've used FinchTV in the past, might be worth chekcing out
http://jblseqdat.bioc.cam.ac.uk/gnmweb/download/soft/FinchTV_1.4/doc/


--------------------





Trade List




Extras: Filter Print Post Top
InvisibleSpeeker

Registered: 02/11/04
Posts: 882
Loc: Flag
Re: CORDYCEPS MILITARIS FIND - how to grow it out?? (moved) [Re: FishLevelMidnight]
    #24773721 - 11/10/17 01:00 PM (6 years, 4 months ago)

Quote:

fishermansjc said:
Try pasting your sequence into here and see what comes up!

https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch

or send me that email with your file and I'll play around with it




Got this out of that file. Don't know nothing about these either...

Quote:

GGTTCTACTGATCCGAGGTCACGTTCAGAGTTGGGCGTTTTACGGCGTGGCCACGTCGGGTTCCCGGTGCGAGTTGGGGTACTACGCAGAGGTCGCCGCGGACGGGCCGCCACTTCATTTCGGGGGCGGCGGTGTGCTGCCGGTCCCCAACGCCGACATCCCCCAGGGGACGTCGAGGGTTGAAATGACGCTCGAACAGGCATGCCCGCCAGAATGCTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAGCCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTGTTTTGCCTTGCGGCGGATTCAGAAAAACTGGTAGATACAGTGTTTGGGGCCCCCGACGGCCGCCGCCCAGGCCCGCGTCCAGGCGCTGGGCGAGTCCGCCGAAGCAACGATAGGTATGTTCACAAAGGGTTGGGAGTTGGGAAACTCGTTAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTACGACTTTTACTTCCTCTAATTGACCAAGAAA




Blast gave this result. (Expires on 11-12 02:53 am)
https://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Get&RID=0C0XMUV0014


--------------------
blog

Extras: Filter Print Post Top
OfflineFishLevelMidnight
Aquaman
Male User Gallery


Registered: 09/01/17
Posts: 2,328
Last seen: 7 months, 22 days
Re: CORDYCEPS MILITARIS FIND - how to grow it out?? (moved) [Re: Speeker]
    #24773746 - 11/10/17 01:06 PM (6 years, 4 months ago)

Thanks for that! Looks like it was the ribosomal RNA that was sequenced, used often for phylogenics to place species.

Usually there is not much variability in this gene among a species, so it would be cool to know if the GGA from GGG mutation has any effects


--------------------





Trade List




Extras: Filter Print Post Top
OfflineWeakHyperCharge
Noob

Registered: 11/03/17
Posts: 437
Loc: Isla Del Morta Flag
Last seen: 5 years, 9 months
Re: CORDYCEPS MILITARIS FIND - how to grow it out?? (moved) [Re: LizardWizard]
    #24773753 - 11/10/17 01:10 PM (6 years, 4 months ago)

How about onionshare( https://onionshare.org/), could put it up and people download it then someone can put it on a torrent.

It's not copyright so shouldn't raise any suspicion

Extras: Filter Print Post Top
InvisibleRogerSmith


Registered: 01/29/15
Posts: 365
Re: CORDYCEPS MILITARIS FIND - how to grow it out?? (moved) [Re: WeakHyperCharge]
    #24773787 - 11/10/17 01:21 PM (6 years, 4 months ago)

File should work, not sure what went wrong.. Did file work for Speeker?

I have a theory about that A sector. Cordyceps Sinensis is actually made from many different non-fruiting organisms (around 22), with very similar DNK. In quote below, there is more written about it. Perhaps, Militaris also has such anamorphs, which could explain different DNK from fruiting strain (missing A).

Quote:

Cordyceps does something very unique. Prior to germination of the spores (remember contain 50% of the DNA), the spores will separate into as many as 100 “part-spores”. These part-spores each contain something less than 50% of the total DNA. Each of these spores can and do germinate though, and the resulting cultures are related to Cordyceps in that they contain some of the DNA of the Cordyceps, but not all of it. But the germinations are species that we recognize and that are already known, for example Fusarium oxysporum. (a very commonly derivative anamorph species from single part-spore isolates) Apparently in nature instead of just two whole spores fusing like in other fungi, in Cordyceps many of these part-spore organisms fuse, so that eventually the entire Cordyceps sinensis DNA sequence is assembled. Only then can the culture be called Cordyceps sinensis and only then does it fruit. We do not know exactly how many partner species contribute to the Cordyceps sinensis organism, but there are at least 21 genera that can be isolated from Cordyceps spores. These are:

Paecilomyces, Acremonium, Akanthomyces, Aschersonia, Aspergillus, Beauveria, Culicinomyces, Fusarium, Gibellula, Hirsutella, Hymenostilbe, Metarhizium, Nomuraea, Paraisaria, Pseudogibellula, Sorosporella, Sporothrix, Tetracrium, Tilachlidiopsis, Tolypocladium, Verticillium

There are others genera known as anamorphs as well, but these 21 genera are listed in the peer-review literature as “anamorphs” of Cordyceps. Some authors will claim that Hirsutella sinensis is the “true” anamorph of Cordyceps sinensis. That is incorrect data from an early attempt to genotype the anamorph. In truth, there is no one single anamorph of Cordyceps, but many that must be present for the fungus to be complete.



Source: https://www.shroomery.org/forums/showflat.php/Number/18496246#18496246

Extras: Filter Print Post Top
InvisibleSpeeker

Registered: 02/11/04
Posts: 882
Loc: Flag
Re: CORDYCEPS MILITARIS FIND - how to grow it out?? (moved) [Re: RogerSmith]
    #24773823 - 11/10/17 01:45 PM (6 years, 4 months ago)

Quote:

RogerSmith said:
File should work, not sure what went wrong.. Did file work for Speeker?





The file looks to be ok. MD5: 442464b6a7db7141074dcbc96a717290.

Checked it that much with hex editor that it didn't have some extra
PDF header or something. Then I just converted the file with this online tool.
http://sequenceconversion.bugaco.com/converter/biology/sequences/


--------------------
blog

Extras: Filter Print Post Top
OfflineSolipsis
m̶a̶d̶ disappointed scientist
Male User Gallery


Registered: 12/28/09
Posts: 3,398
Loc: the Neitherlands Flag
Last seen: 7 months, 16 days
Re: CORDYCEPS MILITARIS FIND - how to grow it out?? (moved) [Re: Speeker]
    #24776179 - 11/11/17 03:41 PM (6 years, 4 months ago)

I don't see how that would make sense in an evolutionary way if it were composed of 20 or so non-fruiting organisms (species?)?

It does call into question things like 'junk DNA' which are thought to be in a way vestibular I think. But consider this in a broad sense just like our mitochondria are in a way "vestibular". So I can get into theories that involve organisms absorbing each other and their DNA and hijacking, modifying it and cutting it up etc but if it involves non-fruiting species they may need to be ancient. I admit I don't know if fungi are known to be fruiting from the get-go, I guess fruiting is also a malleable term and there are many ways of sporulation and identifying the "fruit" may not always (have been) easy?

Might it make sense if you track the evolutionary development back from knowing its parasitic behavior? Did the fungus have to shit out multiple partial spores for other insects to be able to ingest them - something along those lines?
If it were composed of of many species / organisms I don't think that explains at all how it is able to integrate them into a viable species but at the same time is splitting them up during sporulation.

Anyway keep it up guys!!


Edited by Solipsis (11/11/17 03:49 PM)

Extras: Filter Print Post Top
InvisibleRogerSmith


Registered: 01/29/15
Posts: 365
Re: CORDYCEPS MILITARIS FIND - how to grow it out?? (moved) [Re: Solipsis]
    #24776224 - 11/11/17 04:12 PM (6 years, 4 months ago)

It doesn't make much sense yes, so I never really bothered with it too much.
But Militaris ascospore is made of part-spores.
And Paul Stamets recently talked about this on some podcast and he mentioned exactly this thing. He called Sinensis polyculture of different molds. So I guess it is correct info.
Never found any research article about it though.

Extras: Filter Print Post Top
OfflineSolipsis
m̶a̶d̶ disappointed scientist
Male User Gallery


Registered: 12/28/09
Posts: 3,398
Loc: the Neitherlands Flag
Last seen: 7 months, 16 days
Re: CORDYCEPS MILITARIS FIND - how to grow it out?? (moved) [Re: RogerSmith]
    #24776282 - 11/11/17 04:40 PM (6 years, 4 months ago)

Holy shit I guess I stand corrected though I'm gonna need to hear that podcast cause it sounds incredibly interesting :P

I wasn't doubting the part about 'part-spores', just the proposed explanation.. just brainstorming.

Also I am happy humans are not like that otherwise it might make sex and parenting very difficult.

Does this mean it can make genetically IDing cordyceps incredibly hard to begin with or is the DNA still as constant as if it wasn't so goofy-spored?

Extras: Filter Print Post Top
InvisibleRogerSmith


Registered: 01/29/15
Posts: 365
Re: CORDYCEPS MILITARIS FIND - how to grow it out?? (moved) [Re: Solipsis]
    #24776373 - 11/11/17 05:21 PM (6 years, 4 months ago)



1:52:00

Extras: Filter Print Post Top
Jump to top Pages: < Back | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | Next > | Last >

Shop: Original Sensible Seeds Bulk Cannabis Seeds   North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   Left Coast Kratom Buy Kratom Extract   Unfolding Nature Unfolding Nature: Being in the Implicate Order   Mushroom-Hut Liquid Cultures   Myyco.com Isolated Cubensis Liquid Culture For Sale   Kraken Kratom Red Vein Kratom   Bridgetown Botanicals Bridgetown Botanicals   PhytoExtractum Buy Bali Kratom Powder


Similar ThreadsPosterViewsRepliesLast post
* Re: Cordyceps Sinensis Anonymous 2,993 4 05/07/01 10:28 PM
by aNaPhylaktik
* Cordyceps, stage one complete! [pics]
( 1 2 3 4 all )
Suntzu 32,438 76 06/11/09 11:34 AM
by vonswarrior
* Out Door Cordyceps Patches gordonoalberto23 2,165 1 02/05/03 08:42 AM
by Suntzu
* Cordyceps in Washington State
( 1 2 3 all )
RogerRabbitM 18,165 54 10/14/09 01:25 PM
by RogerRabbit
* Cordyceps Mushrooms alman01 3,565 5 05/07/07 12:03 PM
by Jeremy_Davis
* cordyceps phonphan 1,293 1 11/25/05 10:42 PM
by socialnorm77
* Cordyceps mycelium cultivation psyphon 4,656 4 09/24/02 12:39 AM
by zeronio
* cordyceps extract (mycelium) doc34 2,729 11 09/27/18 12:40 AM
by Milehighru

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: RogerRabbit, Pastywhyte, Forrester, Stromrider, SHROOMSISAY01
39,034 topic views. 0 members, 2 guests and 11 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.03 seconds spending 0.008 seconds on 15 queries.