|
HatingMeIsEasier
Stranger
Registered: 05/01/15
Posts: 398
Last seen: 8 years, 4 months
|
Connecting Everything Once And For All! } O { Serious Soul } O { 3
#21901289 - 07/05/15 02:25 PM (8 years, 6 months ago) |
|
|
https://www.youtube.com/watch?v=5oBikInBRxs
Ay! Space wearing a face! Yeah! You! The one that calls themselves "Human"!
I just want you to know, from a transcendental mind that's mastered quanta, to a normal 'human' being that was socially conditioned, that we CAN see your DNA's code. That is all.
GAGAAGGCTGTTGTGAAAACGCTCTTCCGACAACACTTTTGC [Letter Form]
7 1 7 1 1 7 7 3 25 7 25 25 7 25 7 1 1 1 1 3 7 3 25 3 25 25 3 3 7 1 3 1 1 3 1 3 25 25 25 25 7 3 [Number Form]
7 + 17 + 11 + 7 + 7 + 3 + 25 + 7 + 25 + 25 + 7 + 25 + 7 + 11 + 11 = 195 Degrees
DNA = Tetrahedron
Tetrahedron = Methane
Methane = 1 Carbon + 4 Hydrogen
Carbon = 12.011
Hydrogen = 1.008
12.011 + 1.008 x 4 = 16.043
16.043 x 720 = 11550960
960 + 151 = 1111 [Binary Code] 960 x 151 = 144960 <--- 960 Reappears For It Is The Axial Core
11550960 converges into 6696 [Electromagnetism]
Chromosome in English Gematria Equals: 744
744+744+744+744+744+744+744+744+744 = 6696
Notice the "144" next to 'The Axial Core'?
144 x 10.5 = 1512 144 x 12 = 1728 144 x 24 = 3456
10.5 connects into 109.5. 12 Degrees = 12 Disciples = 12 Signs 24 Degrees = Coral Castle Key
1728 + 1512 + 3456 = 6696
1728 = 31428 [Egyptian Code] 1512 = 1 x 3 x 5 x 7 x 12 x 12 [Calcium Ion Formula + H20] 3456 = 864 + 864 + 864 + 864 [Sun's Diameter x 4]
Cell in English Gematria Equals: 192
6696 / 192 = 34.875
34.875 converges into 774
Electricity in English Gematria Equals: 774
774+774+774+774+774+774+774+774+774 = 6966 [Electromagnetism]
774 converges into "144".
The Great Pyramid of Giza has 360 Sacred Cubits Per Edge. 360 x 4 = 1,440 SC.
Sacred Cubit = 2.1 Feet or 25.20 Inches.
Gravity's Constant = 6.67. 6 x 6 x 7 = 252.
252 converges into 27 & 72.
27 x 72 = 1944
1944 + 1944 = 3888
3888 breaks into 3168 <--- The key to our entire Universe.
Multiply all numbers from 1 to 9 except "3", "1", "6" & "8".
2 x 4 x 5 x 7 x 9 = 2520.
2520 converges into 720 Degrees.
72 + 72 = "Let There Be Light" 144 + 144 = "Let There Be Power" 288 + 288 + 288 "Let There Be Energy" 864 + 864 + 864 + 864 = "Let There Be Design" 3456 + 3456 + 3456 + 3456 + 3456 = "Let There Be Life"
17280 converges into 8280.
We have "46" Chromosomes.
46+46+46+46+46+46+46+46+46+46+46+46+46+46+46+46+46+46+ = 828
God's System:
18 x 9 = 162 288 x 9 = 2592 3888 x 9 = 34992 4888 x 9 = 439992
Don't believe me?
The entire Universe makes a full circle at 12, then exalts at 13.
Proof: 360 / 12 = 30
16.5 breaks into a 16 & 14. 16 + 14 = 30
30 + 12 = 42 [Life]
I am going to multiply "13" digits of Pi to prove how everything is connected to God.
3 x 1 x 4 x 1 x 5 x 9 x 2 x 6 x 5 x 3 x 5 x 8 x 9 = 3499200.
There are "7" colors in the rainbow.
30 / 7 = 4.285...
4285 converges into 145 Degrees [Triangle Geometry]
3142857 / 30 = 104761.9
1047619 converges into 667.
Gravity's Constant = 6.67.
6 x 6 x 7 = 252.
Sacred Cubit = 25.20 Inches.
667 / 30 = 22.2333333333
222333333333 converges into 69.
The Lord Of All Creation = 69.
69 / 30 = 2.3
23 Chromosomes...
When Galaxies Collide -- LOOK CLOSELY: http://ircamera.as.arizona.edu/NatSci102/NatSci102/movies/diskcol3.gif
69 [Man & God] x 23 Chromosomes x 46 Chromosomes = 73002
Twin Flames in English Gematria Equals: 732
https://scontent-dfw1-1.xx.fbcdn.net/hphotos-xfp1/v/t1.0-9/11011075_1564756197135984_8147065107566816436_n.jpg?oh=b75c5f9c75fb427adc2c72e0ae30952c&oe=561F2B43
































} O { Sirius Soul } O {
-------------------- E I S P E M I R H E G E E I A A B B
Edited by HatingMeIsEasier (07/05/15 02:50 PM)
|
HatingMeIsEasier
Stranger
Registered: 05/01/15
Posts: 398
Last seen: 8 years, 4 months
|
Re: Connecting Everything Once And For All! } O { Serious Soul } O { [Re: HatingMeIsEasier]
#21901401 - 07/05/15 02:52 PM (8 years, 6 months ago) |
|
|
-------------------- E I S P E M I R H E G E E I A A B B
|
MilkdudTitties
My Nipples Look Like Milk Duds



Registered: 03/22/09
Posts: 3,796
Loc: USA
Last seen: 7 years, 5 months
|
Re: Connecting Everything Once And For All! } O { Serious Soul } O { [Re: HatingMeIsEasier]
#21901754 - 07/05/15 04:15 PM (8 years, 6 months ago) |
|
|
|
lovesquare
Love²

Registered: 06/04/15
Posts: 556
Last seen: 8 years, 4 months
|
Re: Connecting Everything Once And For All! } O { Serious Soul } O { [Re: HatingMeIsEasier]
#21901825 - 07/05/15 04:33 PM (8 years, 6 months ago) |
|
|
-------------------- If you go down round the bend in the river, You're gonna find a few changes been going down there. If you go down to the gas-powered flatland, Where most of the people just think that they're free, Remember the peace that you had on the mountain, Come back to the love that you had here with me...
|
Ran-D



Registered: 12/19/10
Posts: 16,313
|
Re: Connecting Everything Once And For All! } O { Serious Soul } O { [Re: HatingMeIsEasier]
#21903149 - 07/05/15 10:21 PM (8 years, 6 months ago) |
|
|
|
Prisoner#1
Even Dumber ThanAdvertized!


Registered: 01/22/03
Posts: 193,665
Loc: Pvt. Pubfag NutSuck
|
Re: Connecting Everything Once And For All! } O { Serious Soul } O { (moved) [Re: HatingMeIsEasier]
#21903629 - 07/06/15 12:18 AM (8 years, 6 months ago) |
|
|
This thread was moved from The Pub.
Reason: you may want to start making these in a more appropriate forum
|
|