Home | Community | Message Board

World Seed Supply
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

PhytoExtractum Shop: Maeng Da Thai Kratom Leaf Powder

Jump to first unread post Pages: 1
OfflineHatingMeIsEasier
Stranger
Registered: 05/01/15
Posts: 398
Last seen: 8 years, 4 months
Connecting Everything Once And For All! } O { Serious Soul } O { * 3
    #21901289 - 07/05/15 02:25 PM (8 years, 6 months ago)

https://www.youtube.com/watch?v=5oBikInBRxs

Ay! Space wearing a face! Yeah! You! The one that calls themselves "Human"!

I just want you to know, from a transcendental mind that's mastered quanta, to a normal 'human' being that was socially conditioned, that we CAN see your DNA's code. That is all.

GAGAAGGCTGTTGTGAAAACGCTCTTCCGACAACACTTTTGC [Letter Form]

7 1 7 1 1 7 7 3 25 7 25 25 7 25 7 1 1 1 1 3 7 3 25 3 25 25 3 3 7 1 3 1 1 3 1 3
25 25 25 25 7 3 [Number Form]

7 + 17 + 11 + 7 + 7 + 3 + 25 + 7 + 25 + 25 + 7 + 25 + 7 + 11 + 11 = 195 Degrees

DNA = Tetrahedron

Tetrahedron = Methane

Methane = 1 Carbon + 4 Hydrogen

Carbon = 12.011

Hydrogen = 1.008

12.011 + 1.008 x 4 = 16.043

16.043 x 720 = 11550960

960 + 151 = 1111 [Binary Code]
960 x 151 = 144960 <--- 960 Reappears For It Is The Axial Core

11550960 converges into 6696 [Electromagnetism]

Chromosome in English Gematria Equals: 744

744+744+744+744+744+744+744+744+744 = 6696

Notice the "144" next to 'The Axial Core'?

144 x 10.5 = 1512
144 x 12 = 1728
144 x 24 = 3456

10.5 connects into 109.5.
12 Degrees = 12 Disciples = 12 Signs
24 Degrees = Coral Castle Key

1728 + 1512 + 3456 = 6696

1728 = 31428 [Egyptian Code]
1512 = 1 x 3 x 5 x 7 x 12 x 12 [Calcium Ion Formula + H20]
3456 = 864 + 864 + 864 + 864 [Sun's Diameter x 4]

Cell in English Gematria Equals: 192

6696 / 192 = 34.875

34.875 converges into 774

Electricity in English Gematria Equals: 774

774+774+774+774+774+774+774+774+774 = 6966 [Electromagnetism]

774 converges into "144".

The Great Pyramid of Giza has 360 Sacred Cubits Per Edge. 360 x 4 = 1,440 SC.

Sacred Cubit = 2.1 Feet or 25.20 Inches.

Gravity's Constant = 6.67. 6 x 6 x 7 = 252.

252 converges into 27 & 72.

27 x 72 = 1944

1944 + 1944 = 3888

3888 breaks into 3168 <--- The key to our entire Universe.

Multiply all numbers from 1 to 9 except "3", "1", "6" & "8".

2 x 4 x 5 x 7 x 9 = 2520.

2520 converges into 720 Degrees.

72 + 72 = "Let There Be Light"
144 + 144 = "Let There Be Power"
288 + 288 + 288 "Let There Be Energy"
864 + 864 + 864 + 864 = "Let There Be Design"
3456 + 3456 + 3456 + 3456 + 3456 = "Let There Be Life"

17280 converges into 8280.

We have "46" Chromosomes.

46+46+46+46+46+46+46+46+46+46+46+46+46+46+46+46+46+46+ = 828

God's System:

18 x 9 = 162
288 x 9 = 2592
3888 x 9 = 34992
4888 x 9 = 439992

Don't believe me?

The entire Universe makes a full circle at 12, then exalts at 13.

Proof: 360 / 12 = 30

16.5 breaks into a 16 & 14. 16 + 14 = 30

30 + 12 = 42 [Life]

I am going to multiply "13" digits of Pi to prove how everything is connected to God.

3 x 1 x 4 x 1 x 5 x 9 x 2 x 6 x 5 x 3 x 5 x 8 x 9 = 3499200.

There are "7" colors in the rainbow.

30 / 7 = 4.285...

4285 converges into 145 Degrees [Triangle Geometry]

3142857 / 30 = 104761.9

1047619 converges into 667.

Gravity's Constant = 6.67.

6 x 6 x 7 = 252.

Sacred Cubit = 25.20 Inches.

667 / 30 = 22.2333333333

222333333333 converges into 69.

The Lord Of All Creation = 69.

69 / 30 = 2.3

23 Chromosomes...

When Galaxies Collide -- LOOK CLOSELY: http://ircamera.as.arizona.edu/NatSci102/NatSci102/movies/diskcol3.gif

69 [Man & God] x 23 Chromosomes x 46 Chromosomes = 73002

Twin Flames in English Gematria Equals: 732

https://scontent-dfw1-1.xx.fbcdn.net/hphotos-xfp1/v/t1.0-9/11011075_1564756197135984_8147065107566816436_n.jpg?oh=b75c5f9c75fb427adc2c72e0ae30952c&oe=561F2B43

































































} O { Sirius Soul } O {


--------------------
E I S P E M I R H E G E E I A A B B



Edited by HatingMeIsEasier (07/05/15 02:50 PM)


Extras: Filter Print Post Top
OfflineHatingMeIsEasier
Stranger
Registered: 05/01/15
Posts: 398
Last seen: 8 years, 4 months
Re: Connecting Everything Once And For All! } O { Serious Soul } O { [Re: HatingMeIsEasier]
    #21901401 - 07/05/15 02:52 PM (8 years, 6 months ago)



--------------------
E I S P E M I R H E G E E I A A B B



Extras: Filter Print Post Top
OfflineMilkdudTitties
My Nipples Look Like Milk Duds
Male User Gallery


Registered: 03/22/09
Posts: 3,796
Loc: USA
Last seen: 7 years, 5 months
Re: Connecting Everything Once And For All! } O { Serious Soul } O { [Re: HatingMeIsEasier]
    #21901754 - 07/05/15 04:15 PM (8 years, 6 months ago)

:thisisgonnabegood:


Extras: Filter Print Post Top
Offlinelovesquare
Love²

Registered: 06/04/15
Posts: 556
Last seen: 8 years, 4 months
Re: Connecting Everything Once And For All! } O { Serious Soul } O { [Re: HatingMeIsEasier]
    #21901825 - 07/05/15 04:33 PM (8 years, 6 months ago)

:takingnotes:


--------------------
If you go down round the bend in the river,
You're gonna find a few changes been going down there.

If you go down to the gas-powered flatland,
Where most of the people just think that they're free,
Remember the peace that you had on the mountain,
Come back to the love that you had here with me...


Extras: Filter Print Post Top
InvisibleRan-D
 User Gallery

Folding@home Statistics
Registered: 12/19/10
Posts: 16,313
Re: Connecting Everything Once And For All! } O { Serious Soul } O { [Re: HatingMeIsEasier]
    #21903149 - 07/05/15 10:21 PM (8 years, 6 months ago)



Extras: Filter Print Post Top
InvisiblePrisoner#1
Even Dumber ThanAdvertized!
 User Gallery

Registered: 01/22/03
Posts: 193,665
Loc: Pvt. Pubfag NutSuck
Re: Connecting Everything Once And For All! } O { Serious Soul } O { (moved) [Re: HatingMeIsEasier]
    #21903629 - 07/06/15 12:18 AM (8 years, 6 months ago)

This thread was moved from The Pub.

Reason:
you may want to start making these in a more appropriate forum


Extras: Filter Print Post Top
Jump to top Pages: 1

PhytoExtractum Shop: Maeng Da Thai Kratom Leaf Powder


Similar ThreadsPosterViewsRepliesLast post
* Do we have some type of weird psychic connection to our parents? kent101 455 7 03/17/18 12:23 AM
by nooneman
* The Death of the Soul...
( 1 2 all )
WIZOLZ 5,701 35 11/09/08 01:22 PM
by Icelander
* I need help connecting to the feminine side of the universe
( 1 2 3 all )
MOTH 8,288 55 11/29/16 02:52 PM
by finalexplosion
* Found a connection between 2012, astrology, and the Roman Empire Bard 1,143 2 09/05/07 05:39 AM
by Middleman
* Happy Halloween, All Hallows Eve, All Souls Day, Samhain! MarkostheGnostic 1,164 3 10/31/05 02:55 PM
by redgreenvines
* The human soul & abortion
( 1 2 all )
CherryBomM 5,595 34 05/30/07 12:21 PM
by thedudenj
* Frozen souls? Hanky 2,122 16 06/03/07 09:45 AM
by thedudenj
* Soul communion leery11 593 1 10/06/07 12:35 PM
by AlteredAgain

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Middleman, Shroomism, Rose, Kickle, yogabunny, DividedQuantum
499 topic views. 0 members, 10 guests and 1 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.026 seconds spending 0.007 seconds on 14 queries.