Home | Community | Message Board

MagicBag Grow Bags
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: PhytoExtractum Kratom Powder for Sale   North Spore Bulk Substrate   Left Coast Kratom Buy Kratom Extract   Amanita Muscaria Store Amanita Muscaria   Mushroom-Hut Liquid Cultures   Kraken Kratom Red Vein Kratom   Unfolding Nature Unfolding Nature: Being in the Implicate Order   Original Sensible Seeds Bulk Cannabis Seeds

Jump to first unread post Pages: 1 | 2 | 3 | 4 | 5 | 6  [ show all ]
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
OfflineWorkmanV
1999 Spore War Veteran
Male User Gallery

Registered: 03/01/01
Posts: 3,598
Loc: Oregon, USA
Last seen: 1 hour, 31 minutes
Trusted Cultivator
Psilocybe hispanica * 2
    #2102193 - 11/13/03 02:45 PM (20 years, 2 months ago)

Outdoor cultivated Psilocybe hispanica. This species is relatively easy to grow on sterilized horse manure placed outside during cool fall weather (around 60F). A relatively newly described species from Spain. In Spain it grows directly on sheep dung in fields that also support fruitings of Psilocybe semilanceata








Very small specimens growing from a displaced piece of colonized horse dung. Rodents or birds dug into the patch and scattered small pieces of dung that later fruited. It is interesting to note the reduced size of the mushrooms when growing from very small amounts of substrate.



This is a larger specimen from the main patch. Still a relatively small mushroom. The odor is very similar to Psilocybe semilanceata and the appearance reminds me of Psilocybe mexicana


--------------------
Research funded by the patrons of
The Spore Works
Exotic Spore Supply

My Instagram
Reinvesting 25% of Sales Towards Basic Research and Species Identification :amanitajar:


Extras: Filter Print Post Top
OfflinePaid
Pict
 User Gallery

Registered: 03/12/03
Posts: 5,376
Loc: Zone ate
Last seen: 19 years, 11 months
Re: Psilocybe hispanica [Re: Workman]
    #2102207 - 11/13/03 02:50 PM (20 years, 2 months ago)

:thumbup: very interessting shrooms :grin:


--------------------



Extras: Filter Print Post Top
OfflinePolecat
Tuga

Registered: 11/06/03
Posts: 147
Loc: Casa do Sino
Last seen: 8 years, 2 months
Re: Psilocybe hispanica [Re: Paid]
    #2102343 - 11/13/03 03:46 PM (20 years, 2 months ago)

very nice Workman...

tell me something about the trip that our fellow Iberic gives to us...

:smile:



--------------------
www.cogumelosportugal.forum-livre.com


O Caos é uma Ordem por decifrar.
Chaos is Order yet to decipher.

Jose Saramago


Extras: Filter Print Post Top
InvisibleBi0TeK
elephant man

Registered: 11/07/02
Posts: 3,002
Loc: Yorkshire Moors, Great Br...
Re: Psilocybe hispanica [Re: Workman]
    #2102367 - 11/13/03 03:51 PM (20 years, 2 months ago)

Very interesting indeed !  :grin: 


--------------------
PROMOTE BACTERIA. THEY'RE THE ONLY CULTURE SOME PEOPLE HAVE.


Extras: Filter Print Post Top
OfflineWorkmanV
1999 Spore War Veteran
Male User Gallery

Registered: 03/01/01
Posts: 3,598
Loc: Oregon, USA
Last seen: 1 hour, 31 minutes
Trusted Cultivator
Re: Psilocybe hispanica [Re: Polecat]
    #2106240 - 11/14/03 12:20 PM (20 years, 2 months ago)

I have no idea of the potency since I don't eat mushrooms.


--------------------
Research funded by the patrons of
The Spore Works
Exotic Spore Supply

My Instagram
Reinvesting 25% of Sales Towards Basic Research and Species Identification :amanitajar:


Extras: Filter Print Post Top
OfflineAnnoA
Experimenter
 User Gallery

Folding@home Statistics
Registered: 06/17/99
Posts: 24,166
Loc: my room
Last seen: 19 days, 5 hours
Re: Psilocybe hispanica [Re: Workman]
    #2107949 - 11/14/03 10:20 PM (20 years, 2 months ago)

Send them over here :wink: 


Extras: Filter Print Post Top
OfflineCaptainFuture
Finally being here now :)
Male User Gallery

Registered: 12/31/03
Posts: 889
Loc: Earth
Last seen: 16 hours, 10 minutes
Trusted Cultivator
Re: Psilocybe hispanica [Re: Workman]
    #2213478 - 01/01/04 03:54 PM (20 years, 1 month ago)

Hi Workman!
What about sending some prints over to germany for further investigation???

Would be VERY kind...
Greez
Cap


Extras: Filter Print Post Top
OfflineErik006
MushroomCultivator

Registered: 07/13/03
Posts: 310
Loc: Ontario
Last seen: 13 years, 6 months
Re: Psilocybe hispanica [Re: Workman]
    #2221154 - 01/05/04 05:14 PM (20 years, 27 days ago)

Looking good, what about the indoor cultivation of this species, has it been done, and can it be done?

Erik006


--------------------
At last you know what ineffable is, and what ecstacy means


Extras: Filter Print Post Top
OfflineWorkmanV
1999 Spore War Veteran
Male User Gallery

Registered: 03/01/01
Posts: 3,598
Loc: Oregon, USA
Last seen: 1 hour, 31 minutes
Trusted Cultivator
Re: Psilocybe hispanica [Re: Erik006]
    #2228167 - 01/08/04 12:04 PM (20 years, 24 days ago)

I have observed primordia form on refrigerated agar so I do believe indoor cultivation is possible.


--------------------
Research funded by the patrons of
The Spore Works
Exotic Spore Supply

My Instagram
Reinvesting 25% of Sales Towards Basic Research and Species Identification :amanitajar:


Extras: Filter Print Post Top
InvisibleYarry
Old Timer
 User Gallery

Registered: 01/04/04
Posts: 23,762
Re: Psilocybe hispanica [Re: Workman]
    #2228293 - 01/08/04 12:45 PM (20 years, 24 days ago)

wanna pass around a spore print? ;-)


--------------------
Grumpy Old Man.


Extras: Filter Print Post Top
OfflineErik006
MushroomCultivator

Registered: 07/13/03
Posts: 310
Loc: Ontario
Last seen: 13 years, 6 months
Re: Psilocybe hispanica [Re: Yarry]
    #2228645 - 01/08/04 02:42 PM (20 years, 24 days ago)

Sponsor the works and buy one, thats what im gonna do after when I get my ps. cyans and tamps ordered.

Erik006


--------------------
At last you know what ineffable is, and what ecstacy means


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,266
Last seen: 9 hours, 11 minutes
Re: Psilocybe hispanica [Re: Workman]
    #24205371 - 03/30/17 01:13 PM (6 years, 9 months ago)

Could P. hispanica be conspecific with P. semilanceata?

The ITS sequences are just one base pair different, and it's just that one A turned into two A's near the beginning of the sequence, which is likely not even a real difference.

Perhaps they found P. semilanceata on horse dung and thought it was something new because of the unusual substrate.  But horse dung is really just chewed up grass, so it's not that much of a leap - and P. semilanceata is found in the area.

The LSU sequences of the two species are identical.

I am having trouble finding the original species description, which was published in "Docums Mycol. 29(no. 116): 42 (2000)".  Docums Mycol. is short for Les Documents Mycologiques.

Here's a photo of the holotype:  http://mushroomobserver.org/241329


Extras: Filter Print Post Top
OfflineWorkmanV
1999 Spore War Veteran
Male User Gallery


Registered: 03/01/01
Posts: 3,598
Loc: Oregon, USA
Last seen: 1 hour, 31 minutes
Trusted Cultivator
Re: Psilocybe hispanica [Re: Alan Rockefeller]
    #24205813 - 03/30/17 03:53 PM (6 years, 9 months ago)

I need to revisit this species. It is similar to P. semilanceata but it is much more responsive to cultivation, for whatever that is worth.


--------------------
Research funded by the patrons of
The Spore Works
Exotic Spore Supply

My Instagram
Reinvesting 25% of Sales Towards Basic Research and Species Identification :amanitajar:


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,266
Last seen: 9 hours, 11 minutes
Re: Psilocybe hispanica [Re: Workman]
    #24206168 - 03/30/17 06:12 PM (6 years, 9 months ago)

Perhaps a variety that has evolved to be more tolerant of different substrates.  Whether it should be called a separate species is hard to say, I wonder what they would look like cultivated side by side.....and if there are any microscopic differences.  I wonder if the difference in ITS sequences between P. hispanica and P. semilanceata would continue to be seen if more collections were sequenced.


Extras: Filter Print Post Top
Invisiblefunkymonk22
In Service to the Ineffable..
Male User Gallery

Registered: 01/25/16
Posts: 469
Loc: The Big O
Re: Psilocybe hispanica [Re: Alan Rockefeller]
    #24211116 - 04/01/17 02:49 PM (6 years, 9 months ago)

i grew p hispanica in monotubs in a cold room this winter..temps were about 50-60F.  one of the easiest and most prolific species i have grown..


not sure about potency yet, havent had the time to try em


--------------------


"The clouds didn't look like cotton, they didn't even look like clouds.."-Townes Van Zandt


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,266
Last seen: 9 hours, 11 minutes
Re: Psilocybe hispanica [Re: funkymonk22]
    #24211120 - 04/01/17 02:50 PM (6 years, 9 months ago)

How was the potency?  One person grew P. hispanica and said that nothing happened when the fruits were eaten.


Extras: Filter Print Post Top
Invisiblefunkymonk22
In Service to the Ineffable..
Male User Gallery

Registered: 01/25/16
Posts: 469
Loc: The Big O
Re: Psilocybe hispanica [Re: Alan Rockefeller]
    #24211132 - 04/01/17 02:54 PM (6 years, 9 months ago)

you know, ive got mixed feedback from trusted friends..one got a buzz off a couple grams but then another ate 5g and got nothing. I will be sure to report back as soon as i try them myself...im actually watching one of your mexico mushroom excursions on youtube right now Allen:grin:

so cool, youve got me very interested in zapotecorum..just gotta locate spores


--------------------


"The clouds didn't look like cotton, they didn't even look like clouds.."-Townes Van Zandt


Extras: Filter Print Post Top
Invisiblefunkymonk22
In Service to the Ineffable..
Male User Gallery

Registered: 01/25/16
Posts: 469
Loc: The Big O
Re: Psilocybe hispanica [Re: funkymonk22]
    #24219118 - 04/04/17 09:34 PM (6 years, 9 months ago)

so just to add to the confusion, i had 3 friend split 5g of hispanica and all had a mild but definite experience..i will be trying them soon and will offer up my bioassay to the pursuit of science:wink:


--------------------


"The clouds didn't look like cotton, they didn't even look like clouds.."-Townes Van Zandt


Extras: Filter Print Post Top
OfflineLennybernadino
Amazon grower
Male User Gallery

Registered: 09/16/09
Posts: 770
Loc: Iquitos, Peru
Last seen: 5 months, 6 hours
Re: Psilocybe hispanica [Re: funkymonk22]
    #24225659 - 04/07/17 02:24 PM (6 years, 9 months ago)

Popcorn eating smiley, i hope that is helpful info


Extras: Filter Print Post Top
Invisiblefunkymonk22
In Service to the Ineffable..
Male User Gallery

Registered: 01/25/16
Posts: 469
Loc: The Big O
Re: Psilocybe hispanica [Re: Lennybernadino] * 1
    #24239750 - 04/13/17 09:02 AM (6 years, 9 months ago)



couple hispanica shots from this morning..still fruiting away, they seem to love the PNW..i wonder if we can naturalize them here


--------------------


"The clouds didn't look like cotton, they didn't even look like clouds.."-Townes Van Zandt


Extras: Filter Print Post Top
InvisibleSporulator
Male User Gallery

Registered: 03/08/11
Posts: 1,643
Loc: Europe
Re: Psilocybe hispanica [Re: Alan Rockefeller] * 2
    #24886937 - 01/03/18 08:38 AM (6 years, 25 days ago)

Quote:

Alan Rockefeller said:
Could P. hispanica be conspecific with P. semilanceata?

The ITS sequences are just one base pair different, and it's just that one A turned into two A's near the beginning of the sequence, which is likely not even a real difference.

Perhaps they found P. semilanceata on horse dung and thought it was something new because of the unusual substrate.  But horse dung is really just chewed up grass, so it's not that much of a leap - and P. semilanceata is found in the area.

The LSU sequences of the two species are identical.

I am having trouble finding the original species description, which was published in "Docums Mycol. 29(no. 116): 42 (2000)".  Docums Mycol. is short for Les Documents Mycologiques.

Here's a photo of the holotype:  http://mushroomobserver.org/241329




      I never saw Psilocybe semilanceata fruiting directly from cow patties or horse droppings.

      The Psilocybe hispanica strain I am working with does not look like Psilocybe semilanceata.

      It is easy to grow compared to Psilocybe semilanceata, a casing layer is not necessary. It is a cold weather species like Psilocybe semilanceata,
      fruiting between 40 and 60 F and the potency is definitely equal to Psilocybe semilanceata.

      But is the species I am working with really Psilocybe hispanica?

      And was the material used for DNA sequencing really Psilocybe hispanica?  Where did the material come from?  This is all very confusing.








--------------------
                 


Edited by Sporulator (01/03/18 10:32 AM)


Extras: Filter Print Post Top
OfflineMateo
High on LIFE!
Male User Gallery


Registered: 06/24/11
Posts: 2,689
Loc: North Europe
Last seen: 3 years, 3 months
Re: Psilocybe hispanica [Re: Sporulator] * 1
    #24891943 - 01/05/18 01:53 PM (6 years, 23 days ago)

I saw pictures of a whole cluster P.Semilanceata fruiting directly from some animal poo.
It was a thread about it in a swedish forum back in 2012.
And it was Psilocybe semilanceata, im 100% sure of it having picked thousands of them.
We thought it was odd it fruiting directly on the poo like that.

In fact i have always thought P.Semilanceata has some connection to dung.
Where they grow in suburb areas over here they tend to grow grass lawns who has been newly laid out or grass lawn sown previous year.
Then they grow on these for a few years with declining numbers.
Just if they use up the nutrients or fertilizers in the soil.
And they always use animal poo of some sort as a fertilizer.
So P.Semilanceata is probably a dung lover, at least partially.


--------------------
A wise rat has many holes


Edited by Mateo (01/05/18 02:07 PM)


Extras: Filter Print Post Top
InvisibleSporulator
Male User Gallery

Registered: 03/08/11
Posts: 1,643
Loc: Europe
Re: Psilocybe hispanica [Re: Mateo] * 1
    #24893131 - 01/05/18 11:04 PM (6 years, 22 days ago)

Quote:

Mateo said:
I saw pictures of a whole cluster P.Semilanceata fruiting directly from some animal poo.
It was a thread about it in a swedish forum back in 2012.
And it was Psilocybe semilanceata, im 100% sure of it having picked thousands of them.
We thought it was odd it fruiting directly on the poo like that.

In fact i have always thought P.Semilanceata has some connection to dung.
Where they grow in suburb areas over here they tend to grow grass lawns who has been newly laid out or grass lawn sown previous year.
Then they grow on these for a few years with declining numbers.
Just if they use up the nutrients or fertilizers in the soil.
And they always use animal poo of some sort as a fertilizer.
So P.Semilanceata is probably a dung lover, at least partially.




I agree with you that Psilocybe semilanceata is a nitrophilous species.

But I've never found them fruiting directly from dung here in Central Europe.

I always find them growing on former and now abandoned pastures, which have turned into ordinary grassland.

I suspect that another active species from Northern Spain could be involved in this confusion.

Psilocybe gallaeciae  described in 2003 for the first time by Guzman in this paper: 

http://www.samorini.it/doc1/alt_aut/ek/guzman03.pdf

http://mushroomobserver.org/observer/show_observation/59103


Edited by Sporulator (01/07/18 09:22 AM)


Extras: Filter Print Post Top
OfflineMateo
High on LIFE!
Male User Gallery


Registered: 06/24/11
Posts: 2,689
Loc: North Europe
Last seen: 3 years, 3 months
Re: Psilocybe hispanica [Re: Sporulator] * 1
    #24894023 - 01/06/18 11:59 AM (6 years, 22 days ago)

Intresting.

It wouldn´t suprice me if P.semilanceata has a few different sub varietys and that P.semilanceata and similar psilocybes are just same base mushroom that evolved to do well in their growing habitat.
How much must a mushroom change/evolve to be considered a new one?


--------------------
A wise rat has many holes


Extras: Filter Print Post Top
InvisibleSporulator
Male User Gallery

Registered: 03/08/11
Posts: 1,643
Loc: Europe
Re: Psilocybe hispanica [Re: Mateo] * 1
    #24895451 - 01/06/18 11:13 PM (6 years, 21 days ago)

Quote:

Mateo said:
How much must a mushroom change/evolve to be considered a new one?




      Good question!  But I'm a cultivator, not a taxonomist. You should ask Alan Rockefeller or Workman this question.

      I think an interesting experiment would be to grow mycelium of Psilocybe semilanceata and Psilocybe hispanica on the same agar plate.

      If they are the same species, no barrage formation should occur. Barrage formation means, that no nuclear exchange takes place, although hyphal fusions occur.


      https://link.springer.com/chapter/10.1007/978-3-642-69299-4_17


--------------------
                 


Extras: Filter Print Post Top
OfflineMateo
High on LIFE!
Male User Gallery


Registered: 06/24/11
Posts: 2,689
Loc: North Europe
Last seen: 3 years, 3 months
Re: Psilocybe hispanica [Re: Sporulator] * 1
    #24895839 - 01/07/18 07:35 AM (6 years, 21 days ago)

So if for example a mycel of say Psilocybe Cubensis variation Maztapec were grown on the same agarplate as Psilocybe Cubensis variation Golden teacher, the two would not form a barrier when they meet and mix smoothly as both are Psilocybe Cubensis?
They have probably grown separatley for many years and had time to adapt/evolve a bit of ther own.
But this should not matter then and no barrier form, that is intresting as it can be used as a tool to differentiate 2 mushrooms, just as you say.

Too bad my myco refridgerator has broken down, maybe i try this when i get a new one.
I think i have some spores of both P.semilanceata and P.hispanica.


--------------------
A wise rat has many holes


Extras: Filter Print Post Top
InvisibleSporulator
Male User Gallery

Registered: 03/08/11
Posts: 1,643
Loc: Europe
Re: Psilocybe hispanica [Re: Mateo] * 1
    #24895921 - 01/07/18 08:34 AM (6 years, 21 days ago)

Quote:

Mateo said:
So if for example a mycel of say Psilocybe Cubensis variation Maztapec were grown on the same agarplate as Psilocybe Cubensis variation Golden teacher, the two would not form a barrier when they meet and mix smoothly as both are Psilocybe Cubensis?




      Yes.


--------------------
                 


Extras: Filter Print Post Top
InvisiblebodhisattaMDiscordReddit
Smurf real estate agent
 User Gallery
Folding@home Statistics
Registered: 04/30/13
Posts: 61,889
Loc: Milky way
Trusted Cultivator
Re: Psilocybe hispanica [Re: Sporulator] * 1
    #24898113 - 01/08/18 08:29 AM (6 years, 20 days ago)

Quote:

Sporulator said:
Quote:

Mateo said:
So if for example a mycel of say Psilocybe Cubensis variation Maztapec were grown on the same agarplate as Psilocybe Cubensis variation Golden teacher, the two would not form a barrier when they meet and mix smoothly as both are Psilocybe Cubensis?




      Yes.



:whathesaid:
Spores have absolutely no idea a human wrote a name on their syringe.
If they're the same species that's all they care about. And mating type


--------------------
Welcome to the Advanced Mycology Forum

Bod's Library    Article behind a paywall? I can try to get it for you


Extras: Filter Print Post Top
OfflineMateo
High on LIFE!
Male User Gallery


Registered: 06/24/11
Posts: 2,689
Loc: North Europe
Last seen: 3 years, 3 months
Re: Psilocybe hispanica [Re: bodhisatta] * 1
    #24905424 - 01/11/18 12:38 PM (6 years, 17 days ago)

But mushrooms evolve, change, adapt with time and environment.
So at some point they must have changed so much a new mushroom is developed.
Or it has at least changed enough to make a barrier on the agarplate.
Is´t that how every mushroom has allways been created?


--------------------
A wise rat has many holes


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,266
Last seen: 9 hours, 11 minutes
Re: Psilocybe hispanica [Re: Mateo] * 1
    #24911907 - 01/13/18 08:09 PM (6 years, 14 days ago)

Quote:

Mateo said:
How much must a mushroom change/evolve to be considered a new one?





There is a central authority on nomenclature, but no central authority on taxonomy.  Therefore it is up to each individual person to answer that question for themselves, as there is no set number of changes that triggers it being new species.

I like to follow Dr. Bas's species concept, which is that there should be three unrelated differences.  They could be macromorphological, microscopic, chemical or molecular (DNA).

The biological species concept is a good way to answer this question in animals, but does not really work in plants or fungi since they hybridize often.


Extras: Filter Print Post Top
InvisiblebodhisattaMDiscordReddit
Smurf real estate agent
 User Gallery
Folding@home Statistics
Registered: 04/30/13
Posts: 61,889
Loc: Milky way
Trusted Cultivator
Re: Psilocybe hispanica [Re: Alan Rockefeller] * 1
    #24914245 - 01/14/18 05:59 PM (6 years, 14 days ago)

Just an unrelated anecdote for anyone interested
https://en.m.wikipedia.org/wiki/Brassica_oleracea

broccoli, cauliflower, kale, Romanesco, Rapini, Brussels sprouts, collard greens, savoy, kohlrabi, and gai lan.
Are all the exact same species.
And all so very different. There's some you probably love and some you hate on that list.

Canines are like this too. There's obvious and vast difference between breeds


--------------------
Welcome to the Advanced Mycology Forum

Bod's Library    Article behind a paywall? I can try to get it for you


Extras: Filter Print Post Top
InvisibleMushroomOfLife
Loopdidoop
I'm a teapot


Registered: 11/05/17
Posts: 47
Loc: Tanganyika
Re: Psilocybe hispanica [Re: bodhisatta] * 1
    #25278290 - 06/19/18 07:22 AM (5 years, 7 months ago)

Quote:

bodhisatta said:
Just an unrelated anecdote for anyone interested
https://en.m.wikipedia.org/wiki/Brassica_oleracea

broccoli, cauliflower, kale, Romanesco, Rapini, Brussels sprouts, collard greens, savoy, kohlrabi, and gai lan.
Are all the exact same species.
And all so very different. There's some you probably love and some you hate on that list.

Canines are like this too. There's obvious and vast difference between breeds




Sorry to revisit an old thread, but Kale is the spawn of the devil!


--------------------


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,266
Last seen: 9 hours, 11 minutes
Re: Psilocybe hispanica [Re: MushroomOfLife] * 1
    #25284095 - 06/21/18 07:54 PM (5 years, 7 months ago)

Quote:

MushroomOfLife said:
Sorry to revisit an old thread, but Kale is the spawn of the devil!





Why?


Extras: Filter Print Post Top
Invisiblesaralove
Female User Gallery


Registered: 10/01/13
Posts: 1,068
Trusted Cultivator
Re: Psilocybe hispanica [Re: Workman] * 10
    #26498787 - 02/22/20 05:20 PM (3 years, 10 months ago)

Quote:

Workman said:
Outdoor cultivated Psilocybe hispanica.  This species is relatively easy to grow on sterilized horse manure placed outside during cool fall weather (around 60F).  A relatively newly described species from Spain.  In Spain it grows directly on sheep dung in fields that also support fruitings of Psilocybe semilanceata








Very small specimens growing from a displaced piece of colonized horse dung.  Rodents or birds dug into the patch and scattered small pieces of dung that later fruited.  It is interesting to note the reduced size of the mushrooms when growing from very small amounts of substrate.



This is a larger specimen from the main patch.  Still a relatively small mushroom.  The odor is very similar to Psilocybe semilanceata and the appearance reminds me of Psilocybe mexicana   





I hope this puts a smile on your face workman wherever you are  =)

P. hispanica as a fun little cake




your teachings live on:mushroom2:



always your student,

sara




ps.

hi everyone:sun:


--------------------
:bliss:
Listening to: emancipator - baralku tour (live)  |  AMU


Extras: Filter Print Post Top
OfflinePliny_the_Elder
Stranger

Registered: 02/22/20
Posts: 13
Last seen: 2 years, 11 months
Re: Psilocybe hispanica [Re: saralove] * 1
    #26500401 - 02/23/20 07:14 PM (3 years, 10 months ago)

Nice job! Did you have to do anything special compared to growing a normal cube?


Extras: Filter Print Post Top
Offlinebw86
Doesn't play well with others


Registered: 11/12/06
Posts: 5,937
Loc: 7b
Last seen: 4 hours, 7 minutes
Trusted Cultivator
Re: Psilocybe hispanica [Re: Pliny_the_Elder] * 2
    #26500936 - 02/24/20 05:18 AM (3 years, 10 months ago)

holy shit. I have tried to germinate the print i have from sporeworks a  dozen times.
Amazing work!
I wish i could give you 5 more shrooms!


Extras: Filter Print Post Top
OfflineLoaded Shaman
Psychophysiologist
Male User Gallery


Registered: 03/02/15
Posts: 8,006
Loc: Now O'Clock
Last seen: 27 days, 2 hours
Re: Psilocybe hispanica [Re: Workman] * 1
    #27106754 - 12/25/20 12:19 AM (3 years, 1 month ago)

Beautiful, OP! :kenthumbup:


--------------------



"Real knowledge is to know the extent of one’s ignorance." — Confucius


Extras: Filter Print Post Top
Invisiblecoversall
إِنْ شَاءَ ٱللَهُ
 Unread Journal


Registered: 06/06/20
Posts: 2,749
Loc: संसार
Re: Psilocybe hispanica [Re: saralove] * 1
    #27110417 - 12/27/20 09:50 AM (3 years, 1 month ago)

Quote:

saralove said:
Quote:

Workman said:
Outdoor cultivated Psilocybe hispanica.  This species is relatively easy to grow on sterilized horse manure placed outside during cool fall weather (around 60F).  A relatively newly described species from Spain.  In Spain it grows directly on sheep dung in fields that also support fruitings of Psilocybe semilanceata








Very small specimens growing from a displaced piece of colonized horse dung.  Rodents or birds dug into the patch and scattered small pieces of dung that later fruited.  It is interesting to note the reduced size of the mushrooms when growing from very small amounts of substrate.



This is a larger specimen from the main patch.  Still a relatively small mushroom.  The odor is very similar to Psilocybe semilanceata and the appearance reminds me of Psilocybe mexicana   





I hope this puts a smile on your face workman wherever you are  =)

P. hispanica as a fun little cake




your teachings live on:mushroom2:



always your student,

sara




ps.

hi everyone:sun:




What an awesome bump! Those are stunning! I'm going to watch this thread with interest.


--------------------

..:: E V E R Y  ::..

..:: New? Start here. ::..
..:: How I Panaeolus. From Agar to Tea ::..


Extras: Filter Print Post Top
OfflineV.L
Male User Gallery

Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 2 days, 5 hours
Trusted Cultivator
Re: Psilocybe hispanica [Re: coversall] * 3
    #27726779 - 04/09/22 06:28 AM (1 year, 9 months ago)



They are small, for me too easier to grow than semilanceata (as I failed all attempts with semi indoor) phenotype remind me a bit tampanensis but prefer colder temperature.. thanks to CaptainFuture for the print it was a something I wanted to observe since years and will work more on it! Fingers crossed for printing in few days!


Edited by V.L (04/09/22 09:23 AM)


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,266
Last seen: 9 hours, 11 minutes
Re: Psilocybe hispanica [Re: V.L] * 1
    #27731885 - 04/12/22 07:28 PM (1 year, 9 months ago)

I believe that Psilocybe hispanica is a synonym of P. semilanceata or P. fimetaria.    The fruits in this thread look like P. fimetaria.

Someone should do some DNA work on these!

I'd be happy to but I don't have any material.


Extras: Filter Print Post Top
OfflineV.L
Male User Gallery

Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 2 days, 5 hours
Trusted Cultivator
Re: Psilocybe hispanica [Re: Alan Rockefeller] * 2
    #27732067 - 04/12/22 10:21 PM (1 year, 9 months ago)

Does a spore print is enough material? feel free to pm..

Psilocybe hispanica



hispanica printing

Those are the last pic I could upload, normal account limit reached :frown:


Edited by V.L (04/13/22 06:53 AM)


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,266
Last seen: 9 hours, 11 minutes
Re: Psilocybe hispanica [Re: V.L]
    #27732687 - 04/13/22 11:08 AM (1 year, 9 months ago)

Yes a spore print is good.    I sent you a PM and gave you unlimited image uploads.


Extras: Filter Print Post Top
OfflineV.L
Male User Gallery

Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 2 days, 5 hours
Trusted Cultivator
Re: Psilocybe hispanica [Re: Alan Rockefeller]
    #27732789 - 04/13/22 12:20 PM (1 year, 9 months ago)

Cool! Thanks for pictures space, deleted few old pics today to upload but that’s really better! Will send a print to your way, if it can help to have more knowledge on them..


Extras: Filter Print Post Top
OfflineV.L
Male User Gallery

Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 2 days, 5 hours
Trusted Cultivator
Re: Psilocybe hispanica [Re: V.L]
    #27752867 - 04/27/22 02:17 AM (1 year, 8 months ago)

Took 2 weeks for a little second flush:



Some spores under my very old microscope and phone photo:



Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,266
Last seen: 9 hours, 11 minutes
Re: Psilocybe hispanica [Re: V.L]
    #27753944 - 04/27/22 07:38 PM (1 year, 8 months ago)

Are those dry spores?

How are you preparing the slide?


Extras: Filter Print Post Top
OfflineV.L
Male User Gallery

Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 2 days, 5 hours
Trusted Cultivator
Re: Psilocybe hispanica [Re: Alan Rockefeller]
    #27755057 - 04/28/22 12:50 PM (1 year, 8 months ago)

It was dry spores on slide then just one drop of water to separate them a bit and leave it until slide was dry again to not put water on the microscope.. I’m not practicing microscopy very often & was my first time with this specie. Did you received the print yet?


Edited by V.L (04/28/22 01:41 PM)


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,266
Last seen: 9 hours, 11 minutes
Re: Psilocybe hispanica [Re: V.L] * 1
    #27755634 - 04/28/22 08:03 PM (1 year, 8 months ago)

It hasn't arrived yet unless it was in the little stack of mail that I brought to the lab the other day. 

Spores are generally studied when hydrated - yours look a bit collapsed, which is what they are like when they are dry.

I suggest rehydrating them with a half drop of 5% KOH, then putting down a coverslip, lifting it up slightly and putting it back down until air bubbles are gone.  Optionally paint a ring of nail polish around the edge of the coverslip.    Observe using the 100x oil immersion objective, with a drop of immersion oil on top of the coverslip.  If you don't have immersion oil you can use vegetable oil or even isopropanol in a pinch.

If you don't have KOH you can use 70% isopropanol, then let it half dry by blowing on it for 20 seconds or so, then add a half drop of water and put down the coverslip.

If you have a condenser under the stage, open and close it until the image looks best.  It generally should be more closed with the lower power objectives and more open at the higher magnifications.


Extras: Filter Print Post Top
OfflineV.L
Male User Gallery

Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 2 days, 5 hours
Trusted Cultivator
Re: Psilocybe hispanica [Re: Alan Rockefeller]
    #27756033 - 04/29/22 02:32 AM (1 year, 8 months ago)

Thanks for all the info & advice about microscopic practice it’s an other world!! even I’m usually more into macroscopic observations and printing. I did a 2nd cake from more isolated culture and it’s pinning like crazy! Will share some pics if they mature well.. have a nice day


Extras: Filter Print Post Top
OfflineV.L
Male User Gallery

Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 2 days, 5 hours
Trusted Cultivator
Re: Psilocybe hispanica [Re: V.L] * 8
    #27762299 - 05/04/22 02:01 AM (1 year, 8 months ago)

2nd cake 1st flush


Extras: Filter Print Post Top
OfflineDH42
Local to somewhere
 User Gallery


Registered: 10/05/20
Posts: 92
Loc: Scotland Flag
Last seen: 1 day, 13 hours
Re: Psilocybe hispanica [Re: Alan Rockefeller] * 1
    #27762497 - 05/04/22 08:43 AM (1 year, 8 months ago)

I agree Alan, the ones in this thread do look similar to P.fimetaria. I'll attach some examples of hispanica-looking-fimetaria below.

If P.hispanica is actually P.fimetaria, it would mean we would be able to add sheep manure to the list of substrate from which P.fimetaria grows. Also, I have a suspicion that P.fimetaria might grow from Red Deer manure - at least in Scotland/UK.

I saw in another comment, from a few years ago, you said you had an ITS and LSU sequence of P.hispanica. Have you tried comparing the ITS to one of P.fimetaria?














--------------------
Have a look at the subreddit r/fimetaria!


Extras: Filter Print Post Top
OfflineV.L
Male User Gallery

Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 2 days, 5 hours
Trusted Cultivator
Re: Psilocybe hispanica [Re: DH42]
    #27762612 - 05/04/22 10:06 AM (1 year, 8 months ago)

Yes maybe they are conspecific with fimetaria (I don’t think with semilanceata) I hope Alan will receive the prints and could give the final answer with genome sequencing.. personally really love how they look! hispanica or even if it’s same with fimetaria.. do you or someone have a fimetaria prints? so I can work also on it to try to do a comparative grow. And does anyone know a bit more about hispanica/fimetaria usual potency?


Extras: Filter Print Post Top
InvisibleinskiM
Cortinariologist
Male User Gallery


Registered: 02/28/06
Posts: 5,720
Trusted Cultivator
Re: Psilocybe hispanica [Re: V.L] * 5
    #27762754 - 05/04/22 12:15 PM (1 year, 8 months ago)

I think Psilocybe alutacea should be included in these comparisons.


--------------------


Extras: Filter Print Post Top
OfflineDH42
Local to somewhere
 User Gallery


Registered: 10/05/20
Posts: 92
Loc: Scotland Flag
Last seen: 1 day, 13 hours
Re: Psilocybe hispanica [Re: V.L] * 1
    #27765544 - 05/06/22 07:07 AM (1 year, 8 months ago)

Quote:

V.L said:
Yes maybe they are conspecific with fimetaria (I don’t think with semilanceata) I hope Alan will receive the prints and could give the final answer with genome sequencing.. personally really love how they look! hispanica or even if it’s same with fimetaria.. do you or someone have a fimetaria prints? so I can work also on it to try to do a comparative grow. And does anyone know a bit more about hispanica/fimetaria usual potency?





Perhaps they are conspecific with P.fimetaria. You are right - they are definitely different to P.semilanceata. However, they are undoubtedly closely related.

I do have some P.fimetaria prints.

Potency for P.fimetaria (and perhaps, by extension, P.hispanica) is an unresolved topic. From what I have observed and been told, the potency varies considerably for P.fimetaria. Most often it is considerably less potent than, say, P.semilanceata. However, some people report effects on par with P.semilanceata gram-for-gram. The issue ties in with the (lack of) blue bruising found on most P.fimetaria specimens. I believe it might be something to do with differing substrate. I think cow manure produces weak specimens whereas horse manure can produce more moderate ones. However, the existence of P.liniformans confuses things considerably. It looks practically identical to P.fimetaria and the only differing macroscopic feature is the presence of a separable gelatinous gill edge. So, I believe some of the people who have reported strong trips off P.fimetaria *might* have been actually consuming P.liniformans. More work is needed!


--------------------
Have a look at the subreddit r/fimetaria!


Extras: Filter Print Post Top
OfflineDH42
Local to somewhere
 User Gallery


Registered: 10/05/20
Posts: 92
Loc: Scotland Flag
Last seen: 1 day, 13 hours
Re: Psilocybe hispanica [Re: inski] * 3
    #27765546 - 05/06/22 07:08 AM (1 year, 8 months ago)

Quote:

inski said:
I think Psilocybe alutacea should be included in these comparisons.






Another potential candidate for P.fimetaria!



--------------------
Have a look at the subreddit r/fimetaria!


Extras: Filter Print Post Top
OfflineV.L
Male User Gallery

Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 2 days, 5 hours
Trusted Cultivator
Re: Psilocybe hispanica [Re: DH42] * 1
    #27766754 - 05/06/22 11:47 PM (1 year, 8 months ago)

Thanks Insky & DH42 interesting! I only had few fruits on my alutacea attempt years ago and last tries it didn’t germinate (probably too old) Feel free to PM to exchange few prints ; ) to try to compare all of them.. have a beautiful weekend!


Extras: Filter Print Post Top
InvisibleBaba Yaga
♥ coir grower

Registered: 09/13/20
Posts: 3,955
Loc: Hyperspace Chicken Coop
Trusted Cultivator
Re: Psilocybe hispanica [Re: V.L] * 1
    #27776389 - 05/14/22 01:55 AM (1 year, 8 months ago)

Hey just popping by to post some photos of a few fruits from this years semilanceata grow.
I will send these away for sequencing soon and will post the result.



Edited by Baba Yaga (06/15/22 03:41 PM)


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,266
Last seen: 9 hours, 11 minutes
Re: Psilocybe hispanica [Re: Baba Yaga]
    #27779682 - 05/16/22 12:40 AM (1 year, 8 months ago)

Quote:

Baba Yaga said:
Hey just popping by to post some photos of a few fruits from this years semilanceata grow.
I will send these away for sequencing soon and will post the result.




Very cool!  When you get data PM me if you want to do a quick zoom call - I can share my screen show you how I analyze sequence data using free tools and put it into Genbank.


Extras: Filter Print Post Top
InvisibleBaba Yaga
♥ coir grower

Registered: 09/13/20
Posts: 3,955
Loc: Hyperspace Chicken Coop
Trusted Cultivator
Re: Psilocybe hispanica [Re: Alan Rockefeller]
    #27779822 - 05/16/22 05:01 AM (1 year, 8 months ago)

That would be great Alan.


Extras: Filter Print Post Top
OfflineDH42
Local to somewhere
 User Gallery


Registered: 10/05/20
Posts: 92
Loc: Scotland
Last seen: 1 day, 13 hours
Re: Psilocybe hispanica [Re: Baba Yaga]
    #27780540 - 05/16/22 04:31 PM (1 year, 8 months ago)

very nice - on the assumption that they are growing from dung (which it looks like they are) they may well be P.fimetaria!


--------------------
Have a look at the subreddit r/fimetaria!


Extras: Filter Print Post Top
InvisibleBaba Yaga
♥ coir grower

Registered: 09/13/20
Posts: 3,955
Loc: Hyperspace Chicken Coop
Trusted Cultivator
Re: Psilocybe hispanica [Re: DH42]
    #27780714 - 05/16/22 07:25 PM (1 year, 8 months ago)

At this stage anything is possible. This is grain spawned to potting mix by the way,
no manure in there at least it didn't say anything about it on the bag.

Still hoping that these are semilanceata since none of the cultivated specimens
really look like what you can find in the wild.


Extras: Filter Print Post Top
Offlinesmalltalk_canceled
Babnik
 User Gallery

Registered: 07/13/20
Posts: 2,862
Last seen: 11 days, 5 hours
Re: Psilocybe hispanica [Re: Baba Yaga]
    #27783867 - 05/19/22 06:05 AM (1 year, 8 months ago)

Joining this thread too, because of all the good info and the recent development.

Its going to be super exciting to follow hispanica/semilanceata/fimetaria complex.

Got a lot of small individual subs going outside, inside, etc

Im sure we'll have more answers by end of 2022

-

Quote:

funkymonk22 said:
i grew p hispanica in monotubs in a cold room this winter..temps were about 50-60F.  one of the easiest and most prolific species i have grown..


not sure about potency yet, havent had the time to try em





Also to me, the tub here is very alike to my sequenced p fimetaria


--------------------
Willpower is the one true virtue



Edited by smalltalk_canceled (05/24/22 03:14 AM)


Extras: Filter Print Post Top
OfflineKing0fthajuice
Colors
Male

Registered: 06/28/17
Posts: 325
Loc: Wild Like Volusia in the 80s
Last seen: 1 year, 29 days
Re: Psilocybe hispanica [Re: Alan Rockefeller]
    #27786235 - 05/20/22 09:35 PM (1 year, 8 months ago)

Quote:

Alan Rockefeller said:
Quote:

Baba Yaga said:
Hey just popping by to post some photos of a few fruits from this years semilanceata grow.
I will send these away for sequencing soon and will post the result.




Very cool!  When you get data PM me if you want to do a quick zoom call - I can share my screen show you how I analyze sequence data using free tools and put it into Genbank.





So I'm going to tell VL that he should send you another sample, I told him how my tamp sample was misplaced as well.  I want you to do that for me man, I've been dying to know for over a year now~!  I know your in GA right now and have been busy doing conventions!

I'll private message you but I'm putting this part here so you have a responsibility :wink:


--------------------
I like rain

Whether you think you can or you think you can’t, you’re right!


Extras: Filter Print Post Top
OfflineMycoCakes
Stranger


Registered: 11/25/20
Posts: 20
Last seen: 2 months, 18 days
Re: Psilocybe hispanica [Re: Alan Rockefeller]
    #27786393 - 05/21/22 01:43 AM (1 year, 8 months ago)

Hey Alan. Did you ever find out what they were?


Extras: Filter Print Post Top
Offlinesmalltalk_canceled
Babnik
 User Gallery

Registered: 07/13/20
Posts: 2,862
Last seen: 11 days, 5 hours
Re: Psilocybe hispanica [Re: MycoCakes] * 4
    #27812106 - 06/09/22 11:27 AM (1 year, 7 months ago)










--------------------
Willpower is the one true virtue



Edited by smalltalk_canceled (06/09/22 04:55 PM)


Extras: Filter Print Post Top
InvisibleBaba Yaga
♥ coir grower

Registered: 09/13/20
Posts: 3,955
Loc: Hyperspace Chicken Coop
Trusted Cultivator
Re: Psilocybe hispanica [Re: smalltalk_canceled] * 5
    #27883715 - 07/31/22 04:52 AM (1 year, 5 months ago)

Ok, so I got the sequence results back and the mushrooms I grew are semilanceata from what I can see.

A few examples from the first Semilanceata Grow 2020:




and some fruits from second grow 2022 started with spores from above. Samples for sequencing were taken from this grow:

 


Because I banned myself for a few weeks I couldn’t get in touch with Alan but instead I watched his videos on youtube about how to work the
data and this is what I got out from alingning the sequence with BLAST and creating a phylogenetic tree with Geneious Prime.

Alan, I can send you the .ab1 file if you want to have a look at that.


Sequence:

ACCTGATTTGAGGNCAAATTGTCATTTGTATTGTCCAGTGAAGGACGGTTAGAAGCAGCGCAATCCCATTCATGCAAAGGTCCACGGCGTAGATAATTATCACACCAATAGACGGCTCTGCGCGGGGCACCGGCTAATACATTTAAGGGGAGCAGACCTCTTGACGAAGCCAGCAAAAGACCCCCACATCCAAGCCATTATCAGCAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGTTTATAGGCACAAGGCCAATATAATACATTCTGTTACATTCTTTGGGGTATATGAAAACGTAGGCCTGGGTTAATTTGCAAGGAGAGCTTGTGAAAGCAATCCTCTTGACCGAGTTTCCTCGGAAAGTTAACTAATCCAGGTCTACAAAAGGTGCACAGGTGGAGAGATAAAGATGACACGGCGAGCACATGCCCCCGAGAGGACCAGCTACAACCGAGCCAAGTTCATTCAATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGAAACCAAGGAAA


Alignment with the top match in Blast showing only one difference between the two and a phylogenetic tree made with Snap-Gene:




This should be right, right? Since I am not a pro in this regard I would appreciate if you could confirm my findings Alan so I can re-post these
results in a few other places like the Hunting&ID Forum, the Misc Exotic Thread  and include it in the introduction of the Official Sem Thread as well.


Edited by Baba Yaga (08/02/22 04:38 PM)


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,266
Last seen: 9 hours, 11 minutes
Re: Psilocybe hispanica [Re: Baba Yaga]
    #27886287 - 08/02/22 12:25 AM (1 year, 5 months ago)

Yes definitely semilanceata.  I replied to your PM.

It would be cool to put these photos on Mushroom Observer, upload the sequence data to Genbank and link the Genbank record to the Mushroom Observer record so there's a permanent record of this, it'd be good to be able to refer to it when looking at possible semilanceata photos.

A good way to share .ab1 files is to put it on a public Google drive link.

You can also contact me on gmail, Facebook messenger and IG, I use the same name on all 3.


Extras: Filter Print Post Top
InvisibleBaba Yaga
♥ coir grower

Registered: 09/13/20
Posts: 3,955
Loc: Hyperspace Chicken Coop
Trusted Cultivator
Re: Psilocybe hispanica [Re: Alan Rockefeller]
    #27886306 - 08/02/22 01:09 AM (1 year, 5 months ago)

Thanks Alan, there is no reply in my inbox though. I have your gmail address and will get in touch soon.


Extras: Filter Print Post Top
Offlinesmalltalk_canceled
Babnik
 User Gallery


Registered: 07/13/20
Posts: 2,862
Last seen: 11 days, 5 hours
Re: Psilocybe hispanica [Re: Baba Yaga] * 1
    #27889702 - 08/04/22 12:07 PM (1 year, 5 months ago)



--------------------
Willpower is the one true virtue



Extras: Filter Print Post Top
Offlinesmalltalk_canceled
Babnik
 User Gallery


Registered: 07/13/20
Posts: 2,862
Last seen: 11 days, 5 hours
Re: Psilocybe hispanica [Re: smalltalk_canceled]
    #27903560 - 08/14/22 07:07 PM (1 year, 5 months ago)



Does this mycelium look like agaricus blazeii or like hispanica


--------------------
Willpower is the one true virtue



Extras: Filter Print Post Top
OfflineDH42
Local to somewhere
 User Gallery


Registered: 10/05/20
Posts: 92
Loc: Scotland
Last seen: 1 day, 13 hours
Re: Psilocybe hispanica [Re: Baba Yaga]
    #27909455 - 08/19/22 11:11 AM (1 year, 5 months ago)

Nice One Baba Yaga :thumbup:


--------------------
Have a look at the subreddit r/fimetaria!


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,266
Last seen: 9 hours, 11 minutes
Re: Psilocybe hispanica [Re: smalltalk_canceled]
    #27923995 - 08/29/22 12:09 PM (1 year, 4 months ago)

Quote:

smalltalk_canceled said:

Does this mycelium look like agaricus blazeii or like hispanica





It is hard to see what is going on here, but I would guess a mold.


Extras: Filter Print Post Top
OfflineV.L
Male User Gallery

Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 2 days, 5 hours
Trusted Cultivator
Re: Psilocybe hispanica [Re: Alan Rockefeller]
    #27924010 - 08/29/22 12:23 PM (1 year, 4 months ago)

Alan did you received/sequenced the sample I sent you?


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,266
Last seen: 9 hours, 11 minutes
Re: Psilocybe hispanica [Re: V.L]
    #27924013 - 08/29/22 12:24 PM (1 year, 4 months ago)

Quote:

V.L said:
Alan did you received/sequenced the sample I sent you?




What is the iNaturalist or Mushroom Observer observation number?


Extras: Filter Print Post Top
OfflineV.L
Male User Gallery

Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 2 days, 5 hours
Trusted Cultivator
Re: Psilocybe hispanica [Re: Alan Rockefeller] * 1
    #27924020 - 08/29/22 12:31 PM (1 year, 4 months ago)

It was from this grow:

Sent from France few months ago


Extras: Filter Print Post Top
OfflineKevinEm
Stranger
Registered: 09/15/22
Posts: 1
Last seen: 1 year, 4 months
Re: Psilocybe hispanica [Re: V.L]
    #27951596 - 09/15/22 03:40 PM (1 year, 4 months ago)

I was on a hunt may/june in Pyrenees but no luck. Spoke to a locals and heard I can find them if I got luck. Gotta do a 2nd attempt. Where do you guys find yours ??


Extras: Filter Print Post Top
OfflineV.L
Male User Gallery

Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 2 days, 5 hours
Trusted Cultivator
Re: Psilocybe hispanica [Re: KevinEm]
    #27954082 - 09/17/22 07:14 AM (1 year, 4 months ago)

Got the prints from CaptainFuture


Extras: Filter Print Post Top
OfflineV.L
Male User Gallery

Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 2 days, 5 hours
Trusted Cultivator
Re: Psilocybe hispanica [Re: V.L] * 1
    #28011128 - 10/22/22 06:20 PM (1 year, 3 months ago)


Right now doing a little comparative experience inoculated both cakes same day one with semilanceata (from Netherlands) the other with hispanica, both also put in fruiting condition same day, hispanica already started pinning but not the semilanceata yet, still keep hope for it when temperatures will be fresher..


Extras: Filter Print Post Top
OfflineWorkmanV
1999 Spore War Veteran
Male User Gallery


Registered: 03/01/01
Posts: 3,598
Loc: Oregon, USA
Last seen: 1 hour, 31 minutes
Trusted Cultivator
Re: Psilocybe hispanica [Re: V.L] * 1
    #28495629 - 10/07/23 04:25 PM (3 months, 19 days ago)

Finally got back to this species after 19 years (WTF!). Still grows easy outdoors.



Quote:

saralove said:

I hope this puts a smile on your face workman wherever you are  =)

P. hispanica as a fun little cake



your teachings live on:mushroom2:

always your student,

sara

ps.

hi everyone:sun:




Yes, made me smile. Thank you saralove if you are still around.


--------------------
Research funded by the patrons of
The Spore Works
Exotic Spore Supply

My Instagram
Reinvesting 25% of Sales Towards Basic Research and Species Identification :amanitajar:


Edited by Workman (10/07/23 04:33 PM)


Extras: Filter Print Post Top
Invisiblethe_chosen_one
On the Darkslide
Male User Gallery

Registered: 09/11/06
Posts: 2,882
Loc: 1984
Trusted Cultivator
Re: Psilocybe hispanica [Re: Workman]
    #28495640 - 10/07/23 04:42 PM (3 months, 19 days ago)

She pops in from time to time when the kids give her a break. :lol:

I think I have a print from that grow. Need to get back to them myself.


--------------------
"Luck favors the observant." - Workman



Extras: Filter Print Post Top
Invisiblecovertjoy

Registered: 07/09/23
Posts: 272
Re: Psilocybe hispanica [Re: Workman]
    #28495700 - 10/07/23 05:46 PM (3 months, 19 days ago)

I have a couple of prints of Ps. Hispanica from FSE which I'm struggling to get any germination from.

Hope to join you all in growing this species soon.



--------------------


Edited by covertjoy (10/07/23 08:26 PM)


Extras: Filter Print Post Top
Offlinesmalltalk_canceled
Babnik
 User Gallery


Registered: 07/13/20
Posts: 2,862
Last seen: 11 days, 5 hours
Re: Psilocybe hispanica [Re: covertjoy]
    #28495845 - 10/07/23 08:06 PM (3 months, 19 days ago)

its all a mess


--------------------
Willpower is the one true virtue



Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,266
Last seen: 9 hours, 11 minutes
Re: Psilocybe hispanica [Re: smalltalk_canceled] * 2
    #28495997 - 10/07/23 10:35 PM (3 months, 18 days ago)

A friend ITS sequenced Psilocybe hispanica that he got from someone (VR or something) and it was a 100% match for Psilocybe fimetaria.

I also saw a photo of P. hispanica that the person who discovered it took, and it looked just like P. fimetaria, so I think that's what these are.


Extras: Filter Print Post Top
OfflineWorkmanV
1999 Spore War Veteran
Male User Gallery


Registered: 03/01/01
Posts: 3,598
Loc: Oregon, USA
Last seen: 1 hour, 31 minutes
Trusted Cultivator
Re: Psilocybe hispanica [Re: Alan Rockefeller]
    #28496002 - 10/07/23 10:43 PM (3 months, 18 days ago)

Hmmm, it does look identical. I'll get my sample tested and report back. I also have some fimentaria and liniformans to grow out and compare.


--------------------
Research funded by the patrons of
The Spore Works
Exotic Spore Supply

My Instagram
Reinvesting 25% of Sales Towards Basic Research and Species Identification :amanitajar:


Extras: Filter Print Post Top
Offlineel gordo
not the youtube one
Male User Gallery


Registered: 09/05/20
Posts: 108
Last seen: 1 month, 18 days
Re: Psilocybe hispanica [Re: Workman]
    #28496244 - 10/08/23 08:18 AM (3 months, 18 days ago)

without knowing it, just found some of them a couple of days ago....

https://www.shroomery.org/forums/showflat.php/Number/28494130/page/1


Extras: Filter Print Post Top
OfflineDH42
Local to somewhere
 User Gallery


Registered: 10/05/20
Posts: 92
Loc: Scotland Flag
Last seen: 1 day, 13 hours
Re: Psilocybe hispanica [Re: el gordo] * 1
    #28496427 - 10/08/23 11:28 AM (3 months, 18 days ago)

It is very likely that P.hispanica is really P.fimetaria. I am in contact with the finder of the holotype and will hopefully get a few sequences of 'P.hispanica; in a month or two. The pictures that Alan refers to above were taken by this same person.

However, I think it is not impossible that it may be a distinct taxon. I have the ITS and TEF1 sequences from the P.hispanica holotype; the TEF1 doesn't really match to anything and the ITS is too incomplete to get anything very useful from it. The holotype was collected in the 1990s, so a fresh 'P.hispanica' from the original collector should confirm whether or not the species is a synonym. P.fimetaria certainly grows throughout the Pyrenees, but perhaps there is another species hiding there? I will update later in the year once we (hopefully) know!


--------------------
Have a look at the subreddit r/fimetaria!


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,266
Last seen: 9 hours, 11 minutes
Re: Psilocybe hispanica [Re: Workman]
    #28497382 - 10/09/23 08:45 AM (3 months, 17 days ago)

Quote:

Workman said:
Hmmm, it does look identical. I'll get my sample tested and report back. I also have some fimentaria and liniformans to grow out and compare.





I've put P. fimetaria and P. liniformans sequences in Genbank for comparison.


Extras: Filter Print Post Top
Onlinefireinyoface
Stranger
 User Gallery
Registered: 04/13/23
Posts: 27
Last seen: 32 seconds
Re: Psilocybe hispanica [Re: Workman] * 1
    #28499448 - 10/10/23 09:55 PM (3 months, 15 days ago)

From a print from a friend named HB from germany, Hispanica (?) growing outside in the bay area CA, will post updates


Edited by fireinyoface (10/10/23 10:40 PM)


Extras: Filter Print Post Top
Offlinesmalltalk_canceled
Babnik
 User Gallery


Registered: 07/13/20
Posts: 2,862
Last seen: 11 days, 5 hours
Re: Psilocybe hispanica [Re: fireinyoface] * 1
    #28499682 - 10/11/23 06:33 AM (3 months, 15 days ago)

Reviewing this thread and it's pictures, it seems very evident to me that the fimetaria and hispanica is either the same, or extremely closely related.

Hopefully this theory can now be used to actually check/find out

Fimetaria/Hispanica from today, surviving from 2022






--------------------
Willpower is the one true virtue



Edited by smalltalk_canceled (10/14/23 03:00 PM)


Extras: Filter Print Post Top
Invisiblemurderlabz
RIP Stoneman
I'm a teapot User Gallery


Registered: 05/18/19
Posts: 550
Loc: The Multiverse
Re: Psilocybe hispanica [Re: smalltalk_canceled] * 1
    #28499825 - 10/11/23 09:28 AM (3 months, 15 days ago)

:popcorn:


Extras: Filter Print Post Top
Offlinesmalltalk_canceled
Babnik
 User Gallery


Registered: 07/13/20
Posts: 2,862
Last seen: 11 days, 5 hours
Re: Psilocybe hispanica [Re: murderlabz] * 4
    #28504415 - 10/14/23 02:26 PM (3 months, 12 days ago)

For posterity Im linking up a selection of the then cold fruiting hispanica fruiting "outside" as a flowerpot, fruiitng in a cold garage, and fruiting placed outside in fall, and fruiting from one year to another although very sparsely so

this, evidentily, and ofc a bit to my dismay, was psilocybe hispanica all along:








--------------------
Willpower is the one true virtue



Edited by smalltalk_canceled (10/14/23 02:31 PM)


Extras: Filter Print Post Top
InvisibleInocybe
Stranger
 User Gallery

Registered: 01/16/17
Posts: 328
Loc: Spain
Re: Psilocybe hispanica [Re: smalltalk_canceled] * 3
    #28515555 - 10/23/23 05:26 PM (3 months, 3 days ago)

Hey guys!

I grew the suppossedly hispanica from the spores i got from the user Poison Drink, who got them from Captain future (and i think he got them from Workman?). I assumed the ID was done correctly by the original collector even though I have slight doubts as unlike the original description the stipe doesn’t bruise blue and the fruits also show some veil (the key in Noordeloos monography about Strophariaceae s.l says it lacks veil).




I also managed to find an article from 2006 in a spanish magazine where someone talks about this species being found apparently in Euskadi (a región near Pyrinees but not as high), but seeing the description, the spore pics and the macroscopical details (like the cap resembling more like P. semilanceata) i got a bit confused, cause it doesn’t look like the supossedly P. hispanica from most grows posted on Shroomery. But on the other hand it is pretty common that indoor or cultivated mushrooms end looking really different from wild ones, so…

The following pics and description are from the specimens that were sent by the author of the article to Guzman for confirmation and also the same ones from which the genbank sequence KC669289.1 came from (Fernandez-Sasia's voucher). The suppossedly hispanica imo shows more resemblance to P. semilanceata. Afaik P. semilanceata doesn't fruit from dung, but it is not rare that some fruits can be found fruiting through dung cause the mycelium being underneath the poo. Could that have lead to the false asumption that it was a different species (cause the collector thought it was not semilanceata cause of dung)?



If you search this hispanica sequence in genbank (KC669289.1), after running blast you see a 100% match with P. semilanceata sequences, so probably this article was written upon a misidentification made by the author of the article and later also (mistakenly?)ratified by Guzmán.

It also gets my attention the spore micrographs which show a highly truncated germ pore that i think i couldn’t see on the spores from my grow, but perhaps it is caused by the low quality of my microscope which causes some aberration?

All that said, i had samples from my grow sequenced and results in genbank apparently matched it with one of the P. fimetaria  sequence uploaded to genbank. So perhaps the "hispanica" i grew is just P. fimetaria and either there was a misidentification and the true hispanica keeps lost and waiting to be found again or it is just that both are synonyms? But which species could be synonyms? P. hispanica and P. fimetaria or P. hispanica and P. semilanceata?
:badtrip:

P. liniformans is easily distinguished by the gelatinous lamella edge, at least on fresh specimens, idk if dried samples when rehydrated show that elasticity (i have found P. liniformans in NW spain and in north portugal too and in same dung some fruits have elastic lamella edge and other bigger fruits from the same dung not having that separable edge when fresh). I wonder if that elasticity is lost when fruits mature or what, but it should be possible to check under microscope the gelatinous layer with cresyl blue i guess. I should check the samples i keep in my fungarium cause in one dung sample i found fruits that resembled to me more of fimetaria (showing convex cap with acute umbo and what seems like veil with spores) and others more like liniformans (i could send some samples to you Alan if you want to check them or sequence). The ones that were consistent with the liniformans description were sequenced and matched with the liniformans sequence that Alan found on Netherlands few years ago.


Guzmán said that P. hispanica is different from fimetaria cause hispanica lacks veil and has larger cheilocystidia, and different from semilanceata cause of the acute umbonate pileus... but seeing the grows from P. semilanceata that shows that unusual morphology on the cap, it seems like morphology can be a bit wobbly sometimes when it comes to name new species, as it can show some variation due to causes that can be overlooked (i.e. environmental conditions). It happened with Amanita porrinensis which was described as new species in 1980 and found in two subsequent years and never again... only once time more in italy apparently. After sequencing the samples, it was said to be a form of Amanita phalloides.



Edited by Inocybe (10/24/23 02:34 AM)


Extras: Filter Print Post Top
OfflineWorkmanV
1999 Spore War Veteran
Male User Gallery


Registered: 03/01/01
Posts: 3,598
Loc: Oregon, USA
Last seen: 1 hour, 31 minutes
Trusted Cultivator
Re: Psilocybe hispanica [Re: Inocybe] * 4
    #28516577 - 10/24/23 01:12 PM (3 months, 2 days ago)

Nice work. I've got some P. fimetaria from the Netherlands growing side by side with the hispanica outdoors and they do look different, for whatever that is worth. Hispanica on the left, fimetaria on the right. Hispanica fruited first so it seems to do better in warmer weather and is more robust. But the fimetaria was growing on a less than ideal substrate, so I need to start again to get better data. If they are both fimetaria, the hispanica seems to be the better variety for cultivation.




Extras: Filter Print Post Top
Offlinesmalltalk_canceled
Babnik
 User Gallery


Registered: 07/13/20
Posts: 2,862
Last seen: 11 days, 5 hours
Re: Psilocybe hispanica [Re: Workman]
    #28516763 - 10/24/23 03:48 PM (3 months, 2 days ago)

i never sent you a print workman, what out out what i did is still in interest, if anything?

I was able to print the 2023 fruit. i have one inky print of it

and i believe there could be 3 mre print from the original "fimetaria" now turned hispanica collection

at this point


--------------------
Willpower is the one true virtue



Edited by smalltalk_canceled (10/24/23 03:51 PM)


Extras: Filter Print Post Top
OfflineDH42
Local to somewhere
 User Gallery


Registered: 10/05/20
Posts: 92
Loc: Scotland Flag
Last seen: 1 day, 13 hours
Re: Psilocybe hispanica [Re: Inocybe]
    #28516873 - 10/24/23 05:05 PM (3 months, 2 days ago)

Inocybe, great write up, thank you for sharing that!

The genbank sequence KC669289.1 is, as it does appear, P.semilanceata. I have discussed this with Fernandez-Sasia. P.semilanceata fruiting underneath dung can produce some strange and confusing results, particularly in giving the illusion of it actually growing from dung in the same way that any obligately coprophilous fungus would.

Guzman's description of P.hispanica is faulty. I am in contact with the finder of the original holotype and hopefully something useful will be sequenced this year relating to it. P.hispanica's taxonomic position is certainly confusing, and we can't rush to synonymise it with P.fimetaria or P.liniformans prematurely.

Also, the species all display some level of polymorphism when cultivated artificially, which is interesting!


--------------------
Have a look at the subreddit r/fimetaria!


Extras: Filter Print Post Top
Onlinefireinyoface
Stranger
 User Gallery
Registered: 04/13/23
Posts: 27
Last seen: 32 seconds
Re: Psilocybe hispanica [Re: DH42] * 2
    #28519180 - 10/26/23 05:34 PM (3 months, 2 hours ago)










Here's an update


Edited by fireinyoface (10/30/23 05:43 AM)


Extras: Filter Print Post Top
OfflineDH42
Local to somewhere
 User Gallery


Registered: 10/05/20
Posts: 92
Loc: Scotland Flag
Last seen: 1 day, 13 hours
Re: Psilocybe hispanica [Re: fireinyoface] * 1
    #28519756 - 10/27/23 03:45 AM (2 months, 30 days ago)

Lovely pics of...Psilocybe fimetaria


--------------------
Have a look at the subreddit r/fimetaria!


Extras: Filter Print Post Top
Onlinefireinyoface
Stranger
 User Gallery
Registered: 04/13/23
Posts: 27
Last seen: 32 seconds
Re: Psilocybe hispanica [Re: DH42]
    #28519921 - 10/27/23 09:15 AM (2 months, 30 days ago)

It was given to me as Hispanica but I will just refer to it as Fimetaria from now on! I might send it in for sequencing but I think its Fimetaria also.


Edited by fireinyoface (10/27/23 11:01 AM)


Extras: Filter Print Post Top
Offlinesmalltalk_canceled
Babnik
 User Gallery


Registered: 07/13/20
Posts: 2,862
Last seen: 11 days, 5 hours
Re: Psilocybe hispanica [Re: fireinyoface]
    #28520548 - 10/27/23 08:23 PM (2 months, 29 days ago)

My 2023 "hispanica" spore printed a decidely black or dark, over brown

So when Captain future was sending out spore prints named ps hispanica

to my experience faint brown or black, pitch in here

where did he get his classification from to call it hispanica, instead of fimetaria? at the point he did?

is the swedish artsdatabanken.se reporting ps hispanica or ps fimetaria? when it says there are 6 observations there? (gov)

what does the literature or the experts so gathered say about the following:

1: was ps hispanica a cold fruiter
2: was there ever a fimetaria _before_ hispanica, or was fimetaria identified at the same time or later than hispanica
3: what is the history of the spore colour of fimetaria and hispanica
  and is any concentration of these even wildly possible to be mistaken for semilanceta
4: if early accounts of fimetaria and hispanica had dissimiliar, nonconcucrrent, truly absolutely differentiable from each other spore colours, where is this accounted and what are the proposed spore colours of fimetaria, and hispanica?


--------------------
Willpower is the one true virtue



Edited by smalltalk_canceled (10/27/23 08:24 PM)


Extras: Filter Print Post Top
Onlinefireinyoface
Stranger
 User Gallery
Registered: 04/13/23
Posts: 27
Last seen: 32 seconds
Re: Psilocybe hispanica [Re: smalltalk_canceled]
    #28520637 - 10/27/23 09:33 PM (2 months, 29 days ago)

Okay I did a little digging and found out my friend from Germany got his print from FSE also, who got their spores from VL, who got his spores from captain future! So what I have in the above pictures is also the same as captain future and VL and anyone else who has spores sourced from there.

https://www.freespore.com/psilocybe-hispanica.html


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,266
Last seen: 9 hours, 11 minutes
Re: Psilocybe hispanica [Re: Inocybe]
    #28521875 - 10/29/23 12:53 AM (2 months, 28 days ago)

Quote:

All that said, i had samples from my grow sequenced and results in genbank apparently matched it with one of the P. fimetaria  sequence uploaded to genbank. So perhaps the "hispanica" i grew is just P. fimetaria and either there was a misidentification and the true hispanica keeps lost and waiting to be found again or it is just that both are synonyms?




I think Psilocybe hispanica and Psilocybe fimetaria are the same thing, and Psilocybe fimetaria was published first so that is the name I use.


Extras: Filter Print Post Top
Onlinefireinyoface
Stranger
 User Gallery
Registered: 04/13/23
Posts: 27
Last seen: 32 seconds
Re: Psilocybe hispanica [Re: Alan Rockefeller]
    #28522387 - 10/29/23 01:44 PM (2 months, 28 days ago)

Who has noticed bruising on their fimetaria/hispanica ?? I picked some and got some great pics of bluing that happened within minutes of handling



Edited by fireinyoface (10/29/23 09:15 PM)


Extras: Filter Print Post Top
OfflineDH42
Local to somewhere
 User Gallery


Registered: 10/05/20
Posts: 92
Loc: Scotland Flag
Last seen: 1 day, 13 hours
Re: Psilocybe hispanica [Re: fireinyoface]
    #28523083 - 10/30/23 07:10 AM (2 months, 27 days ago)

Nice bluing! Am I right in thinking you also posted this to r/fimetaria?

Some people's cultivated P.fimetaria does blue strongly like yours do. Not all, however.


--------------------
Have a look at the subreddit r/fimetaria!


Extras: Filter Print Post Top
OfflineDH42
Local to somewhere
 User Gallery


Registered: 10/05/20
Posts: 92
Loc: Scotland Flag
Last seen: 1 day, 13 hours
Re: Psilocybe hispanica [Re: smalltalk_canceled] * 1
    #28523086 - 10/30/23 07:12 AM (2 months, 27 days ago)

I wouldn't focus too much on varying spore colours of closely related Psilocybes. The differences,if there are any, will likely be minute and in the subjective range. Remember a highly concentrated/dense spore deposit may appear darker than a spore deposit consisting of less spores.


--------------------
Have a look at the subreddit r/fimetaria!


Extras: Filter Print Post Top
Offlinesmalltalk_canceled
Babnik
 User Gallery


Registered: 07/13/20
Posts: 2,862
Last seen: 11 days, 5 hours
Re: Psilocybe hispanica [Re: fireinyoface]
    #28525557 - 11/01/23 01:56 PM (2 months, 25 days ago)

Quote:

fireinyoface said:
Who has noticed bruising on their fimetaria/hispanica ?? I picked some and got some great pics of bluing that happened within minutes of handling






Do you have a log? What was the substrate, what type of isolation was this?


--------------------
Willpower is the one true virtue



Extras: Filter Print Post Top
Onlinefireinyoface
Stranger
 User Gallery
Registered: 04/13/23
Posts: 27
Last seen: 32 seconds
Re: Psilocybe hispanica [Re: DH42] * 1
    #28525561 - 11/01/23 02:07 PM (2 months, 25 days ago)

These from the plastic container and glass jar have no bruising




These from the basket all have bruising



Edited by fireinyoface (11/01/23 02:54 PM)


Extras: Filter Print Post Top
Onlinefireinyoface
Stranger
 User Gallery
Registered: 04/13/23
Posts: 27
Last seen: 32 seconds
Re: Psilocybe hispanica [Re: smalltalk_canceled]
    #28525565 - 11/01/23 02:10 PM (2 months, 25 days ago)

No log and it was just a different culture from a different plate but same original print. Going to be trying to determine if it was genetic or environmental, but I would assume there were would be more bruising on wild specimens if it was environmental. I think it's genetics personally but I'll keep you all posted


Extras: Filter Print Post Top
Offlinesmalltalk_canceled
Babnik
 User Gallery


Registered: 07/13/20
Posts: 2,862
Last seen: 11 days, 5 hours
Re: Psilocybe hispanica [Re: fireinyoface]
    #28525567 - 11/01/23 02:11 PM (2 months, 25 days ago)

If you think its genetics i will buy you a set of miraculix test. Or get one yourself!


--------------------
Willpower is the one true virtue



Extras: Filter Print Post Top
Onlinefireinyoface
Stranger
 User Gallery
Registered: 04/13/23
Posts: 27
Last seen: 32 seconds
Re: Psilocybe hispanica [Re: smalltalk_canceled]
    #28525574 - 11/01/23 02:21 PM (2 months, 25 days ago)

Shoot me a link to something legit I'd like to have that resource!

I say I think it's genetic because they are all in similar substrates outside in similar conditions and these are so obviously different. Also I imagine their natural environment is the same if not better than what I have going right now.

I'm cloning the basket culture to see if I can replicate it in different settings. I'm hoping to get to the bottom of the environment vs genetics question


Edited by fireinyoface (11/01/23 08:16 PM)


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,266
Last seen: 9 hours, 11 minutes
Re: Psilocybe hispanica [Re: fireinyoface] * 1
    #28527002 - 11/02/23 07:18 PM (2 months, 24 days ago)

Quote:

fireinyoface said:
Shoot me a link to something legit I'd like to have that resource!





The Miraculix tests are available at https://www.miraculix-lab.de/en; Note that there is a link to another site to order them in the US.  They are accurate to within about 10%, which is less accurate than HPLC but mushrooms differ from one mushroom to the next more than 10% so the accuracy is fine.

Best place to send them for DNA barcoding to confirm the species is https://docs.google.com/document/d/1nSKlouFy1Z3OXbCf2cWiKH0hkDnFKZvPn6_oCr3vEK0/edit

It's free, though he does accept donations.


Extras: Filter Print Post Top
OnlinePluviophile
Stranger
Male User Gallery

Registered: 10/26/17
Posts: 3,092
Loc: Massachusetts
Last seen: 5 minutes, 16 seconds
Re: Psilocybe hispanica [Re: Alan Rockefeller] * 1
    #28527032 - 11/02/23 07:38 PM (2 months, 24 days ago)

:takingnotes:


Extras: Filter Print Post Top
Onlinefireinyoface
Stranger
 User Gallery
Registered: 04/13/23
Posts: 27
Last seen: 32 seconds
Re: Psilocybe hispanica [Re: Alan Rockefeller]
    #28528949 - 11/04/23 11:11 AM (2 months, 22 days ago)

Thanks Alan! I'm going to order some of those tests. I'd also love to send in samples for sequencing but I had always wondered if there was any legal risk with something like that? Is there anything to worry about when sending psilocybe through the mail, or is it safe because it's headed to a lab?


Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,266
Last seen: 9 hours, 11 minutes
Re: Psilocybe hispanica [Re: fireinyoface] * 1
    #28529774 - 11/05/23 12:14 AM (2 months, 21 days ago)

Quote:

fireinyoface said:
Thanks Alan! I'm going to order some of those tests. I'd also love to send in samples for sequencing but I had always wondered if there was any legal risk with something like that? Is there anything to worry about when sending psilocybe through the mail, or is it safe because it's headed to a lab?





There is legal risk but not much.  Mail cops only care about large amounts.  If you are sending ten pounds you should worry, but no one cares about a couple of grams.


Extras: Filter Print Post Top
Offlinesmalltalk_canceled
Babnik
 User Gallery


Registered: 07/13/20
Posts: 2,862
Last seen: 11 days, 5 hours
Re: Psilocybe hispanica [Re: Alan Rockefeller]
    #28530572 - 11/05/23 12:38 PM (2 months, 21 days ago)



From the outdoor "Hispanica"

For another round


--------------------
Willpower is the one true virtue



Edited by smalltalk_canceled (11/05/23 12:38 PM)


Extras: Filter Print Post Top
Jump to top Pages: 1 | 2 | 3 | 4 | 5 | 6  [ show all ]

Shop: PhytoExtractum Kratom Powder for Sale   North Spore Bulk Substrate   Left Coast Kratom Buy Kratom Extract   Amanita Muscaria Store Amanita Muscaria   Mushroom-Hut Liquid Cultures   Kraken Kratom Red Vein Kratom   Unfolding Nature Unfolding Nature: Being in the Implicate Order   Original Sensible Seeds Bulk Cannabis Seeds


Similar ThreadsPosterViewsRepliesLast post
* Psilocybe hispanica - Pins on agar (Updated 5-25-06)
( 1 2 all )
WorkmanV 8,644 26 12/05/06 04:51 AM
by myCo_psyCo
* Psilocybe Hispanica.. anybody grown it? Know how? Dogomush 1,444 4 11/15/02 11:21 AM
by mycofile
* P. hispanica grow TEK
( 1 2 all )
Zanti 6,732 21 06/13/03 04:31 AM
by Ryche Hawk
* Where's a Hispanica tek? Dogomush 1,064 3 05/27/03 02:09 PM
by comario2
* Psilocybe semilanceata spores Zanti 13,494 10 08/08/07 10:19 AM
by Workman
* NEW WORLD PSILOCYBE SPECIES nachoo 1,986 8 08/28/01 01:39 PM
by dioze1
* Re: Psilocybe natalensis and Psilocybe zapatecorum info please Anonymous 1,739 5 04/20/00 08:25 PM
by phree_1
* salvia hispanica L grain in substrate???? es_f1 1,371 6 02/16/08 07:54 PM
by Subbedhunter420

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: RogerRabbit, Pastywhyte, bodhisatta
23,547 topic views. 0 members, 5 guests and 1 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.061 seconds spending 0.008 seconds on 12 queries.