Home | Community | Message Board

Kratom Eye
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Myyco.com Isolated Cubensis Liquid Culture For Sale   Original Sensible Seeds Bulk Cannabis Seeds   Sporeworks.EU Spores for European Microscopy   North Spore Bulk Substrate   MagicBag.co All-In-One Bags That Don't Suck   Left Coast Kratom Buy Kratom Extract   Kraken Kratom Red Vein Kratom   PhytoExtractum Kratom Powder for Sale   Mushroom-Hut Substrate Bags

Jump to first unread post Pages: | 1 | 2 | 3 | 4 | 5 | 6 |  [ show all ]
Re: Psilocybe hispanica [Re: Baba Yaga] * 1
    #27783867 -

Joining this thread too, because of all the good info and the recent development.

Its going to be super exciting to follow hispanica/semilanceata/fimetaria complex.

Got a lot of small individual subs going outside, inside, etc

Im sure we'll have more answers by end of 2022

-

funkymonk22 said:
i grew p hispanica in monotubs in a cold room this winter..temps were about 50-60F.  one of the easiest and most prolific species i have grown..


not sure about potency yet, havent had the time to try em




Also to me, the tub here is very alike to my sequenced p fimetaria


--------------------
Willpower is the one true virtue


Edited by smalltalk_canceled (05/24/22 03:14 AM)

Extras: Filter Print Post Top
Re: Psilocybe hispanica [Re: Alan Rockefeller]
    #27786235 -

Alan Rockefeller said:
Baba Yaga said:
Hey just popping by to post some photos of a few fruits from this years semilanceata grow.
I will send these away for sequencing soon and will post the result.



Very cool!  When you get data PM me if you want to do a quick zoom call - I can share my screen show you how I analyze sequence data using free tools and put it into Genbank.




So I'm going to tell VL that he should send you another sample, I told him how my tamp sample was misplaced as well.  I want you to do that for me man, I've been dying to know for over a year now~!  I know your in GA right now and have been busy doing conventions!

I'll private message you but I'm putting this part here so you have a responsibility :wink:


--------------------
I like rain

Whether you think you can or you think you can’t, you’re right!

Extras: Filter Print Post Top
Re: Psilocybe hispanica [Re: Alan Rockefeller]
    #27786393 -

Hey Alan. Did you ever find out what they were?

Extras: Filter Print Post Top
Re: Psilocybe hispanica [Re: MycoCakes] * 4
    #27812106 -










--------------------
Willpower is the one true virtue


Edited by smalltalk_canceled (06/09/22 04:55 PM)

Extras: Filter Print Post Top
Re: Psilocybe hispanica [Re: smalltalk_canceled] * 5
    #27883715 -

Ok, so I got the sequence results back and the mushrooms I grew are semilanceata from what I can see.

A few examples from the first Semilanceata Grow 2020:




and some fruits from second grow 2022 started with spores from above. Samples for sequencing were taken from this grow:

 


Because I banned myself for a few weeks I couldn’t get in touch with Alan but instead I watched his videos on youtube about how to work the
data and this is what I got out from alingning the sequence with BLAST and creating a phylogenetic tree with Geneious Prime.

Alan, I can send you the .ab1 file if you want to have a look at that.


Sequence:

ACCTGATTTGAGGNCAAATTGTCATTTGTATTGTCCAGTGAAGGACGGTTAGAAGCAGCGCAATCCCATTCATGCAAAGGTCCACGGCGTAGATAATTATCACACCAATAGACGGCTCTGCGCGGGGCACCGGCTAATACATTTAAGGGGAGCAGACCTCTTGACGAAGCCAGCAAAAGACCCCCACATCCAAGCCATTATCAGCAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGTTTATAGGCACAAGGCCAATATAATACATTCTGTTACATTCTTTGGGGTATATGAAAACGTAGGCCTGGGTTAATTTGCAAGGAGAGCTTGTGAAAGCAATCCTCTTGACCGAGTTTCCTCGGAAAGTTAACTAATCCAGGTCTACAAAAGGTGCACAGGTGGAGAGATAAAGATGACACGGCGAGCACATGCCCCCGAGAGGACCAGCTACAACCGAGCCAAGTTCATTCAATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGAAACCAAGGAAA


Alignment with the top match in Blast showing only one difference between the two and a phylogenetic tree made with Snap-Gene:




This should be right, right? Since I am not a pro in this regard I would appreciate if you could confirm my findings Alan so I can re-post these
results in a few other places like the Hunting&ID Forum, the Misc Exotic Thread  and include it in the introduction of the Official Sem Thread as well.

Edited by Baba Yaga (08/02/22 04:38 PM)

Extras: Filter Print Post Top
Re: Psilocybe hispanica [Re: Baba Yaga]
    #27886287 -

Yes definitely semilanceata.  I replied to your PM.

It would be cool to put these photos on Mushroom Observer, upload the sequence data to Genbank and link the Genbank record to the Mushroom Observer record so there's a permanent record of this, it'd be good to be able to refer to it when looking at possible semilanceata photos.

A good way to share .ab1 files is to put it on a public Google drive link.

You can also contact me on gmail, Facebook messenger and IG, I use the same name on all 3.

Extras: Filter Print Post Top
Re: Psilocybe hispanica [Re: Alan Rockefeller]
    #27886306 -

Thanks Alan, there is no reply in my inbox though. I have your gmail address and will get in touch soon.

Extras: Filter Print Post Top
Re: Psilocybe hispanica [Re: Baba Yaga] * 1
    #27889702 -



--------------------
Willpower is the one true virtue


Extras: Filter Print Post Top
Re: Psilocybe hispanica [Re: smalltalk_canceled]
    #27903560 -



Does this mycelium look like agaricus blazeii or like hispanica


--------------------
Willpower is the one true virtue


Extras: Filter Print Post Top
Re: Psilocybe hispanica [Re: Baba Yaga]
    #27909455 -

Nice One Baba Yaga :thumbup:


--------------------
Have a look at the subreddit r/fimetaria!

Extras: Filter Print Post Top
Re: Psilocybe hispanica [Re: smalltalk_canceled]
    #27923995 -

smalltalk_canceled said:
Does this mycelium look like agaricus blazeii or like hispanica




It is hard to see what is going on here, but I would guess a mold.

Extras: Filter Print Post Top
Re: Psilocybe hispanica [Re: Alan Rockefeller]
    #27924010 -

Alan did you received/sequenced the sample I sent you?


--------------------
  Exotics Fanaticus cakes: EF tek

  Micro-Agar transfer tool

If you need some prints (Pans, cubes, tamp, WL…) feel free to PM

Extras: Filter Print Post Top
Re: Psilocybe hispanica [Re: V.L]
    #27924013 -

V.L said:
Alan did you received/sequenced the sample I sent you?



What is the iNaturalist or Mushroom Observer observation number?

Extras: Filter Print Post Top
Re: Psilocybe hispanica [Re: Alan Rockefeller] * 1
    #27924020 -

It was from this grow:

Sent from France few months ago


--------------------
  Exotics Fanaticus cakes: EF tek

  Micro-Agar transfer tool

If you need some prints (Pans, cubes, tamp, WL…) feel free to PM

Extras: Filter Print Post Top
Re: Psilocybe hispanica [Re: V.L]
    #27951596 -

I was on a hunt may/june in Pyrenees but no luck. Spoke to a locals and heard I can find them if I got luck. Gotta do a 2nd attempt. Where do you guys find yours ??

Extras: Filter Print Post Top
Re: Psilocybe hispanica [Re: KevinEm]
    #27954082 -

Got the prints from CaptainFuture


--------------------
  Exotics Fanaticus cakes: EF tek

  Micro-Agar transfer tool

If you need some prints (Pans, cubes, tamp, WL…) feel free to PM

Extras: Filter Print Post Top
Re: Psilocybe hispanica [Re: V.L] * 1
    #28011128 -


Right now doing a little comparative experience inoculated both cakes same day one with semilanceata (from Netherlands) the other with hispanica, both also put in fruiting condition same day, hispanica already started pinning but not the semilanceata yet, still keep hope for it when temperatures will be fresher..


--------------------
  Exotics Fanaticus cakes: EF tek

  Micro-Agar transfer tool

If you need some prints (Pans, cubes, tamp, WL…) feel free to PM

Extras: Filter Print Post Top
Re: Psilocybe hispanica [Re: V.L] * 3
    #28495629 -

Finally got back to this species after 19 years (WTF!). Still grows easy outdoors.



saralove said:
I hope this puts a smile on your face workman wherever you are  =)

P. hispanica as a fun little cake



your teachings live on:mushroom2:

always your student,

sara

ps.

hi everyone:sun:



Yes, made me smile. Thank you saralove if you are still around.


--------------------
Research funded by the patrons of
The Spore Works
Exotic Spore Supply

My Instagram
Reinvesting Sales Towards Basic Research and Species Identification :amanitajar:

Edited by Workman (10/07/23 04:33 PM)

Extras: Filter Print Post Top
Re: Psilocybe hispanica [Re: Workman]
    #28495640 -

She pops in from time to time when the kids give her a break. :lol:

I think I have a print from that grow. Need to get back to them myself.

Extras: Filter Print Post Top
Re: Psilocybe hispanica [Re: Workman]
    #28495700 -

I have a couple of prints of Ps. Hispanica from FSE which I'm struggling to get any germination from.

Hope to join you all in growing this species soon.



--------------------

Edited by covertjoy (10/07/23 08:26 PM)

Extras: Filter Print Post Top
Jump to top Pages: | 1 | 2 | 3 | 4 | 5 | 6 |  [ show all ]

Shop: Myyco.com Isolated Cubensis Liquid Culture For Sale   Original Sensible Seeds Bulk Cannabis Seeds   Sporeworks.EU Spores for European Microscopy   North Spore Bulk Substrate   MagicBag.co All-In-One Bags That Don't Suck   Left Coast Kratom Buy Kratom Extract   Kraken Kratom Red Vein Kratom   PhytoExtractum Kratom Powder for Sale   Mushroom-Hut Substrate Bags


Similar ThreadsPosterViewsRepliesLast post
* Psilocybe hispanica - Pins on agar (Updated 5-25-06)
( 1 2 all )
WorkmanV 8,899 26 12/05/06 04:51 AM
by myCo_psyCo
* Psilocybe Hispanica.. anybody grown it? Know how? Dogomush 1,547 4 11/15/02 11:21 AM
by mycofile
* P. hispanica grow TEK
( 1 2 all )
Zanti 7,025 21 06/13/03 04:31 AM
by Ryche Hawk
* Where's a Hispanica tek? Dogomush 1,163 3 05/27/03 02:09 PM
by comario2
* Psilocybe semilanceata spores Zanti 13,573 10 08/08/07 10:19 AM
by Workman
* NEW WORLD PSILOCYBE SPECIES nachoo 2,097 8 08/28/01 01:39 PM
by dioze1
* Re: Psilocybe natalensis and Psilocybe zapatecorum info please Anonymous 1,885 5 04/20/00 08:25 PM
by phree_1
* salvia hispanica L grain in substrate???? es_f1 1,439 6 02/16/08 07:54 PM
by Subbedhunter420

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: RogerRabbit, cronicr, Stipe-n Cap, Pastywhyte, bodhisatta
26,542 topic views. 0 members, 0 guests and 3 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2026 Mind Media. Some rights reserved.

Generated in 0.037 seconds spending 0.01 seconds on 17 queries.