Home | Community | Message Board


This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Left Coast Kratom Buy Kratom Extract   PhytoExtractum Kratom Powder for Sale   Mushroom-Hut Substrate Bags   North Spore Bulk Substrate   Original Sensible Seeds Bulk Cannabis Seeds

Jump to first unread post Pages: 1
InvisibleBaba Yaga
♥ coir grower

Registered: 09/13/20
Posts: 3,955
Loc: Hyperspace Chicken Coop
Trusted Cultivator
Re: Psilocybe hispanica [Re: V.L] * 1
    #27776389 - 05/14/22 01:55 AM (1 year, 8 months ago)

Hey just popping by to post some photos of a few fruits from this years semilanceata grow.
I will send these away for sequencing soon and will post the result.



Edited by Baba Yaga (06/15/22 03:41 PM)


Extras: Unfilter Print Post Top
InvisibleBaba Yaga
♥ coir grower

Registered: 09/13/20
Posts: 3,955
Loc: Hyperspace Chicken Coop
Trusted Cultivator
Re: Psilocybe hispanica [Re: Alan Rockefeller]
    #27779822 - 05/16/22 05:01 AM (1 year, 8 months ago)

That would be great Alan.


Extras: Unfilter Print Post Top
InvisibleBaba Yaga
♥ coir grower

Registered: 09/13/20
Posts: 3,955
Loc: Hyperspace Chicken Coop
Trusted Cultivator
Re: Psilocybe hispanica [Re: DH42]
    #27780714 - 05/16/22 07:25 PM (1 year, 8 months ago)

At this stage anything is possible. This is grain spawned to potting mix by the way,
no manure in there at least it didn't say anything about it on the bag.

Still hoping that these are semilanceata since none of the cultivated specimens
really look like what you can find in the wild.


Extras: Unfilter Print Post Top
InvisibleBaba Yaga
♥ coir grower

Registered: 09/13/20
Posts: 3,955
Loc: Hyperspace Chicken Coop
Trusted Cultivator
Re: Psilocybe hispanica [Re: smalltalk_canceled] * 5
    #27883715 - 07/31/22 04:52 AM (1 year, 5 months ago)

Ok, so I got the sequence results back and the mushrooms I grew are semilanceata from what I can see.

A few examples from the first Semilanceata Grow 2020:




and some fruits from second grow 2022 started with spores from above. Samples for sequencing were taken from this grow:

 


Because I banned myself for a few weeks I couldn’t get in touch with Alan but instead I watched his videos on youtube about how to work the
data and this is what I got out from alingning the sequence with BLAST and creating a phylogenetic tree with Geneious Prime.

Alan, I can send you the .ab1 file if you want to have a look at that.


Sequence:

ACCTGATTTGAGGNCAAATTGTCATTTGTATTGTCCAGTGAAGGACGGTTAGAAGCAGCGCAATCCCATTCATGCAAAGGTCCACGGCGTAGATAATTATCACACCAATAGACGGCTCTGCGCGGGGCACCGGCTAATACATTTAAGGGGAGCAGACCTCTTGACGAAGCCAGCAAAAGACCCCCACATCCAAGCCATTATCAGCAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGTTTATAGGCACAAGGCCAATATAATACATTCTGTTACATTCTTTGGGGTATATGAAAACGTAGGCCTGGGTTAATTTGCAAGGAGAGCTTGTGAAAGCAATCCTCTTGACCGAGTTTCCTCGGAAAGTTAACTAATCCAGGTCTACAAAAGGTGCACAGGTGGAGAGATAAAGATGACACGGCGAGCACATGCCCCCGAGAGGACCAGCTACAACCGAGCCAAGTTCATTCAATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGAAACCAAGGAAA


Alignment with the top match in Blast showing only one difference between the two and a phylogenetic tree made with Snap-Gene:




This should be right, right? Since I am not a pro in this regard I would appreciate if you could confirm my findings Alan so I can re-post these
results in a few other places like the Hunting&ID Forum, the Misc Exotic Thread  and include it in the introduction of the Official Sem Thread as well.


Edited by Baba Yaga (08/02/22 04:38 PM)


Extras: Unfilter Print Post Top
InvisibleBaba Yaga
♥ coir grower

Registered: 09/13/20
Posts: 3,955
Loc: Hyperspace Chicken Coop
Trusted Cultivator
Re: Psilocybe hispanica [Re: Alan Rockefeller]
    #27886306 - 08/02/22 01:09 AM (1 year, 5 months ago)

Thanks Alan, there is no reply in my inbox though. I have your gmail address and will get in touch soon.


Extras: Unfilter Print Post Top
Jump to top Pages: 1

Shop: Left Coast Kratom Buy Kratom Extract   PhytoExtractum Kratom Powder for Sale   Mushroom-Hut Substrate Bags   North Spore Bulk Substrate   Original Sensible Seeds Bulk Cannabis Seeds


Similar ThreadsPosterViewsRepliesLast post
* Psilocybe hispanica - Pins on agar (Updated 5-25-06)
( 1 2 all )
WorkmanV 8,645 26 12/05/06 04:51 AM
by myCo_psyCo
* Psilocybe Hispanica.. anybody grown it? Know how? Dogomush 1,444 4 11/15/02 11:21 AM
by mycofile
* P. hispanica grow TEK
( 1 2 all )
Zanti 6,732 21 06/13/03 04:31 AM
by Ryche Hawk
* Where's a Hispanica tek? Dogomush 1,064 3 05/27/03 02:09 PM
by comario2
* Psilocybe semilanceata spores Zanti 13,494 10 08/08/07 10:19 AM
by Workman
* NEW WORLD PSILOCYBE SPECIES nachoo 1,986 8 08/28/01 01:39 PM
by dioze1
* Re: Psilocybe natalensis and Psilocybe zapatecorum info please Anonymous 1,739 5 04/20/00 08:25 PM
by phree_1
* salvia hispanica L grain in substrate???? es_f1 1,371 6 02/16/08 07:54 PM
by Subbedhunter420

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: RogerRabbit, Pastywhyte, bodhisatta
23,549 topic views. 2 members, 8 guests and 3 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.027 seconds spending 0.009 seconds on 17 queries.