Home | Community | Message Board


This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: PhytoExtractum Kratom Powder for Sale   Left Coast Kratom Buy Kratom Extract   Mushroom-Hut Substrate Bags   Kraken Kratom Red Vein Kratom   Amanita Muscaria Store Amanita Muscaria   North Spore Bulk Substrate   Original Sensible Seeds Bulk Cannabis Seeds

Jump to first unread post Pages: 1 | 2 | 3 | 4 | 5 | 6 | Next >  [ show all ]
Invisiblesaralove
Female User Gallery


Registered: 10/01/13
Posts: 1,068
Trusted Cultivator
Re: Psilocybe hispanica [Re: Workman] * 10
    #26498787 - 02/22/20 05:20 PM (3 years, 10 months ago)

Quote:

Workman said:
Outdoor cultivated Psilocybe hispanica.  This species is relatively easy to grow on sterilized horse manure placed outside during cool fall weather (around 60F).  A relatively newly described species from Spain.  In Spain it grows directly on sheep dung in fields that also support fruitings of Psilocybe semilanceata








Very small specimens growing from a displaced piece of colonized horse dung.  Rodents or birds dug into the patch and scattered small pieces of dung that later fruited.  It is interesting to note the reduced size of the mushrooms when growing from very small amounts of substrate.



This is a larger specimen from the main patch.  Still a relatively small mushroom.  The odor is very similar to Psilocybe semilanceata and the appearance reminds me of Psilocybe mexicana   





I hope this puts a smile on your face workman wherever you are  =)

P. hispanica as a fun little cake




your teachings live on:mushroom2:



always your student,

sara




ps.

hi everyone:sun:


--------------------
:bliss:
Listening to: emancipator - baralku tour (live)  |  AMU


Extras: Unfilter Print Post Top
OfflineV.L
Male User Gallery

Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 50 minutes, 7 seconds
Trusted Cultivator
Re: Psilocybe hispanica [Re: V.L] * 8
    #27762299 - 05/04/22 02:01 AM (1 year, 8 months ago)

2nd cake 1st flush


Extras: Unfilter Print Post Top
InvisibleinskiM
Cortinariologist
Male User Gallery


Registered: 02/28/06
Posts: 5,720
Trusted Cultivator
Re: Psilocybe hispanica [Re: V.L] * 5
    #27762754 - 05/04/22 12:15 PM (1 year, 8 months ago)

I think Psilocybe alutacea should be included in these comparisons.


--------------------


Extras: Unfilter Print Post Top
InvisibleBaba Yaga
♥ coir grower

Registered: 09/13/20
Posts: 3,955
Loc: Hyperspace Chicken Coop
Trusted Cultivator
Re: Psilocybe hispanica [Re: smalltalk_canceled] * 5
    #27883715 - 07/31/22 04:52 AM (1 year, 5 months ago)

Ok, so I got the sequence results back and the mushrooms I grew are semilanceata from what I can see.

A few examples from the first Semilanceata Grow 2020:




and some fruits from second grow 2022 started with spores from above. Samples for sequencing were taken from this grow:

 


Because I banned myself for a few weeks I couldn’t get in touch with Alan but instead I watched his videos on youtube about how to work the
data and this is what I got out from alingning the sequence with BLAST and creating a phylogenetic tree with Geneious Prime.

Alan, I can send you the .ab1 file if you want to have a look at that.


Sequence:

ACCTGATTTGAGGNCAAATTGTCATTTGTATTGTCCAGTGAAGGACGGTTAGAAGCAGCGCAATCCCATTCATGCAAAGGTCCACGGCGTAGATAATTATCACACCAATAGACGGCTCTGCGCGGGGCACCGGCTAATACATTTAAGGGGAGCAGACCTCTTGACGAAGCCAGCAAAAGACCCCCACATCCAAGCCATTATCAGCAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGTTTATAGGCACAAGGCCAATATAATACATTCTGTTACATTCTTTGGGGTATATGAAAACGTAGGCCTGGGTTAATTTGCAAGGAGAGCTTGTGAAAGCAATCCTCTTGACCGAGTTTCCTCGGAAAGTTAACTAATCCAGGTCTACAAAAGGTGCACAGGTGGAGAGATAAAGATGACACGGCGAGCACATGCCCCCGAGAGGACCAGCTACAACCGAGCCAAGTTCATTCAATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGAAACCAAGGAAA


Alignment with the top match in Blast showing only one difference between the two and a phylogenetic tree made with Snap-Gene:




This should be right, right? Since I am not a pro in this regard I would appreciate if you could confirm my findings Alan so I can re-post these
results in a few other places like the Hunting&ID Forum, the Misc Exotic Thread  and include it in the introduction of the Official Sem Thread as well.


Edited by Baba Yaga (08/02/22 04:38 PM)


Extras: Unfilter Print Post Top
Offlinesmalltalk_canceled
Babnik
 User Gallery

Registered: 07/13/20
Posts: 2,862
Last seen: 11 days, 21 hours
Re: Psilocybe hispanica [Re: MycoCakes] * 4
    #27812106 - 06/09/22 11:27 AM (1 year, 7 months ago)










--------------------
Willpower is the one true virtue



Edited by smalltalk_canceled (06/09/22 04:55 PM)


Extras: Unfilter Print Post Top
Offlinesmalltalk_canceled
Babnik
 User Gallery


Registered: 07/13/20
Posts: 2,862
Last seen: 11 days, 21 hours
Re: Psilocybe hispanica [Re: murderlabz] * 4
    #28504415 - 10/14/23 02:26 PM (3 months, 12 days ago)

For posterity Im linking up a selection of the then cold fruiting hispanica fruiting "outside" as a flowerpot, fruiitng in a cold garage, and fruiting placed outside in fall, and fruiting from one year to another although very sparsely so

this, evidentily, and ofc a bit to my dismay, was psilocybe hispanica all along:








--------------------
Willpower is the one true virtue



Edited by smalltalk_canceled (10/14/23 02:31 PM)


Extras: Unfilter Print Post Top
OfflineWorkmanV
1999 Spore War Veteran
Male User Gallery


Registered: 03/01/01
Posts: 3,598
Loc: Oregon, USA
Last seen: 14 hours, 25 minutes
Trusted Cultivator
Re: Psilocybe hispanica [Re: Inocybe] * 4
    #28516577 - 10/24/23 01:12 PM (3 months, 2 days ago)

Nice work. I've got some P. fimetaria from the Netherlands growing side by side with the hispanica outdoors and they do look different, for whatever that is worth. Hispanica on the left, fimetaria on the right. Hispanica fruited first so it seems to do better in warmer weather and is more robust. But the fimetaria was growing on a less than ideal substrate, so I need to start again to get better data. If they are both fimetaria, the hispanica seems to be the better variety for cultivation.




Extras: Unfilter Print Post Top
OfflineV.L
Male User Gallery

Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 50 minutes, 7 seconds
Trusted Cultivator
Re: Psilocybe hispanica [Re: coversall] * 3
    #27726779 - 04/09/22 06:28 AM (1 year, 9 months ago)



They are small, for me too easier to grow than semilanceata (as I failed all attempts with semi indoor) phenotype remind me a bit tampanensis but prefer colder temperature.. thanks to CaptainFuture for the print it was a something I wanted to observe since years and will work more on it! Fingers crossed for printing in few days!


Edited by V.L (04/09/22 09:23 AM)


Extras: Unfilter Print Post Top
OfflineDH42
Local to somewhere
 User Gallery


Registered: 10/05/20
Posts: 92
Loc: Scotland Flag
Last seen: 2 days, 4 hours
Re: Psilocybe hispanica [Re: inski] * 3
    #27765546 - 05/06/22 07:08 AM (1 year, 8 months ago)

Quote:

inski said:
I think Psilocybe alutacea should be included in these comparisons.






Another potential candidate for P.fimetaria!



--------------------
Have a look at the subreddit r/fimetaria!


Extras: Unfilter Print Post Top
InvisibleInocybe
Stranger
 User Gallery

Registered: 01/16/17
Posts: 328
Loc: Spain
Re: Psilocybe hispanica [Re: smalltalk_canceled] * 3
    #28515555 - 10/23/23 05:26 PM (3 months, 3 days ago)

Hey guys!

I grew the suppossedly hispanica from the spores i got from the user Poison Drink, who got them from Captain future (and i think he got them from Workman?). I assumed the ID was done correctly by the original collector even though I have slight doubts as unlike the original description the stipe doesn’t bruise blue and the fruits also show some veil (the key in Noordeloos monography about Strophariaceae s.l says it lacks veil).




I also managed to find an article from 2006 in a spanish magazine where someone talks about this species being found apparently in Euskadi (a región near Pyrinees but not as high), but seeing the description, the spore pics and the macroscopical details (like the cap resembling more like P. semilanceata) i got a bit confused, cause it doesn’t look like the supossedly P. hispanica from most grows posted on Shroomery. But on the other hand it is pretty common that indoor or cultivated mushrooms end looking really different from wild ones, so…

The following pics and description are from the specimens that were sent by the author of the article to Guzman for confirmation and also the same ones from which the genbank sequence KC669289.1 came from (Fernandez-Sasia's voucher). The suppossedly hispanica imo shows more resemblance to P. semilanceata. Afaik P. semilanceata doesn't fruit from dung, but it is not rare that some fruits can be found fruiting through dung cause the mycelium being underneath the poo. Could that have lead to the false asumption that it was a different species (cause the collector thought it was not semilanceata cause of dung)?



If you search this hispanica sequence in genbank (KC669289.1), after running blast you see a 100% match with P. semilanceata sequences, so probably this article was written upon a misidentification made by the author of the article and later also (mistakenly?)ratified by Guzmán.

It also gets my attention the spore micrographs which show a highly truncated germ pore that i think i couldn’t see on the spores from my grow, but perhaps it is caused by the low quality of my microscope which causes some aberration?

All that said, i had samples from my grow sequenced and results in genbank apparently matched it with one of the P. fimetaria  sequence uploaded to genbank. So perhaps the "hispanica" i grew is just P. fimetaria and either there was a misidentification and the true hispanica keeps lost and waiting to be found again or it is just that both are synonyms? But which species could be synonyms? P. hispanica and P. fimetaria or P. hispanica and P. semilanceata?
:badtrip:

P. liniformans is easily distinguished by the gelatinous lamella edge, at least on fresh specimens, idk if dried samples when rehydrated show that elasticity (i have found P. liniformans in NW spain and in north portugal too and in same dung some fruits have elastic lamella edge and other bigger fruits from the same dung not having that separable edge when fresh). I wonder if that elasticity is lost when fruits mature or what, but it should be possible to check under microscope the gelatinous layer with cresyl blue i guess. I should check the samples i keep in my fungarium cause in one dung sample i found fruits that resembled to me more of fimetaria (showing convex cap with acute umbo and what seems like veil with spores) and others more like liniformans (i could send some samples to you Alan if you want to check them or sequence). The ones that were consistent with the liniformans description were sequenced and matched with the liniformans sequence that Alan found on Netherlands few years ago.


Guzmán said that P. hispanica is different from fimetaria cause hispanica lacks veil and has larger cheilocystidia, and different from semilanceata cause of the acute umbonate pileus... but seeing the grows from P. semilanceata that shows that unusual morphology on the cap, it seems like morphology can be a bit wobbly sometimes when it comes to name new species, as it can show some variation due to causes that can be overlooked (i.e. environmental conditions). It happened with Amanita porrinensis which was described as new species in 1980 and found in two subsequent years and never again... only once time more in italy apparently. After sequencing the samples, it was said to be a form of Amanita phalloides.



Edited by Inocybe (10/24/23 02:34 AM)


Extras: Unfilter Print Post Top
OfflineWorkmanV
1999 Spore War Veteran
Male User Gallery

Registered: 03/01/01
Posts: 3,598
Loc: Oregon, USA
Last seen: 14 hours, 25 minutes
Trusted Cultivator
Psilocybe hispanica * 2
    #2102193 - 11/13/03 02:45 PM (20 years, 2 months ago)

Outdoor cultivated Psilocybe hispanica. This species is relatively easy to grow on sterilized horse manure placed outside during cool fall weather (around 60F). A relatively newly described species from Spain. In Spain it grows directly on sheep dung in fields that also support fruitings of Psilocybe semilanceata








Very small specimens growing from a displaced piece of colonized horse dung. Rodents or birds dug into the patch and scattered small pieces of dung that later fruited. It is interesting to note the reduced size of the mushrooms when growing from very small amounts of substrate.



This is a larger specimen from the main patch. Still a relatively small mushroom. The odor is very similar to Psilocybe semilanceata and the appearance reminds me of Psilocybe mexicana


--------------------
Research funded by the patrons of
The Spore Works
Exotic Spore Supply

My Instagram
Reinvesting 25% of Sales Towards Basic Research and Species Identification :amanitajar:


Extras: Unfilter Print Post Top
InvisibleSporulator
Male User Gallery

Registered: 03/08/11
Posts: 1,643
Loc: Europe
Re: Psilocybe hispanica [Re: Alan Rockefeller] * 2
    #24886937 - 01/03/18 08:38 AM (6 years, 26 days ago)

Quote:

Alan Rockefeller said:
Could P. hispanica be conspecific with P. semilanceata?

The ITS sequences are just one base pair different, and it's just that one A turned into two A's near the beginning of the sequence, which is likely not even a real difference.

Perhaps they found P. semilanceata on horse dung and thought it was something new because of the unusual substrate.  But horse dung is really just chewed up grass, so it's not that much of a leap - and P. semilanceata is found in the area.

The LSU sequences of the two species are identical.

I am having trouble finding the original species description, which was published in "Docums Mycol. 29(no. 116): 42 (2000)".  Docums Mycol. is short for Les Documents Mycologiques.

Here's a photo of the holotype:  http://mushroomobserver.org/241329




      I never saw Psilocybe semilanceata fruiting directly from cow patties or horse droppings.

      The Psilocybe hispanica strain I am working with does not look like Psilocybe semilanceata.

      It is easy to grow compared to Psilocybe semilanceata, a casing layer is not necessary. It is a cold weather species like Psilocybe semilanceata,
      fruiting between 40 and 60 F and the potency is definitely equal to Psilocybe semilanceata.

      But is the species I am working with really Psilocybe hispanica?

      And was the material used for DNA sequencing really Psilocybe hispanica?  Where did the material come from?  This is all very confusing.








--------------------
                 


Edited by Sporulator (01/03/18 10:32 AM)


Extras: Unfilter Print Post Top
Offlinebw86
Doesn't play well with others


Registered: 11/12/06
Posts: 5,937
Loc: 7b
Last seen: 14 hours, 21 minutes
Trusted Cultivator
Re: Psilocybe hispanica [Re: Pliny_the_Elder] * 2
    #26500936 - 02/24/20 05:18 AM (3 years, 10 months ago)

holy shit. I have tried to germinate the print i have from sporeworks a  dozen times.
Amazing work!
I wish i could give you 5 more shrooms!


Extras: Unfilter Print Post Top
OfflineV.L
Male User Gallery

Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 50 minutes, 7 seconds
Trusted Cultivator
Re: Psilocybe hispanica [Re: Alan Rockefeller] * 2
    #27732067 - 04/12/22 10:21 PM (1 year, 9 months ago)

Does a spore print is enough material? feel free to pm..

Psilocybe hispanica



hispanica printing

Those are the last pic I could upload, normal account limit reached :frown:


Edited by V.L (04/13/22 06:53 AM)


Extras: Unfilter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,271
Last seen: 9 hours, 54 minutes
Re: Psilocybe hispanica [Re: smalltalk_canceled] * 2
    #28495997 - 10/07/23 10:35 PM (3 months, 19 days ago)

A friend ITS sequenced Psilocybe hispanica that he got from someone (VR or something) and it was a 100% match for Psilocybe fimetaria.

I also saw a photo of P. hispanica that the person who discovered it took, and it looked just like P. fimetaria, so I think that's what these are.


Extras: Unfilter Print Post Top
Offlinefireinyoface
Stranger
 User Gallery
Registered: 04/13/23
Posts: 27
Last seen: 14 hours, 53 minutes
Re: Psilocybe hispanica [Re: DH42] * 2
    #28519180 - 10/26/23 05:34 PM (3 months, 17 hours ago)










Here's an update


Edited by fireinyoface (10/30/23 05:43 AM)


Extras: Unfilter Print Post Top
Invisiblefunkymonk22
In Service to the Ineffable..
Male User Gallery

Registered: 01/25/16
Posts: 469
Loc: The Big O
Re: Psilocybe hispanica [Re: Lennybernadino] * 1
    #24239750 - 04/13/17 09:02 AM (6 years, 9 months ago)



couple hispanica shots from this morning..still fruiting away, they seem to love the PNW..i wonder if we can naturalize them here


--------------------


"The clouds didn't look like cotton, they didn't even look like clouds.."-Townes Van Zandt


Extras: Unfilter Print Post Top
OfflineMateo
High on LIFE!
Male User Gallery


Registered: 06/24/11
Posts: 2,689
Loc: North Europe
Last seen: 3 years, 3 months
Re: Psilocybe hispanica [Re: Sporulator] * 1
    #24891943 - 01/05/18 01:53 PM (6 years, 23 days ago)

I saw pictures of a whole cluster P.Semilanceata fruiting directly from some animal poo.
It was a thread about it in a swedish forum back in 2012.
And it was Psilocybe semilanceata, im 100% sure of it having picked thousands of them.
We thought it was odd it fruiting directly on the poo like that.

In fact i have always thought P.Semilanceata has some connection to dung.
Where they grow in suburb areas over here they tend to grow grass lawns who has been newly laid out or grass lawn sown previous year.
Then they grow on these for a few years with declining numbers.
Just if they use up the nutrients or fertilizers in the soil.
And they always use animal poo of some sort as a fertilizer.
So P.Semilanceata is probably a dung lover, at least partially.


--------------------
A wise rat has many holes


Edited by Mateo (01/05/18 02:07 PM)


Extras: Unfilter Print Post Top
InvisibleSporulator
Male User Gallery

Registered: 03/08/11
Posts: 1,643
Loc: Europe
Re: Psilocybe hispanica [Re: Mateo] * 1
    #24893131 - 01/05/18 11:04 PM (6 years, 23 days ago)

Quote:

Mateo said:
I saw pictures of a whole cluster P.Semilanceata fruiting directly from some animal poo.
It was a thread about it in a swedish forum back in 2012.
And it was Psilocybe semilanceata, im 100% sure of it having picked thousands of them.
We thought it was odd it fruiting directly on the poo like that.

In fact i have always thought P.Semilanceata has some connection to dung.
Where they grow in suburb areas over here they tend to grow grass lawns who has been newly laid out or grass lawn sown previous year.
Then they grow on these for a few years with declining numbers.
Just if they use up the nutrients or fertilizers in the soil.
And they always use animal poo of some sort as a fertilizer.
So P.Semilanceata is probably a dung lover, at least partially.




I agree with you that Psilocybe semilanceata is a nitrophilous species.

But I've never found them fruiting directly from dung here in Central Europe.

I always find them growing on former and now abandoned pastures, which have turned into ordinary grassland.

I suspect that another active species from Northern Spain could be involved in this confusion.

Psilocybe gallaeciae  described in 2003 for the first time by Guzman in this paper: 

http://www.samorini.it/doc1/alt_aut/ek/guzman03.pdf

http://mushroomobserver.org/observer/show_observation/59103


Edited by Sporulator (01/07/18 09:22 AM)


Extras: Unfilter Print Post Top
OfflineMateo
High on LIFE!
Male User Gallery


Registered: 06/24/11
Posts: 2,689
Loc: North Europe
Last seen: 3 years, 3 months
Re: Psilocybe hispanica [Re: Sporulator] * 1
    #24894023 - 01/06/18 11:59 AM (6 years, 22 days ago)

Intresting.

It wouldn´t suprice me if P.semilanceata has a few different sub varietys and that P.semilanceata and similar psilocybes are just same base mushroom that evolved to do well in their growing habitat.
How much must a mushroom change/evolve to be considered a new one?


--------------------
A wise rat has many holes


Extras: Unfilter Print Post Top
Jump to top Pages: 1 | 2 | 3 | 4 | 5 | 6 | Next >  [ show all ]

Shop: PhytoExtractum Kratom Powder for Sale   Left Coast Kratom Buy Kratom Extract   Mushroom-Hut Substrate Bags   Kraken Kratom Red Vein Kratom   Amanita Muscaria Store Amanita Muscaria   North Spore Bulk Substrate   Original Sensible Seeds Bulk Cannabis Seeds


Similar ThreadsPosterViewsRepliesLast post
* Psilocybe hispanica - Pins on agar (Updated 5-25-06)
( 1 2 all )
WorkmanV 8,645 26 12/05/06 04:51 AM
by myCo_psyCo
* Psilocybe Hispanica.. anybody grown it? Know how? Dogomush 1,444 4 11/15/02 11:21 AM
by mycofile
* P. hispanica grow TEK
( 1 2 all )
Zanti 6,732 21 06/13/03 04:31 AM
by Ryche Hawk
* Where's a Hispanica tek? Dogomush 1,064 3 05/27/03 02:09 PM
by comario2
* Psilocybe semilanceata spores Zanti 13,494 10 08/08/07 10:19 AM
by Workman
* NEW WORLD PSILOCYBE SPECIES nachoo 1,986 8 08/28/01 01:39 PM
by dioze1
* Re: Psilocybe natalensis and Psilocybe zapatecorum info please Anonymous 1,739 5 04/20/00 08:25 PM
by phree_1
* salvia hispanica L grain in substrate???? es_f1 1,371 6 02/16/08 07:54 PM
by Subbedhunter420

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: RogerRabbit, Pastywhyte, bodhisatta
23,549 topic views. 2 members, 8 guests and 3 web crawlers are browsing this forum.
[ Show Images Only | Sort by Date | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.034 seconds spending 0.009 seconds on 16 queries.