|
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
|
Workman
1999 Spore War Veteran


Registered: 03/01/01
Posts: 3,598
Loc: Oregon, USA
Last seen: 14 hours, 25 minutes
|
Psilocybe hispanica 2
#2102193 - 11/13/03 02:45 PM (20 years, 2 months ago) |
|
|
Outdoor cultivated Psilocybe hispanica. This species is relatively easy to grow on sterilized horse manure placed outside during cool fall weather (around 60F). A relatively newly described species from Spain. In Spain it grows directly on sheep dung in fields that also support fruitings of Psilocybe semilanceata



Very small specimens growing from a displaced piece of colonized horse dung. Rodents or birds dug into the patch and scattered small pieces of dung that later fruited. It is interesting to note the reduced size of the mushrooms when growing from very small amounts of substrate.

This is a larger specimen from the main patch. Still a relatively small mushroom. The odor is very similar to Psilocybe semilanceata and the appearance reminds me of Psilocybe mexicana
-------------------- Research funded by the patrons of The Spore Works Exotic Spore Supply My Instagram Reinvesting 25% of Sales Towards Basic Research and Species Identification 
|
funkymonk22
In Service to the Ineffable..


Registered: 01/25/16
Posts: 469
Loc: The Big O
|
|
i grew p hispanica in monotubs in a cold room this winter..temps were about 50-60F. one of the easiest and most prolific species i have grown..

not sure about potency yet, havent had the time to try em
--------------------
  "The clouds didn't look like cotton, they didn't even look like clouds.."-Townes Van Zandt
|
funkymonk22
In Service to the Ineffable..


Registered: 01/25/16
Posts: 469
Loc: The Big O
|
|

couple hispanica shots from this morning..still fruiting away, they seem to love the PNW..i wonder if we can naturalize them here
--------------------
  "The clouds didn't look like cotton, they didn't even look like clouds.."-Townes Van Zandt
|
Sporulator


Registered: 03/08/11
Posts: 1,643
Loc: Europe
|
|
Quote:
Alan Rockefeller said: Could P. hispanica be conspecific with P. semilanceata?
The ITS sequences are just one base pair different, and it's just that one A turned into two A's near the beginning of the sequence, which is likely not even a real difference.
Perhaps they found P. semilanceata on horse dung and thought it was something new because of the unusual substrate. But horse dung is really just chewed up grass, so it's not that much of a leap - and P. semilanceata is found in the area.
The LSU sequences of the two species are identical.
I am having trouble finding the original species description, which was published in "Docums Mycol. 29(no. 116): 42 (2000)". Docums Mycol. is short for Les Documents Mycologiques.
Here's a photo of the holotype: http://mushroomobserver.org/241329
I never saw Psilocybe semilanceata fruiting directly from cow patties or horse droppings.
The Psilocybe hispanica strain I am working with does not look like Psilocybe semilanceata.
It is easy to grow compared to Psilocybe semilanceata, a casing layer is not necessary. It is a cold weather species like Psilocybe semilanceata, fruiting between 40 and 60 F and the potency is definitely equal to Psilocybe semilanceata.
But is the species I am working with really Psilocybe hispanica?
And was the material used for DNA sequencing really Psilocybe hispanica? Where did the material come from? This is all very confusing.

Edited by Sporulator (01/03/18 10:32 AM)
|
saralove



Registered: 10/01/13
Posts: 1,068
|
Re: Psilocybe hispanica [Re: Workman] 10
#26498787 - 02/22/20 05:20 PM (3 years, 10 months ago) |
|
|
Quote:
Workman said: Outdoor cultivated Psilocybe hispanica. This species is relatively easy to grow on sterilized horse manure placed outside during cool fall weather (around 60F). A relatively newly described species from Spain. In Spain it grows directly on sheep dung in fields that also support fruitings of Psilocybe semilanceata



Very small specimens growing from a displaced piece of colonized horse dung. Rodents or birds dug into the patch and scattered small pieces of dung that later fruited. It is interesting to note the reduced size of the mushrooms when growing from very small amounts of substrate.

This is a larger specimen from the main patch. Still a relatively small mushroom. The odor is very similar to Psilocybe semilanceata and the appearance reminds me of Psilocybe mexicana
I hope this puts a smile on your face workman wherever you are =)
P. hispanica as a fun little cake

your teachings live on
always your student,
sara
ps.
hi everyone
--------------------
Listening to: emancipator - baralku tour (live) | AMU
|
coversall
إِنْ شَاءَ ٱللَهُ



Registered: 06/06/20
Posts: 2,749
Loc: संसार
|
Re: Psilocybe hispanica [Re: saralove] 1
#27110417 - 12/27/20 09:50 AM (3 years, 1 month ago) |
|
|
Quote:
saralove said:
Quote:
Workman said: Outdoor cultivated Psilocybe hispanica. This species is relatively easy to grow on sterilized horse manure placed outside during cool fall weather (around 60F). A relatively newly described species from Spain. In Spain it grows directly on sheep dung in fields that also support fruitings of Psilocybe semilanceata



Very small specimens growing from a displaced piece of colonized horse dung. Rodents or birds dug into the patch and scattered small pieces of dung that later fruited. It is interesting to note the reduced size of the mushrooms when growing from very small amounts of substrate.

This is a larger specimen from the main patch. Still a relatively small mushroom. The odor is very similar to Psilocybe semilanceata and the appearance reminds me of Psilocybe mexicana
I hope this puts a smile on your face workman wherever you are =)
P. hispanica as a fun little cake

your teachings live on
always your student,
sara
ps.
hi everyone
What an awesome bump! Those are stunning! I'm going to watch this thread with interest.
|
V.L


Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 50 minutes, 1 second
|
Re: Psilocybe hispanica [Re: coversall] 3
#27726779 - 04/09/22 06:28 AM (1 year, 9 months ago) |
|
|

They are small, for me too easier to grow than semilanceata (as I failed all attempts with semi indoor) phenotype remind me a bit tampanensis but prefer colder temperature.. thanks to CaptainFuture for the print it was a something I wanted to observe since years and will work more on it! Fingers crossed for printing in few days!
Edited by V.L (04/09/22 09:23 AM)
|
V.L


Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 50 minutes, 1 second
|
|
Does a spore print is enough material? feel free to pm..
Psilocybe hispanica

hispanica printing
Those are the last pic I could upload, normal account limit reached
Edited by V.L (04/13/22 06:53 AM)
|
V.L


Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 50 minutes, 1 second
|
Re: Psilocybe hispanica [Re: V.L]
#27752867 - 04/27/22 02:17 AM (1 year, 8 months ago) |
|
|
Took 2 weeks for a little second flush:

Some spores under my very old microscope and phone photo:
|
V.L


Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 50 minutes, 1 second
|
Re: Psilocybe hispanica [Re: V.L] 8
#27762299 - 05/04/22 02:01 AM (1 year, 8 months ago) |
|
|
|
DH42
Local to somewhere



Registered: 10/05/20
Posts: 92
Loc: Scotland
Last seen: 2 days, 4 hours
|
|
I agree Alan, the ones in this thread do look similar to P.fimetaria. I'll attach some examples of hispanica-looking-fimetaria below.
If P.hispanica is actually P.fimetaria, it would mean we would be able to add sheep manure to the list of substrate from which P.fimetaria grows. Also, I have a suspicion that P.fimetaria might grow from Red Deer manure - at least in Scotland/UK.
I saw in another comment, from a few years ago, you said you had an ITS and LSU sequence of P.hispanica. Have you tried comparing the ITS to one of P.fimetaria?





-------------------- Have a look at the subreddit r/fimetaria!
|
inski
Cortinariologist



Registered: 02/28/06
Posts: 5,720
|
Re: Psilocybe hispanica [Re: V.L] 5
#27762754 - 05/04/22 12:15 PM (1 year, 8 months ago) |
|
|
I think Psilocybe alutacea should be included in these comparisons.
|
DH42
Local to somewhere



Registered: 10/05/20
Posts: 92
Loc: Scotland
Last seen: 2 days, 4 hours
|
Re: Psilocybe hispanica [Re: inski] 3
#27765546 - 05/06/22 07:08 AM (1 year, 8 months ago) |
|
|
Quote:
inski said: I think Psilocybe alutacea should be included in these comparisons.

Another potential candidate for P.fimetaria!
-------------------- Have a look at the subreddit r/fimetaria!
|
Baba Yaga
♥ coir grower

Registered: 09/13/20
Posts: 3,955
Loc: Hyperspace Chicken Coop
|
Re: Psilocybe hispanica [Re: V.L] 1
#27776389 - 05/14/22 01:55 AM (1 year, 8 months ago) |
|
|
Hey just popping by to post some photos of a few fruits from this years semilanceata grow. I will send these away for sequencing soon and will post the result.
Edited by Baba Yaga (06/15/22 03:41 PM)
|
smalltalk_canceled
Babnik


Registered: 07/13/20
Posts: 2,862
Last seen: 11 days, 21 hours
|
Re: Psilocybe hispanica [Re: Baba Yaga]
#27783867 - 05/19/22 06:05 AM (1 year, 8 months ago) |
|
|
Joining this thread too, because of all the good info and the recent development.
Its going to be super exciting to follow hispanica/semilanceata/fimetaria complex.
Got a lot of small individual subs going outside, inside, etc
Im sure we'll have more answers by end of 2022
-
Quote:
funkymonk22 said: i grew p hispanica in monotubs in a cold room this winter..temps were about 50-60F. one of the easiest and most prolific species i have grown..

not sure about potency yet, havent had the time to try em
Also to me, the tub here is very alike to my sequenced p fimetaria
-------------------- Willpower is the one true virtue
  
Edited by smalltalk_canceled (05/24/22 03:14 AM)
|
smalltalk_canceled
Babnik


Registered: 07/13/20
Posts: 2,862
Last seen: 11 days, 21 hours
|
Re: Psilocybe hispanica [Re: MycoCakes] 4
#27812106 - 06/09/22 11:27 AM (1 year, 7 months ago) |
|
|
-------------------- Willpower is the one true virtue
  
Edited by smalltalk_canceled (06/09/22 04:55 PM)
|
Baba Yaga
♥ coir grower

Registered: 09/13/20
Posts: 3,955
Loc: Hyperspace Chicken Coop
|
|
Ok, so I got the sequence results back and the mushrooms I grew are semilanceata from what I can see.
A few examples from the first Semilanceata Grow 2020:

and some fruits from second grow 2022 started with spores from above. Samples for sequencing were taken from this grow:

Because I banned myself for a few weeks I couldn’t get in touch with Alan but instead I watched his videos on youtube about how to work the data and this is what I got out from alingning the sequence with BLAST and creating a phylogenetic tree with Geneious Prime.
Alan, I can send you the .ab1 file if you want to have a look at that.
Sequence:
ACCTGATTTGAGGNCAAATTGTCATTTGTATTGTCCAGTGAAGGACGGTTAGAAGCAGCGCAATCCCATTCATGCAAAGGTCCACGGCGTAGATAATTATCACACCAATAGACGGCTCTGCGCGGGGCACCGGCTAATACATTTAAGGGGAGCAGACCTCTTGACGAAGCCAGCAAAAGACCCCCACATCCAAGCCATTATCAGCAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGTTTATAGGCACAAGGCCAATATAATACATTCTGTTACATTCTTTGGGGTATATGAAAACGTAGGCCTGGGTTAATTTGCAAGGAGAGCTTGTGAAAGCAATCCTCTTGACCGAGTTTCCTCGGAAAGTTAACTAATCCAGGTCTACAAAAGGTGCACAGGTGGAGAGATAAAGATGACACGGCGAGCACATGCCCCCGAGAGGACCAGCTACAACCGAGCCAAGTTCATTCAATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGAAACCAAGGAAA
Alignment with the top match in Blast showing only one difference between the two and a phylogenetic tree made with Snap-Gene:

This should be right, right? Since I am not a pro in this regard I would appreciate if you could confirm my findings Alan so I can re-post these results in a few other places like the Hunting&ID Forum, the Misc Exotic Thread and include it in the introduction of the Official Sem Thread as well.
Edited by Baba Yaga (08/02/22 04:38 PM)
|
smalltalk_canceled
Babnik



Registered: 07/13/20
Posts: 2,862
Last seen: 11 days, 21 hours
|
Re: Psilocybe hispanica [Re: Baba Yaga] 1
#27889702 - 08/04/22 12:07 PM (1 year, 5 months ago) |
|
|
-------------------- Willpower is the one true virtue
  
|
smalltalk_canceled
Babnik



Registered: 07/13/20
Posts: 2,862
Last seen: 11 days, 21 hours
|
|

Does this mycelium look like agaricus blazeii or like hispanica
-------------------- Willpower is the one true virtue
  
|
V.L


Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 50 minutes, 1 second
|
|
It was from this grow:
 Sent from France few months ago
|
|