Home | Community | Message Board


This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Kraken Kratom Red Vein Kratom   North Spore Bulk Substrate   Mushroom-Hut Substrate Bags   Original Sensible Seeds Bulk Cannabis Seeds   PhytoExtractum Kratom Powder for Sale   Left Coast Kratom Buy Kratom Extract

Jump to first unread post Pages: 1 | 2 | Next >  [ show all ]
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
OfflineWorkmanV
1999 Spore War Veteran
Male User Gallery

Registered: 03/01/01
Posts: 3,598
Loc: Oregon, USA
Last seen: 14 hours, 25 minutes
Trusted Cultivator
Psilocybe hispanica * 2
    #2102193 - 11/13/03 02:45 PM (20 years, 2 months ago)

Outdoor cultivated Psilocybe hispanica. This species is relatively easy to grow on sterilized horse manure placed outside during cool fall weather (around 60F). A relatively newly described species from Spain. In Spain it grows directly on sheep dung in fields that also support fruitings of Psilocybe semilanceata








Very small specimens growing from a displaced piece of colonized horse dung. Rodents or birds dug into the patch and scattered small pieces of dung that later fruited. It is interesting to note the reduced size of the mushrooms when growing from very small amounts of substrate.



This is a larger specimen from the main patch. Still a relatively small mushroom. The odor is very similar to Psilocybe semilanceata and the appearance reminds me of Psilocybe mexicana


--------------------
Research funded by the patrons of
The Spore Works
Exotic Spore Supply

My Instagram
Reinvesting 25% of Sales Towards Basic Research and Species Identification :amanitajar:


Extras: Unfilter Print Post Top
Invisiblefunkymonk22
In Service to the Ineffable..
Male User Gallery

Registered: 01/25/16
Posts: 469
Loc: The Big O
Re: Psilocybe hispanica [Re: Alan Rockefeller]
    #24211116 - 04/01/17 02:49 PM (6 years, 9 months ago)

i grew p hispanica in monotubs in a cold room this winter..temps were about 50-60F.  one of the easiest and most prolific species i have grown..


not sure about potency yet, havent had the time to try em


--------------------


"The clouds didn't look like cotton, they didn't even look like clouds.."-Townes Van Zandt


Extras: Unfilter Print Post Top
Invisiblefunkymonk22
In Service to the Ineffable..
Male User Gallery

Registered: 01/25/16
Posts: 469
Loc: The Big O
Re: Psilocybe hispanica [Re: Lennybernadino] * 1
    #24239750 - 04/13/17 09:02 AM (6 years, 9 months ago)



couple hispanica shots from this morning..still fruiting away, they seem to love the PNW..i wonder if we can naturalize them here


--------------------


"The clouds didn't look like cotton, they didn't even look like clouds.."-Townes Van Zandt


Extras: Unfilter Print Post Top
InvisibleSporulator
Male User Gallery

Registered: 03/08/11
Posts: 1,643
Loc: Europe
Re: Psilocybe hispanica [Re: Alan Rockefeller] * 2
    #24886937 - 01/03/18 08:38 AM (6 years, 26 days ago)

Quote:

Alan Rockefeller said:
Could P. hispanica be conspecific with P. semilanceata?

The ITS sequences are just one base pair different, and it's just that one A turned into two A's near the beginning of the sequence, which is likely not even a real difference.

Perhaps they found P. semilanceata on horse dung and thought it was something new because of the unusual substrate.  But horse dung is really just chewed up grass, so it's not that much of a leap - and P. semilanceata is found in the area.

The LSU sequences of the two species are identical.

I am having trouble finding the original species description, which was published in "Docums Mycol. 29(no. 116): 42 (2000)".  Docums Mycol. is short for Les Documents Mycologiques.

Here's a photo of the holotype:  http://mushroomobserver.org/241329




      I never saw Psilocybe semilanceata fruiting directly from cow patties or horse droppings.

      The Psilocybe hispanica strain I am working with does not look like Psilocybe semilanceata.

      It is easy to grow compared to Psilocybe semilanceata, a casing layer is not necessary. It is a cold weather species like Psilocybe semilanceata,
      fruiting between 40 and 60 F and the potency is definitely equal to Psilocybe semilanceata.

      But is the species I am working with really Psilocybe hispanica?

      And was the material used for DNA sequencing really Psilocybe hispanica?  Where did the material come from?  This is all very confusing.








--------------------
                 


Edited by Sporulator (01/03/18 10:32 AM)


Extras: Unfilter Print Post Top
Invisiblesaralove
Female User Gallery


Registered: 10/01/13
Posts: 1,068
Trusted Cultivator
Re: Psilocybe hispanica [Re: Workman] * 10
    #26498787 - 02/22/20 05:20 PM (3 years, 10 months ago)

Quote:

Workman said:
Outdoor cultivated Psilocybe hispanica.  This species is relatively easy to grow on sterilized horse manure placed outside during cool fall weather (around 60F).  A relatively newly described species from Spain.  In Spain it grows directly on sheep dung in fields that also support fruitings of Psilocybe semilanceata








Very small specimens growing from a displaced piece of colonized horse dung.  Rodents or birds dug into the patch and scattered small pieces of dung that later fruited.  It is interesting to note the reduced size of the mushrooms when growing from very small amounts of substrate.



This is a larger specimen from the main patch.  Still a relatively small mushroom.  The odor is very similar to Psilocybe semilanceata and the appearance reminds me of Psilocybe mexicana   





I hope this puts a smile on your face workman wherever you are  =)

P. hispanica as a fun little cake




your teachings live on:mushroom2:



always your student,

sara




ps.

hi everyone:sun:


--------------------
:bliss:
Listening to: emancipator - baralku tour (live)  |  AMU


Extras: Unfilter Print Post Top
Invisiblecoversall
إِنْ شَاءَ ٱللَهُ
 Unread Journal


Registered: 06/06/20
Posts: 2,749
Loc: संसार
Re: Psilocybe hispanica [Re: saralove] * 1
    #27110417 - 12/27/20 09:50 AM (3 years, 1 month ago)

Quote:

saralove said:
Quote:

Workman said:
Outdoor cultivated Psilocybe hispanica.  This species is relatively easy to grow on sterilized horse manure placed outside during cool fall weather (around 60F).  A relatively newly described species from Spain.  In Spain it grows directly on sheep dung in fields that also support fruitings of Psilocybe semilanceata








Very small specimens growing from a displaced piece of colonized horse dung.  Rodents or birds dug into the patch and scattered small pieces of dung that later fruited.  It is interesting to note the reduced size of the mushrooms when growing from very small amounts of substrate.



This is a larger specimen from the main patch.  Still a relatively small mushroom.  The odor is very similar to Psilocybe semilanceata and the appearance reminds me of Psilocybe mexicana   





I hope this puts a smile on your face workman wherever you are  =)

P. hispanica as a fun little cake




your teachings live on:mushroom2:



always your student,

sara




ps.

hi everyone:sun:




What an awesome bump! Those are stunning! I'm going to watch this thread with interest.


--------------------

..:: E V E R Y  ::..

..:: New? Start here. ::..
..:: How I Panaeolus. From Agar to Tea ::..


Extras: Unfilter Print Post Top
OfflineV.L
Male User Gallery

Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 50 minutes, 1 second
Trusted Cultivator
Re: Psilocybe hispanica [Re: coversall] * 3
    #27726779 - 04/09/22 06:28 AM (1 year, 9 months ago)



They are small, for me too easier to grow than semilanceata (as I failed all attempts with semi indoor) phenotype remind me a bit tampanensis but prefer colder temperature.. thanks to CaptainFuture for the print it was a something I wanted to observe since years and will work more on it! Fingers crossed for printing in few days!


Edited by V.L (04/09/22 09:23 AM)


Extras: Unfilter Print Post Top
OfflineV.L
Male User Gallery

Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 50 minutes, 1 second
Trusted Cultivator
Re: Psilocybe hispanica [Re: Alan Rockefeller] * 2
    #27732067 - 04/12/22 10:21 PM (1 year, 9 months ago)

Does a spore print is enough material? feel free to pm..

Psilocybe hispanica



hispanica printing

Those are the last pic I could upload, normal account limit reached :frown:


Edited by V.L (04/13/22 06:53 AM)


Extras: Unfilter Print Post Top
OfflineV.L
Male User Gallery

Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 50 minutes, 1 second
Trusted Cultivator
Re: Psilocybe hispanica [Re: V.L]
    #27752867 - 04/27/22 02:17 AM (1 year, 8 months ago)

Took 2 weeks for a little second flush:



Some spores under my very old microscope and phone photo:



Extras: Unfilter Print Post Top
OfflineV.L
Male User Gallery

Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 50 minutes, 1 second
Trusted Cultivator
Re: Psilocybe hispanica [Re: V.L] * 8
    #27762299 - 05/04/22 02:01 AM (1 year, 8 months ago)

2nd cake 1st flush


Extras: Unfilter Print Post Top
OfflineDH42
Local to somewhere
 User Gallery


Registered: 10/05/20
Posts: 92
Loc: Scotland Flag
Last seen: 2 days, 4 hours
Re: Psilocybe hispanica [Re: Alan Rockefeller] * 1
    #27762497 - 05/04/22 08:43 AM (1 year, 8 months ago)

I agree Alan, the ones in this thread do look similar to P.fimetaria. I'll attach some examples of hispanica-looking-fimetaria below.

If P.hispanica is actually P.fimetaria, it would mean we would be able to add sheep manure to the list of substrate from which P.fimetaria grows. Also, I have a suspicion that P.fimetaria might grow from Red Deer manure - at least in Scotland/UK.

I saw in another comment, from a few years ago, you said you had an ITS and LSU sequence of P.hispanica. Have you tried comparing the ITS to one of P.fimetaria?














--------------------
Have a look at the subreddit r/fimetaria!


Extras: Unfilter Print Post Top
InvisibleinskiM
Cortinariologist
Male User Gallery


Registered: 02/28/06
Posts: 5,720
Trusted Cultivator
Re: Psilocybe hispanica [Re: V.L] * 5
    #27762754 - 05/04/22 12:15 PM (1 year, 8 months ago)

I think Psilocybe alutacea should be included in these comparisons.


--------------------


Extras: Unfilter Print Post Top
OfflineDH42
Local to somewhere
 User Gallery


Registered: 10/05/20
Posts: 92
Loc: Scotland Flag
Last seen: 2 days, 4 hours
Re: Psilocybe hispanica [Re: inski] * 3
    #27765546 - 05/06/22 07:08 AM (1 year, 8 months ago)

Quote:

inski said:
I think Psilocybe alutacea should be included in these comparisons.






Another potential candidate for P.fimetaria!



--------------------
Have a look at the subreddit r/fimetaria!


Extras: Unfilter Print Post Top
InvisibleBaba Yaga
♥ coir grower

Registered: 09/13/20
Posts: 3,955
Loc: Hyperspace Chicken Coop
Trusted Cultivator
Re: Psilocybe hispanica [Re: V.L] * 1
    #27776389 - 05/14/22 01:55 AM (1 year, 8 months ago)

Hey just popping by to post some photos of a few fruits from this years semilanceata grow.
I will send these away for sequencing soon and will post the result.



Edited by Baba Yaga (06/15/22 03:41 PM)


Extras: Unfilter Print Post Top
Offlinesmalltalk_canceled
Babnik
 User Gallery

Registered: 07/13/20
Posts: 2,862
Last seen: 11 days, 21 hours
Re: Psilocybe hispanica [Re: Baba Yaga]
    #27783867 - 05/19/22 06:05 AM (1 year, 8 months ago)

Joining this thread too, because of all the good info and the recent development.

Its going to be super exciting to follow hispanica/semilanceata/fimetaria complex.

Got a lot of small individual subs going outside, inside, etc

Im sure we'll have more answers by end of 2022

-

Quote:

funkymonk22 said:
i grew p hispanica in monotubs in a cold room this winter..temps were about 50-60F.  one of the easiest and most prolific species i have grown..


not sure about potency yet, havent had the time to try em





Also to me, the tub here is very alike to my sequenced p fimetaria


--------------------
Willpower is the one true virtue



Edited by smalltalk_canceled (05/24/22 03:14 AM)


Extras: Unfilter Print Post Top
Offlinesmalltalk_canceled
Babnik
 User Gallery

Registered: 07/13/20
Posts: 2,862
Last seen: 11 days, 21 hours
Re: Psilocybe hispanica [Re: MycoCakes] * 4
    #27812106 - 06/09/22 11:27 AM (1 year, 7 months ago)










--------------------
Willpower is the one true virtue



Edited by smalltalk_canceled (06/09/22 04:55 PM)


Extras: Unfilter Print Post Top
InvisibleBaba Yaga
♥ coir grower

Registered: 09/13/20
Posts: 3,955
Loc: Hyperspace Chicken Coop
Trusted Cultivator
Re: Psilocybe hispanica [Re: smalltalk_canceled] * 5
    #27883715 - 07/31/22 04:52 AM (1 year, 5 months ago)

Ok, so I got the sequence results back and the mushrooms I grew are semilanceata from what I can see.

A few examples from the first Semilanceata Grow 2020:




and some fruits from second grow 2022 started with spores from above. Samples for sequencing were taken from this grow:

 


Because I banned myself for a few weeks I couldn’t get in touch with Alan but instead I watched his videos on youtube about how to work the
data and this is what I got out from alingning the sequence with BLAST and creating a phylogenetic tree with Geneious Prime.

Alan, I can send you the .ab1 file if you want to have a look at that.


Sequence:

ACCTGATTTGAGGNCAAATTGTCATTTGTATTGTCCAGTGAAGGACGGTTAGAAGCAGCGCAATCCCATTCATGCAAAGGTCCACGGCGTAGATAATTATCACACCAATAGACGGCTCTGCGCGGGGCACCGGCTAATACATTTAAGGGGAGCAGACCTCTTGACGAAGCCAGCAAAAGACCCCCACATCCAAGCCATTATCAGCAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGTTTATAGGCACAAGGCCAATATAATACATTCTGTTACATTCTTTGGGGTATATGAAAACGTAGGCCTGGGTTAATTTGCAAGGAGAGCTTGTGAAAGCAATCCTCTTGACCGAGTTTCCTCGGAAAGTTAACTAATCCAGGTCTACAAAAGGTGCACAGGTGGAGAGATAAAGATGACACGGCGAGCACATGCCCCCGAGAGGACCAGCTACAACCGAGCCAAGTTCATTCAATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGAAACCAAGGAAA


Alignment with the top match in Blast showing only one difference between the two and a phylogenetic tree made with Snap-Gene:




This should be right, right? Since I am not a pro in this regard I would appreciate if you could confirm my findings Alan so I can re-post these
results in a few other places like the Hunting&ID Forum, the Misc Exotic Thread  and include it in the introduction of the Official Sem Thread as well.


Edited by Baba Yaga (08/02/22 04:38 PM)


Extras: Unfilter Print Post Top
Offlinesmalltalk_canceled
Babnik
 User Gallery


Registered: 07/13/20
Posts: 2,862
Last seen: 11 days, 21 hours
Re: Psilocybe hispanica [Re: Baba Yaga] * 1
    #27889702 - 08/04/22 12:07 PM (1 year, 5 months ago)



--------------------
Willpower is the one true virtue



Extras: Unfilter Print Post Top
Offlinesmalltalk_canceled
Babnik
 User Gallery


Registered: 07/13/20
Posts: 2,862
Last seen: 11 days, 21 hours
Re: Psilocybe hispanica [Re: smalltalk_canceled]
    #27903560 - 08/14/22 07:07 PM (1 year, 5 months ago)



Does this mycelium look like agaricus blazeii or like hispanica


--------------------
Willpower is the one true virtue



Extras: Unfilter Print Post Top
OfflineV.L
Male User Gallery

Registered: 12/15/17
Posts: 526
Loc: In my pants
Last seen: 50 minutes, 1 second
Trusted Cultivator
Re: Psilocybe hispanica [Re: Alan Rockefeller] * 1
    #27924020 - 08/29/22 12:31 PM (1 year, 4 months ago)

It was from this grow:

Sent from France few months ago


Extras: Unfilter Print Post Top
Jump to top Pages: 1 | 2 | Next >  [ show all ]

Shop: Kraken Kratom Red Vein Kratom   North Spore Bulk Substrate   Mushroom-Hut Substrate Bags   Original Sensible Seeds Bulk Cannabis Seeds   PhytoExtractum Kratom Powder for Sale   Left Coast Kratom Buy Kratom Extract


Similar ThreadsPosterViewsRepliesLast post
* Psilocybe hispanica - Pins on agar (Updated 5-25-06)
( 1 2 all )
WorkmanV 8,645 26 12/05/06 04:51 AM
by myCo_psyCo
* Psilocybe Hispanica.. anybody grown it? Know how? Dogomush 1,444 4 11/15/02 11:21 AM
by mycofile
* P. hispanica grow TEK
( 1 2 all )
Zanti 6,732 21 06/13/03 04:31 AM
by Ryche Hawk
* Where's a Hispanica tek? Dogomush 1,064 3 05/27/03 02:09 PM
by comario2
* Psilocybe semilanceata spores Zanti 13,494 10 08/08/07 10:19 AM
by Workman
* NEW WORLD PSILOCYBE SPECIES nachoo 1,986 8 08/28/01 01:39 PM
by dioze1
* Re: Psilocybe natalensis and Psilocybe zapatecorum info please Anonymous 1,739 5 04/20/00 08:25 PM
by phree_1
* salvia hispanica L grain in substrate???? es_f1 1,371 6 02/16/08 07:54 PM
by Subbedhunter420

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: RogerRabbit, Pastywhyte, bodhisatta
23,549 topic views. 2 members, 8 guests and 4 web crawlers are browsing this forum.
[ Show All Posts | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.034 seconds spending 0.01 seconds on 17 queries.