Home | Community | Message Board


Mycohaus
Please support our sponsors.

Mushrooms, Mycology and Psychedelics >> Mushroom Hunting and Identification

Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Amazon Shop: Vermiculite

Jump to first unread post. Pages: 1 | 2 | 3 | 4 | 5 | 6 | Next >  [ show all ]
Offlinepsylosymonreturns
aka Gym Sporrison
Male


Registered: 10/16/09
Posts: 13,946
Loc: Mos Eisley,
Last seen: 8 months, 11 days
Getting personal with Panaeolus
    #16354719 - 06/09/12 02:58 AM (5 years, 1 month ago)

Hey guys and gals. I think its time we put our heads together and give this genus the spotlight. there is alot of misconceptions and misindentifications and just not a lot of good information compiled in one place with Panaeolous.

we can include Panaeolopsis because they are rad and Panaeolina so noobs will see that its not really hard to tell the difference!

please include pics, habitat shots, microscopy and all that is Pan!



Panaeolus subbalteatus/ cinctulus/ black spores/ grass



dung/





unknown Panaeolus 1 / black spore print / found in a pasture that doesnt support liberty caps. could have been on dung, i cant remember.





unknown Panaeolus 2 / hopefully Panaeolus olivaceus / black spores/found in some grass in a back yard





unknown Panaeolus 3 / hopefully Panaeolus fimicola /black spores/ found in a pasture that supports liberty caps





unknown Panaeolus 4 / id as P fimicola by Bob. / black spores/growing alongside a lake in some grass full of goose shit





Panaeolus papilionaceus/ black spores





Panaeolus acuminatus/ black spores

[/url]




Panaeolina foenisecii/ brown spores



thats it for now. take it away folks!!


--------------------


Edited by psylosymonreturns (06/09/12 04:17 AM)


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleByrain

Registered: 01/07/10
Posts: 9,108
Trusted Identifier
Re: Getting personal with Panaeolus [Re: psylosymonreturns]
    #16355002 - 06/09/12 05:09 AM (5 years, 1 month ago)

Panaeolina foenisecii

Spores (With 1-3 oil drops per spore, but hard to see in the image)

Pileipellis


Panaeolina castaneifolia

Spores without oil drops

Pileipellis


Panaeolus olivaceus

Slightly roughened spores

Pileipellis


Panaeolus olivaceus left, Panaeolina castaneifolia right.


Panaeolus cinctulus



Spores
CheilocystidiumPileipellis

I'll add more later.


Edited by Byrain (06/10/12 04:33 PM)


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleTheShroomingAtheis
He's gone....


Registered: 12/31/11
Posts: 2,734
Re: Getting personal with Panaeolus [Re: Byrain]
    #16355071 - 06/09/12 06:54 AM (5 years, 1 month ago)

OMG OMG I HAVE
Panaeolina castaneifolia
im my garden
is it active?
ID's here said it to be foes
but it aint! may i make an id here?


--------------------
You gotta face the music!


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleTheShroomingAtheis
He's gone....


Registered: 12/31/11
Posts: 2,734
Re: Getting personal with Panaeolus [Re: TheShroomingAtheis]
    #16355076 - 06/09/12 07:03 AM (5 years, 1 month ago)










Dont know what any of them are.


--------------------
You gotta face the music!


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinepsylosymonreturns
aka Gym Sporrison
Male


Registered: 10/16/09
Posts: 13,946
Loc: Mos Eisley,
Last seen: 8 months, 11 days
Re: Getting personal with Panaeolus [Re: TheShroomingAtheis]
    #16355473 - 06/09/12 11:30 AM (5 years, 1 month ago)

great shots Byrain! i was hoping you were going to join in!! what I notice about your P olivaceus is that the caps have a grey color, just like mine. thats something we need to look out for with a macro id.

nice work with the Panaeolina castaneifolia, nice to see something new!! i never saw your microscopy on those. :thumbup:


anyone else want to play, we need to see some of those tropical Pans!!


--------------------


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinemountainplayer
Stranger
 User Gallery


Registered: 01/07/11
Posts: 1,272
Last seen: 25 days, 7 hours
Re: Getting personal with Panaeolus [Re: TheShroomingAtheis]
    #16356000 - 06/09/12 02:09 PM (5 years, 1 month ago)

Quote:

TheShroomingAtheis said:
OMG OMG I HAVE
Panaeolina castaneifolia
im my garden
is it active?
ID's here said it to be foes
but it aint! may i make an id here?




What's up with picture #5?


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleByrain

Registered: 01/07/10
Posts: 9,108
Trusted Identifier
Re: Getting personal with Panaeolus [Re: TheShroomingAtheis]
    #16356134 - 06/09/12 02:47 PM (5 years, 1 month ago)

Quote:

TheShroomingAtheis said:
Dont know what any of them are.




I'm really hesitant in applying Panaeolus and Panaeolina names without microscopy.  The first four pics are Panaeolina, they look like what I have been calling P. castaneifolia which is an American species which is supposed to be a more robust then P. foenisecii, but I don't really know how to tell them apart macroscopically, I don't believe it is active. :shrug:

Are the last same pictures from the same patch?  Its hard to tell with the lighting, but they look more like an Panaeolus.


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinepsylosymonreturns
aka Gym Sporrison
Male


Registered: 10/16/09
Posts: 13,946
Loc: Mos Eisley,
Last seen: 8 months, 11 days
Re: Getting personal with Panaeolus [Re: Byrain]
    #16356179 - 06/09/12 02:59 PM (5 years, 1 month ago)

so  P. castaneifolia is suppose to be robust eh? i always wondered why some , what i thought were foes , get huge here!! maybe i'll print some one day.


--------------------


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleByrain

Registered: 01/07/10
Posts: 9,108
Trusted Identifier
Re: Getting personal with Panaeolus [Re: psylosymonreturns]
    #16356217 - 06/09/12 03:10 PM (5 years, 1 month ago)

Quote:

psylosymonreturns said:
great shots Byrain! i was hoping you were going to join in!! what I notice about your P olivaceus is that the caps have a grey color, just like mine. thats something we need to look out for with a macro id.




There is still P. fimicola and a few other species to sort out, such as P. microsporus, P. subfirmus. P. reticulatus, and P. paludosus.  I don't think I have descriptions for any of those 4...

Quote:

nice work with the Panaeolina castaneifolia, nice to see something new!! i never saw your microscopy on those. :thumbup:




Its really close to P. foenisecii, I wonder if its really different.  I only really got the literature to go on at this point.

Quote:

anyone else want to play, we need to see some of those tropical Pans!!




Some europeans should look for P. guttulatus which should have a gill edge with yellowish droplets that need a hand lens to see.  It would also be cool to see the wood loving species, such as P. bernicis and P. fraxinophilus.

Quote:

psylosymonreturns said:
so  P. castaneifolia is suppose to be robust eh? i always wondered why some , what i thought were foes , get huge here!! maybe i'll print some one day.




I'm not sure if printing them will help, going off the literature, it differs in not usually having oil drops in the spores, having only 4 spored basidia instead of both 4 and 2 spored, the epicutis cells are larger, and its known mostly from urban environments when P. foenisecii is not.  The taste and smell also might be indicative.

Here is the Panaeolina key I am using, there may be some more Panaeolina species from Japan which are not included.  I only know of the names so far though, P. rhombisperma Hongo and P. sagarae Hongo.

Quote:

Key: Species of the genus Panaeolina
1 Spores normally with 1 to 2 big oildrops (also at
exsiccatum); nearly cosmopolitan species
...................................... Panaeolina foenisecii (30)
- Spores normally without oildrops .............................. 2
2 Breadth of spores not more than 10 Lim, ornamenta
tion like foenisecii; basidia constantly 4-spored; robust
Northamerican species Panaeolina castaneifolia (31)
- Breadth of spores up to 12 Lim, ornamentation more
coarsely as foenisecii; basidia 1- to 4-spored; Indian
species ................................... Panaeolina indica (32)




Post Extras: Print Post  Remind Me! Notify Moderator
Offlinepsylosymonreturns
aka Gym Sporrison
Male


Registered: 10/16/09
Posts: 13,946
Loc: Mos Eisley,
Last seen: 8 months, 11 days
Re: Getting personal with Panaeolus [Re: Byrain]
    #16356258 - 06/09/12 03:21 PM (5 years, 1 month ago)

man you know your pans! i have never heard of any of those international ones. are those active or non active species?

hopefully some of my finds are P fimicola , alan has them and has done microscopy on them but he hasnt posted any pics or results yet.


--------------------


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleByrain

Registered: 01/07/10
Posts: 9,108
Trusted Identifier
Re: Getting personal with Panaeolus [Re: psylosymonreturns]
    #16356338 - 06/09/12 03:44 PM (5 years, 1 month ago)

Quote:

psylosymonreturns said:
man you know your pans! i have never heard of any of those international ones. are those active or non active species?




I don't really know them well yet, I only know I don't know enough yet. :smile:
And I don't know how many of those are active, the first four I mentioned after fimicola I don't even know what part of the world they are known from...  I seem to be missing pages from this Gerhardt Panaeolus book. :frown:


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery

Registered: 03/10/07
Posts: 43,246
Last seen: 17 days, 6 hours
Trusted Identifier
Re: Getting personal with Panaeolus [Re: psylosymonreturns] * 1
    #16356400 - 06/09/12 04:02 PM (5 years, 1 month ago)

Panaeolus cyanescens

http://mushroomobserver.org/95460

Growing in my friends closet on 90% horse manure and 10% vermiculite.

Temperature was 78 degrees, humidity 99%.






























Panaeolus alcis

Macroscopic photos by knarkkorven. Micrographs by Alan Rockefeller.

10.00 micrometer divisions.

Thread here.

On moose dung.

Cheilocystidia abundant. Pleurocystidia absent.

Spores (15.5) 17.0 – 19.3 (19.5) x (8.9) 9.0 – 10.2 (10.9) μm.

15.55 × 8.88
17.00 × 9.23
17.08 × 9.32
17.36 × 8.75
17.91 × 8.61
18.26 × 9.86
18.40 × 9.02
18.61 × 8.81
18.95 × 9.09
19.09 × 10.13
19.23 × 10.90
19.25 × 10.27
19.36 × 9.02
19.37 × 9.58
19.37 × 9.93
19.51 × 9.09

ITS1 sequence:

TATGATATGCTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGGTCAAATGGTTCAAGTTGTCCAAGTCAATGGACGGTT
AGAAGCGGGGCAAACACCTTTTTACAGCAATCCTAGACCACGGCGTAGATAATTATCACACCAATAGATAGGTTTGCGCG
GGGCACCCACTAATTCATTTGAGAGGAGCTGACCTTTCGGCCTGCAGAAACCTCCACATCCAAGCCATCATCACAAAAGC
GATGAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCTTCGGAATACCAAAGAGCGCAAGGTGCGTTCAAAGATTC
GATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCC
GTTGCTGAAAGTTGTATATAGTTTATAGGCTTAGAGCCCATTGAATCGTTCTGTTACTTTCAATAGTGTATATGTATAAG
CATAGGACCTGAACGTCAAGGAATTGCTTCCCTTCCCTCCAGACCTACAGTGTGTTCACAGGTGGAAAAACAAAAAAGGT
AAGGCGTGCACAGTTCCCCCGAGAGGGACAGCAACAACCCACCCAGTTTATTCGATAATGATCCTTCCGCAGGTCACCTA
CGGAAACCTTGTTACGACTTTTACTTCCTCTAA

BLAST matches:

Panaeolus sphinctrinus isolate AFTOL-ID 1499 18S ribosomal RNA gene from Worcester, PA – 99% query coverage, 99% match
Panaeolus campanulatus voucher 10141 18S ribosomal RNA gene from Italy – 96% query coverage, 99% match
Panaeolus rickenii voucher 12446 18S ribosomal RNA gene from Italy – 96% query coverage, 99% match












Panaeolus semiovatus

From Perote, Veracruz, Mexico

http://mushroomobserver.org/84656



Spores standing on end, showing large germ pore.



Post Extras: Print Post  Remind Me! Notify Moderator
Invisiblemaynardjameskeenan
The white stipes
Male

Folding@home Statistics
Registered: 11/11/10
Posts: 16,326
Loc: 'Merica
Trusted Identifier
Re: Getting personal with Panaeolus [Re: Alan Rockefeller]
    #16356464 - 06/09/12 04:19 PM (5 years, 1 month ago)

:aweyeah: Your friends closet seems like a cool place to be.


--------------------
May you be filled with loving kindness.
May you be well.
May you be peaceful and at ease.
May you be happy.



AMU Q&A


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinepsylosymonreturns
aka Gym Sporrison
Male


Registered: 10/16/09
Posts: 13,946
Loc: Mos Eisley,
Last seen: 8 months, 11 days
Re: Getting personal with Panaeolus [Re: maynardjameskeenan]
    #16356657 - 06/09/12 05:04 PM (5 years, 1 month ago)

nice additions alan!


--------------------


Post Extras: Print Post  Remind Me! Notify Moderator
Offlineknarkkorven
Entheoholic
Male User Gallery

Registered: 06/22/05
Posts: 1,332
Loc: Sweden Flag
Last seen: 4 days, 5 hours
Re: Getting personal with Panaeolus [Re: maynardjameskeenan] * 1
    #16356676 - 06/09/12 05:08 PM (5 years, 1 month ago)

Great thread!! I have thought about creating something like this but never took the time to do it..

I have collected some rare specimens during the years (some that I can ID), but also some strange ones... Here at The Shroomery almost everything people post is considered pan paps which I think sometimes is to quick/easy to call..


P. acuminatus



frozen



p. papilionaceus



p. semiovatus (the smaller var.)



the big ones



what I think is p. retirugis... which I know is considered a synonym to p. papilionacues (?) but I think the wrinkels is a sign of somthing else.



tan panaeolus or panaeolina



I think this is the same species as the ones psylosymonreturns found



here you see acuminatus (right) and something with clearly different shape/colors(left)



p. foenisecii




could be p. foenisecii



p. alcis - see Alans post.. :wink:

p cinctulus / subbalteatus




other unknowns:



Edited by knarkkorven (06/10/12 03:59 AM)


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineNeoSporen
Antibiotic cream
Male User Gallery


Registered: 09/05/09
Posts: 4,137
Loc: Washington State Flag
Last seen: 22 days, 22 hours
Re: Getting personal with Panaeolus [Re: psylosymonreturns]
    #16356695 - 06/09/12 05:13 PM (5 years, 1 month ago)

Panaeolus Acuminatus:

Basidia-

cheilocystidia-

Spores @ 2000X-



Panaeolus cinctulus:


--------------------
Having lived through an existence close to nature, one accepts the small and simple things as most important in life. Sun, wind, rain and snow. The sounds birds make, smells of fresh wild flowers. Love of all kinds, from friends and family, thy self and our neighbors. Beautiful sunrises to the darkest clouds dancing above in the sky. To forgive, learn, share and express. This is the only thing a man such as myself can ask for. What comes as the result is nothing short of the core of human existence, to truly live free in body and mind.


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineGreenGoblin7
Dreamer
Male User Gallery


Registered: 01/02/09
Posts: 711
Last seen: 2 years, 6 months
Re: Getting personal with Panaeolus [Re: NeoSporen]
    #16356985 - 06/09/12 06:18 PM (5 years, 1 month ago)

Another image of Panaeolus Cinctulus showing slight color variation.


--------------------
:mushroom2:"Only when the power of love overcomes the love of power will the world be at peace" - Jimi Hendrix:mushroom2:

2009 Carolina Hunting Thread
2010 Carolina Hunting Thread


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineNeoSporen
Antibiotic cream
Male User Gallery


Registered: 09/05/09
Posts: 4,137
Loc: Washington State Flag
Last seen: 22 days, 22 hours
Re: Getting personal with Panaeolus [Re: GreenGoblin7]
    #16357003 - 06/09/12 06:24 PM (5 years, 1 month ago)

I'll only add a few to compare with the other ones posted.

Panaeolus olivaceus:

Cheilocystidia:

Basidia:

Spores:


--------------------
Having lived through an existence close to nature, one accepts the small and simple things as most important in life. Sun, wind, rain and snow. The sounds birds make, smells of fresh wild flowers. Love of all kinds, from friends and family, thy self and our neighbors. Beautiful sunrises to the darkest clouds dancing above in the sky. To forgive, learn, share and express. This is the only thing a man such as myself can ask for. What comes as the result is nothing short of the core of human existence, to truly live free in body and mind.


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinepsylosymonreturns
aka Gym Sporrison
Male


Registered: 10/16/09
Posts: 13,946
Loc: Mos Eisley,
Last seen: 8 months, 11 days
Re: Getting personal with Panaeolus [Re: NeoSporen]
    #16357473 - 06/09/12 08:21 PM (5 years, 1 month ago)

Knarrk, glad you joined in!! you have a huge selction!

i imagine 2nd unknwn at the bottom of your post is P papilionaceus .



Bfogg, again nice additions man . this thread is going to be epic!


--------------------


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleByrain

Registered: 01/07/10
Posts: 9,108
Trusted Identifier
Re: Getting personal with Panaeolus [Re: psylosymonreturns]
    #16361447 - 06/10/12 04:35 PM (5 years, 1 month ago)

Added some P. cinctulus to the second post.


Post Extras: Print Post  Remind Me! Notify Moderator
Jump to top. Pages: 1 | 2 | 3 | 4 | 5 | 6 | Next >  [ show all ]

Amazon Shop: Vermiculite

Mushrooms, Mycology and Psychedelics >> Mushroom Hunting and Identification

Similar ThreadsPosterViewsRepliesLast post
* Some starter help please downhill 650 11 07/11/07 03:58 PM
by Jair
* Hunting, location distances, how far is far away (4u personally|)?....
( 1 2 all )
Sobercolober 1,629 30 06/11/11 08:05 PM
by Stopwhispering
* Personal first: I got mushroom poisoning. Mr. Mushrooms 1,327 11 07/06/08 11:50 PM
by Mr. Mushrooms
* Psylosymon's 2012 fall fungi finds, projects and id requests update Nov 25 2012 Azurescen bonsai!
( 1 2 3 all )
psylosymonreturns 4,117 44 11/26/12 08:03 PM
by psylosymonreturns
* Re: Psylosymon and any BC hunters..... Anonymous 678 1 08/05/00 11:32 AM
by mjshroomer
* South Australia 2005 season starter
( 1 2 3 4 5 6 7 all )
tryptonite 16,285 125 10/03/05 02:57 AM
by tryptonite
* Here's a starter for the Aussie summer season ajna 539 3 10/01/05 12:01 PM
by tryptonite
* Well apparantly I'm a bad person whatdidusay 582 9 10/03/09 04:17 AM
by sui

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: ToxicMan, karode13, inski, Alan Rockefeller, TimmiT, Joust, Tmethyl, Fennario
7,100 topic views. 5 members, 46 guests and 10 web crawlers are browsing this forum.
[ Toggle Favorite | Print Topic | Stats ]
Search this thread:
MushroomCube.com
Please support our sponsors.

Copyright 1997-2017 Mind Media. Some rights reserved.

Generated in 0.037 seconds spending 0.002 seconds on 18 queries.