|
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
|
Oboy
Psychonaut
Registered: 05/03/11
Posts: 533
Loc: Sweden
Last seen: 5 years, 6 months
|
Re: Panaeolus alcidis, a rare species on moose dung [Re: knarkkorven]
#15090575 - 09/17/11 04:34 AM (12 years, 6 months ago) |
|
|
Really beautiful photos as always knarkkorven!
I haven't seen those souvenirs before, but i there was a site were you could order plain moose spillings by weight... What do you say there are people for everything.
|
Bobzimmer
Crawlin' Kingsnake
Registered: 09/07/08
Posts: 8,696
Loc: NY
|
Re: Panaeolus alcidis, a rare species on moose dung [Re: Oboy]
#15090865 - 09/17/11 07:43 AM (12 years, 6 months ago) |
|
|
Very cool species, Knark! Moose get more and more common here (in the spring)...maybe I have a shot at finding this.
-------------------- Mr. Mushrooms said: I will confess something that should be quite obvious, CC. I love mushrooms, i.e. fungi. I really do. I am talking about a strong feeling, i.e. emotion, for them. I think they are beautiful. I even dream of them.
|
psylosymonreturns
aka Gym Sporrison
Registered: 10/16/09
Posts: 13,948
Loc: Mos Eisley,
Last seen: 3 years, 8 months
|
Re: Panaeolus alcidis, a rare species on moose dung [Re: knarkkorven]
#15094171 - 09/17/11 11:48 PM (12 years, 6 months ago) |
|
|
Quote:
knarkkorven said: psylosymonreturns: No, I'm not dissing it. I actually liked it very much and was about to nominate it (or another picture in that series) but saw that someone else already did. but I voted for Psilocybe caerulipes by The Thinker and vjp because that was an unusual psychoactive species and a beautiful photo.
I'm just making a a note about what gets nominated and how people tend to vote... Not angry, not sad, just observing.
jet li: Haha, yeah.. they are pretty huh? And they are worth money even without mushrooms on them. There is an urban legend from when I was a kid that you could pick them, dip them in lacquer and sell to Germans for about $1 a piece. I don't know if it actually ever happened but I know that german tourist in Sweden, traveling with their motor homes often have stickers of moose on them and seeing a moose on their vacation is like the best thing that could happen, and during the summer many moose warning signs along the roads get stolen by people loving this (for them) exotic animal. Moose dung might be an attractive souvenir...
*looking around a bit with google*
Oh... It's not an urban legend. Here is a key ring with moose dung http://files.marianova.com/files/imagecache/normal/files/3272/a519d3f698b4068178840983943a7d7c.jpg and why not invest in paper made from it? http://www.cariann-of-sweden.com/paper10_.html or this pair of lovely ear rings (not from Sweden but I read it is popular as souvenirs also) http://www.unforgettable-jewelry.com/columbiaSC/wp-content/uploads/2010/03/moose-poop.jpg
ahhhh no worries man , just fucking razzing ya! i loved thinkers beauty bluefoot pic and your Claviceps was amazing as well ! i was just lucky.that was just my first or second nomination EVER!!
NOW ABOUT THIS COOL MOOSE SHIT PAN !!! holy shit man, you find some really cool stuff !
and has anyone looked at your blueing Conocybes yet ? i would really love for you to confirm a Conocybe kuehneriana ! although they do look alot like my confirmed C cyanopus.
--------------------
|
FreshShrooms
Stranger
Registered: 03/23/09
Posts: 128
Last seen: 11 years, 7 months
|
Re: Panaeolus alcidis, a rare species on moose dung [Re: psylosymonreturns]
#15094638 - 09/18/11 05:17 AM (12 years, 6 months ago) |
|
|
Thanks for posting:)
|
rev0kadavur
Forager
Registered: 03/18/10
Posts: 1,199
Loc: Richmond & Beyond - California
Last seen: 4 years, 5 months
|
Re: Panaeolus alcidis, a rare species on moose dung [Re: FreshShrooms]
#15151856 - 09/29/11 09:22 AM (12 years, 6 months ago) |
|
|
Moose are my favorite! & these mushrooms are just adorable!
-------------------- - Question # Everything -
|
knarkkorven
Entheoholic
Registered: 06/22/05
Posts: 1,709
Loc: Sweden
Last seen: 7 minutes, 11 seconds
|
Re: Panaeolus alcidis, a rare species on moose dung [Re: rev0kadavur]
#15237924 - 10/17/11 10:58 AM (12 years, 6 months ago) |
|
|
Update with new photos.
Not fruting in big numbers anymore, but still som nice shots:
|
psylosymonreturns
aka Gym Sporrison
Registered: 10/16/09
Posts: 13,948
Loc: Mos Eisley,
Last seen: 3 years, 8 months
|
Re: Panaeolus alcidis, a rare species on moose dung [Re: knarkkorven]
#15237950 - 10/17/11 11:04 AM (12 years, 6 months ago) |
|
|
very cool knaark!! i found out they grow here too. gotta find me some moose shit!
--------------------
|
suchen
Once and Future Noob
Registered: 06/28/11
Posts: 8,841
Loc: Shangri-la
Last seen: 3 years, 4 months
|
Re: Panaeolus alcidis, a rare species on moose dung [Re: psylosymonreturns]
#15238029 - 10/17/11 11:25 AM (12 years, 6 months ago) |
|
|
-------------------- Rod Tulloss said: The bulb is the bulb. The volva is the volva. They have a very long term realtionship, but they’re “just friends.”
|
innerview
Dreamer
Registered: 08/16/11
Posts: 847
Loc: USA/Sweden
|
Re: Panaeolus alcidis, a rare species on moose dung [Re: suchen]
#15238073 - 10/17/11 11:35 AM (12 years, 6 months ago) |
|
|
Great images!!!
|
knarkkorven
Entheoholic
Registered: 06/22/05
Posts: 1,709
Loc: Sweden
Last seen: 7 minutes, 11 seconds
|
Re: Panaeolus alcidis, a rare species on moose dung [Re: innerview]
#15238209 - 10/17/11 12:07 PM (12 years, 6 months ago) |
|
|
Thanks!
|
MollyLucyMaryJane
Registered: 09/10/11
Posts: 1,302
|
Re: Panaeolus alcidis, a rare species on moose dung [Re: knarkkorven]
#15238338 - 10/17/11 12:34 PM (12 years, 6 months ago) |
|
|
Yes they r perty panaeolus, Are they active?
|
maynardjameskeenan
The white stipes
Registered: 11/11/10
Posts: 16,391
Loc: 'Merica
|
Re: Panaeolus alcidis, a rare species on moose dung [Re: MollyLucyMaryJane]
#15238742 - 10/17/11 02:22 PM (12 years, 6 months ago) |
|
|
Love the new pictures.
-------------------- May you be filled with loving kindness. May you be well. May you be peaceful and at ease. May you be happy. AMU Q&A
|
Alan Rockefeller
Mycologist
Registered: 03/10/07
Posts: 48,364
Last seen: 1 day, 16 hours
|
Re: Panaeolus alcidis, a rare species on moose dung (updated 17:th October with more photos) [Re: knarkkorven]
#15841159 - 02/21/12 03:34 AM (12 years, 1 month ago) |
|
|
Conclusion: It is Panaeolus alcis. All microscopic features match well. Molecular evidence says that this species is closely related to Panaeolus papilionaceus.
http://mushroomobserver.org/obs/88085
Panaeolus alcidis was declared invalid due to IBC Art. 36.1.
Cheilocystidia abundant. Pleurocystidia absent.
Spores (15.5) 17.0 - 19.3 (19.5) x (8.9) 9.0 - 10.2 (10.9) μm.
15.55 x 8.88 17.00 x 9.23 17.08 x 9.32 17.36 x 8.75 17.91 x 8.61 18.26 x 9.86 18.40 x 9.02 18.61 x 8.81 18.95 x 9.09 19.09 x 10.13 19.23 x 10.90 19.25 x 10.27 19.36 x 9.02 19.37 x 9.58 19.37 x 9.93 19.51 x 9.09
ITS1 sequence:
TATGATATGCTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGGTCAAATGGTTCAAGTTGTCCAAGTCAATGGACGGTT AGAAGCGGGGCAAACACCTTTTTACAGCAATCCTAGACCACGGCGTAGATAATTATCACACCAATAGATAGGTTTGCGCG GGGCACCCACTAATTCATTTGAGAGGAGCTGACCTTTCGGCCTGCAGAAACCTCCACATCCAAGCCATCATCACAAAAGC GATGAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCTTCGGAATACCAAAGAGCGCAAGGTGCGTTCAAAGATTC GATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCC GTTGCTGAAAGTTGTATATAGTTTATAGGCTTAGAGCCCATTGAATCGTTCTGTTACTTTCAATAGTGTATATGTATAAG CATAGGACCTGAACGTCAAGGAATTGCTTCCCTTCCCTCCAGACCTACAGTGTGTTCACAGGTGGAAAAACAAAAAAGGT AAGGCGTGCACAGTTCCCCCGAGAGGGACAGCAACAACCCACCCAGTTTATTCGATAATGATCCTTCCGCAGGTCACCTA CGGAAACCTTGTTACGACTTTTACTTCCTCTAA
BLAST matches:
Panaeolus sphinctrinus isolate AFTOL-ID 1499 18S ribosomal RNA gene from Worcester, PA - 99% query coverage, 99% match Panaeolus campanulatus voucher 10141 18S ribosomal RNA gene from Italy - 96% query coverage, 99% match Panaeolus rickenii voucher 12446 18S ribosomal RNA gene from Italy - 96% query coverage, 99% match
If you want to compare the DNA, it is very easy. Go to neucleotide blast, paste the sequence into the Query Sequence window, for the database select Neucleotide sequence (nr/nt) and press BLAST.
Cheilocystidia
Spores 1000x
|
fux234
Woodgnome
Registered: 09/22/10
Posts: 1,198
Loc: Westwood
Last seen: 5 years, 4 months
|
Re: Panaeolus alcidis, a rare species on moose dung (updated 17:th October with more photos) [Re: Alan Rockefeller]
#15841809 - 02/21/12 09:27 AM (12 years, 1 month ago) |
|
|
again great work Alan!
-------------------- "Carpe diem!" P.Semilanceata Germany
|
swampyAppleseed
Friendliest kid you ever met
Registered: 06/23/11
Posts: 1,124
Last seen: 5 years, 1 month
|
Re: Panaeolus alcidis, a rare species on moose dung (updated 17:th October with more photos) [Re: fux234]
#15841866 - 02/21/12 09:46 AM (12 years, 1 month ago) |
|
|
that's awesome!
-------------------- A little nonsense now and then, is relished by the wisest men
|
lowbrow
Paddy Time!!!!
Registered: 09/12/08
Posts: 9,809
Last seen: 6 hours, 11 minutes
|
Re: Panaeolus alcidis, a rare species on moose dung (updated 17:th October with more photos) [Re: swampyAppleseed]
#15842223 - 02/21/12 11:26 AM (12 years, 1 month ago) |
|
|
Active?
-------------------- Amanita86 said: Sui is trying to mod right now. Kinda like a newborn calf tryin ta stand fer the first time ain’t it..
|
NeoSporen
Antibiotic cream
Registered: 09/05/09
Posts: 4,265
Loc: Graham, WA
Last seen: 3 months, 20 days
|
Re: Panaeolus alcidis, a rare species on moose dung (updated 17:th October with more photos) [Re: lowbrow]
#15842319 - 02/21/12 11:53 AM (12 years, 1 month ago) |
|
|
Awesome work Alan.
-------------------- Having lived through an existence close to nature, one accepts the small and simple things as most important in life. Sun, wind, rain and snow. The sounds birds make, smells of fresh wild flowers. Love of all kinds, from friends and family, thy self and our neighbors. Beautiful sunrises to the darkest clouds dancing above in the sky. To forgive, learn, share and express. This is the only thing a man such as myself can ask for. What comes as the result is nothing short of the core of human existence, to truly live free in body and mind.
|
knarkkorven
Entheoholic
Registered: 06/22/05
Posts: 1,709
Loc: Sweden
Last seen: 7 minutes, 11 seconds
|
Re: Panaeolus alcidis, a rare species on moose dung (updated 17:th October with more photos) [Re: NeoSporen]
#15842843 - 02/21/12 02:01 PM (12 years, 1 month ago) |
|
|
Great work again! Alan rocks!
lowbrow: unfortunately it's probably not active.
|
Alan Rockefeller
Mycologist
Registered: 03/10/07
Posts: 48,364
Last seen: 1 day, 16 hours
|
Re: Panaeolus alcidis, a rare species on moose dung (updated 17:th October with more photos) [Re: lowbrow]
#15846209 - 02/22/12 05:35 AM (12 years, 1 month ago) |
|
|
Quote:
lowbrow said: Active?
No.
No blue staining and it is very closely related to other inactive Panaeolus species.
|
Alan Rockefeller
Mycologist
Registered: 03/10/07
Posts: 48,364
Last seen: 1 day, 16 hours
|
Re: Panaeolus alcidis, a rare species on moose dung (updated 17:th October with more photos) [Re: Alan Rockefeller]
#20997362 - 12/19/14 01:51 AM (9 years, 3 months ago) |
|
|
This collection is now in GenBank - KM982723. http://www.ncbi.nlm.nih.gov/nuccore/726965694. It isn't the first collection from shroomery to end up in GenBank, but it is the first one I personally submitted. Many more to follow.
While Gerhardt 1996 places this in __Panaeolus__ section __Laevispora__, ITS sequencing shows that this species has a close affinity to _Panaeolus papilionaceus_, which is in Panaeolus section Panaeolus.
Here is a phylogenetic tree that highlights the position of Panaeolus alcis:
|
|