Home | Community | Message Board


Mushrooms.com
Please support our sponsors.

Mushrooms, Mycology and Psychedelics >> Mushroom Hunting and Identification

Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Amazon Shop for: Microscope

Jump to first unread post. Pages: 1 | 2 | 3  [ show all ]
Offlineknarkkorven
Entheoholic
Male User Gallery

Registered: 06/22/05
Posts: 1,326
Loc: Sweden Flag
Last seen: 22 days, 13 hours
Panaeolus alcidis, a rare species on moose dung (updated Feb 21 with microscope photos) * 3
    #15086859 - 09/16/11 01:10 PM (5 years, 7 months ago)

This is what I think is Panaeolus alcidis. Growing in huge numbers from moose dung in Sweden. Only known from Scandinavia and Canada.

See http://www.jstor.org/pss/3793340 for references
and http://www.myra.nu/SmyraSG-3180.html for another photo.




Edited by knarkkorven (02/21/12 04:03 PM)


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineMysterious
Shroomgu
 User Gallery


Registered: 10/31/10
Posts: 137
Loc: Tacoma, Washington
Last seen: 3 months, 26 days
Re: Panaeolus alcidis, a rare species on moose dung [Re: knarkkorven]
    #15086952 - 09/16/11 01:28 PM (5 years, 7 months ago)

Very cool!
Interesting looking mushrooms.


--------------------
Just remember, life will PREVAIL.






Post Extras: Print Post  Remind Me! Notify Moderator
Offlinesuchen
Once and Future Noob
Male User Gallery


Registered: 06/28/11
Posts: 8,835
Loc: Shangri-la
Last seen: 1 year, 9 days
Trusted Identifier
Re: Panaeolus alcidis, a rare species on moose dung [Re: Mysterious]
    #15086997 - 09/16/11 01:37 PM (5 years, 7 months ago)

:bow2:  Whatever those are, your shots of them are stunning!


--------------------
Rod Tulloss said:

The bulb is the bulb.

The volva is the volva.

They have a very long term realtionship, but they’re “just friends.”


Post Extras: Print Post  Remind Me! Notify Moderator
Invisibleinnerview
Dreamer
Male User Gallery

Registered: 08/16/11
Posts: 846
Loc: USA/Sweden Flag
Re: Panaeolus alcidis, a rare species on moose dung [Re: suchen]
    #15087043 - 09/16/11 01:50 PM (5 years, 7 months ago)



THAT is a a great image!!! :super:  POTM nominated!


Post Extras: Print Post  Remind Me! Notify Moderator
Offlineknarkkorven
Entheoholic
Male User Gallery

Registered: 06/22/05
Posts: 1,326
Loc: Sweden Flag
Last seen: 22 days, 13 hours
Re: Panaeolus alcidis, a rare species on moose dung [Re: innerview]
    #15087127 - 09/16/11 02:09 PM (5 years, 7 months ago)

Thanks! :sunny:

here is three more. I think you will like the last one.



Post Extras: Print Post  Remind Me! Notify Moderator
OfflineBothHands
Dog Coffee
Female User Gallery


Registered: 10/28/09
Posts: 13,172
Loc: Flag
Last seen: 4 months, 20 hours
Re: Panaeolus alcidis, a rare species on moose dung [Re: knarkkorven]
    #15087135 - 09/16/11 02:11 PM (5 years, 7 months ago)

Are they psychoactive?

Nice pictures.

I voted for your claviceps last POTM :biggrin:


Post Extras: Print Post  Remind Me! Notify Moderator
Invisibleinnerview
Dreamer
Male User Gallery

Registered: 08/16/11
Posts: 846
Loc: USA/Sweden Flag
Re: Panaeolus alcidis, a rare species on moose dung [Re: knarkkorven]
    #15087158 - 09/16/11 02:16 PM (5 years, 7 months ago)

yep... that is great! I love the little ones that are slumping over.

now it's a tough call... which of those two do you like better?


Post Extras: Print Post  Remind Me! Notify Moderator
Offlineknarkkorven
Entheoholic
Male User Gallery

Registered: 06/22/05
Posts: 1,326
Loc: Sweden Flag
Last seen: 22 days, 13 hours
Re: Panaeolus alcidis, a rare species on moose dung [Re: BothHands]
    #15087196 - 09/16/11 02:27 PM (5 years, 7 months ago)

innerview:

The one in the first post. hmm.. or is it.. I don't know.

BothHands:

I don't think they ever have been analyzed, but I don't think so, because they are close related to the inactives.

Thanks for the vote :wink: I thought I had a rare enough photo there (claviceps purpurea stroma) to have an easy victory, or at least top 3, but it's often photos with colorful mushrooms or blurry photos (macro with low f-value) that attract peoples feelings and get more votes... I'm not complaining now, just making a note of users behavior.

I didn't think I would get nominated for this.. is highly random, not predictable. I thought this one of my c. cyanopus would get nominated, but apparently everyone missed it :smile:


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleThe Thinker

Registered: 09/01/10
Posts: 3,999
Re: Panaeolus alcidis, a rare species on moose dung [Re: knarkkorven]
    #15087209 - 09/16/11 02:31 PM (5 years, 7 months ago)

great find and photos knark. this is one ive been hoping to see in Maine


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleThe Thinker

Registered: 09/01/10
Posts: 3,999
Re: Panaeolus alcidis, a rare species on moose dung [Re: The Thinker]
    #15087255 - 09/16/11 02:41 PM (5 years, 7 months ago)

do you have the means necessary to post micro photos?


Post Extras: Print Post  Remind Me! Notify Moderator
Offlineknarkkorven
Entheoholic
Male User Gallery

Registered: 06/22/05
Posts: 1,326
Loc: Sweden Flag
Last seen: 22 days, 13 hours
Re: Panaeolus alcidis, a rare species on moose dung [Re: The Thinker]
    #15087300 - 09/16/11 02:51 PM (5 years, 7 months ago)

Thanks. No, I and didn't collect any samples. If the interest is great enough from the community, perhaps I'll do it and mail it.


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineBothHands
Dog Coffee
Female User Gallery


Registered: 10/28/09
Posts: 13,172
Loc: Flag
Last seen: 4 months, 20 hours
Re: Panaeolus alcidis, a rare species on moose dung [Re: knarkkorven]
    #15087317 - 09/16/11 02:54 PM (5 years, 7 months ago)

It just depends on people.  There were some beautiful pictures there, and I had a hard time making my choice.  In the end, I voted for the claviceps for the reasons you mentioned.  But some of the others were "prettier."  The one that did win was also an incredible picture, and it was my second choice.


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineGrova
Forte Fungus
Other


Registered: 05/03/11
Posts: 629
Last seen: 2 months, 14 days
Re: Panaeolus alcidis, a rare species on moose dung [Re: knarkkorven]
    #15087319 - 09/16/11 02:55 PM (5 years, 7 months ago)

Those are cool!
The pictures and mushrooms.

Very sleek & bold looking mushrooms.

Great findings my friend!


--------------------


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleThe Lightning
Mycology Enthusiast
 User Gallery

Registered: 09/06/11
Posts: 3,889
Re: Panaeolus alcidis, a rare species on moose dung [Re: knarkkorven]
    #15087389 - 09/16/11 03:11 PM (5 years, 7 months ago)

Thank you for showing these images to us. I've never heard of this species.


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinepsylosymonreturns
aka Gym Sporrison
Male


Registered: 10/16/09
Posts: 13,946
Loc: Mos Eisley,
Last seen: 5 months, 19 days
Re: Panaeolus alcidis, a rare species on moose dung [Re: The Lightning]
    #15088469 - 09/16/11 07:04 PM (5 years, 7 months ago)

thanks for dissing my pic. :thumbdown:


--------------------


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinepiggy
Sausage

Registered: 02/08/09
Posts: 141
Last seen: 2 years, 3 months
Re: Panaeolus alcidis, a rare species on moose dung [Re: psylosymonreturns]
    #15089084 - 09/16/11 09:38 PM (5 years, 7 months ago)

Quote:

psylosymonreturns said:
thanks for dissing my pic. :thumbdown:




Who dissed what pic???


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineBothHands
Dog Coffee
Female User Gallery


Registered: 10/28/09
Posts: 13,172
Loc: Flag
Last seen: 4 months, 20 hours
Re: Panaeolus alcidis, a rare species on moose dung [Re: knarkkorven]
    #15089096 - 09/16/11 09:41 PM (5 years, 7 months ago)

Quote:

knarkkorven said:
or at least top 3, but it's often photos with colorful mushrooms or blurry photos (macro with low f-value) that attract peoples feelings and get more votes...




Here ^

But I'd probably be a bit sore if I lost with that claviceps picture too.  It's something that might never come around here again.  It was definitely a worthy picture.

But psylosymon's picture was also amazing, and he won a fair vote.  It was also a picture worth winning.


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinejet li
The One
Male User Gallery


Registered: 07/09/07
Posts: 3,953
Loc: penis double yew
Last seen: 5 months, 30 days
Re: Panaeolus alcidis, a rare species on moose dung [Re: BothHands]
    #15089631 - 09/16/11 11:58 PM (5 years, 7 months ago)

send me that poo I wanna trip balz  :smirk:


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineMollyLucyMaryJane
MlMj
Male Arcade Champion: Beermat, Disc Dash, Smack the Rabbit, Space Hunter, Typing Test


Registered: 09/11/11
Posts: 1,193
Last seen: 25 days, 11 hours
Re: Panaeolus alcidis, a rare species on moose dung [Re: jet li]
    #15090192 - 09/17/11 02:45 AM (5 years, 7 months ago)

Beautiful pics of a rare species, thanks for sharing =)


Post Extras: Print Post  Remind Me! Notify Moderator
Offlineknarkkorven
Entheoholic
Male User Gallery

Registered: 06/22/05
Posts: 1,326
Loc: Sweden Flag
Last seen: 22 days, 13 hours
Re: Panaeolus alcidis, a rare species on moose dung [Re: MollyLucyMaryJane]
    #15090314 - 09/17/11 03:40 AM (5 years, 7 months ago)

psylosymonreturns: No, I'm not dissing it. :frown: I actually liked it very much and was about to nominate it (or another picture in that series) but saw that someone else already did. but I voted for Psilocybe caerulipes by The Thinker and vjp because that was an unusual psychoactive species and a beautiful photo.

I'm just making a a note about what gets nominated and how people tend to vote... Not angry, not sad, just observing. :wink:

jet li: Haha, yeah.. they are pretty huh? And they are worth money even without mushrooms on them. There is an urban legend from when I was a kid that you could pick them, dip them in lacquer and sell to Germans for about $1 a piece. I don't know if it actually ever happened but I know that german tourist in Sweden, traveling with their motor homes often have stickers of moose on them and seeing a moose on their vacation is like the best thing that could happen, and during the summer many moose warning signs along the roads get stolen by people loving this (for them) exotic animal. Moose dung might be an attractive souvenir... :smile:

*looking around a bit with google*

Oh... It's not an urban legend. Here is a key ring with moose dung :laugh:
http://files.marianova.com/files/imagecache/normal/files/3272/a519d3f698b4068178840983943a7d7c.jpg
and why not invest in paper made from it?
http://www.cariann-of-sweden.com/paper10_.html
or this pair of lovely ear rings (not from Sweden but I read it is popular as souvenirs also)
http://www.unforgettable-jewelry.com/columbiaSC/wp-content/uploads/2010/03/moose-poop.jpg


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineOboy
Psychonaut
Male User Gallery


Registered: 05/03/11
Posts: 530
Loc: Sweden Flag
Last seen: 4 years, 5 months
Re: Panaeolus alcidis, a rare species on moose dung [Re: knarkkorven]
    #15090575 - 09/17/11 06:34 AM (5 years, 7 months ago)

Really beautiful photos as always knarkkorven!

I haven't seen those souvenirs before, but i there was a site were you could order plain moose spillings by weight... What do you say there are people for everything.
:urreallydumb:


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleBobzimmer
Crawlin' Kingsnake
 User Gallery

Registered: 09/07/08
Posts: 8,694
Loc: NY
Trusted Identifier
Re: Panaeolus alcidis, a rare species on moose dung [Re: Oboy]
    #15090865 - 09/17/11 09:43 AM (5 years, 7 months ago)

Very cool species, Knark! Moose get more and more common here (in the spring)...maybe I have a shot at finding this.:shrug:


--------------------
Mr. Mushrooms said:
I will confess something that should be quite obvious, CC.  I love mushrooms, i.e. fungi.  I really do.  I am talking about a strong feeling, i.e. emotion, for them.  I think they are beautiful.  I even dream of them.


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinepsylosymonreturns
aka Gym Sporrison
Male


Registered: 10/16/09
Posts: 13,946
Loc: Mos Eisley,
Last seen: 5 months, 19 days
Re: Panaeolus alcidis, a rare species on moose dung [Re: knarkkorven]
    #15094171 - 09/18/11 01:48 AM (5 years, 7 months ago)

Quote:

knarkkorven said:
psylosymonreturns: No, I'm not dissing it. :frown: I actually liked it very much and was about to nominate it (or another picture in that series) but saw that someone else already did. but I voted for Psilocybe caerulipes by The Thinker and vjp because that was an unusual psychoactive species and a beautiful photo.

I'm just making a a note about what gets nominated and how people tend to vote... Not angry, not sad, just observing. :wink:

jet li: Haha, yeah.. they are pretty huh? And they are worth money even without mushrooms on them. There is an urban legend from when I was a kid that you could pick them, dip them in lacquer and sell to Germans for about $1 a piece. I don't know if it actually ever happened but I know that german tourist in Sweden, traveling with their motor homes often have stickers of moose on them and seeing a moose on their vacation is like the best thing that could happen, and during the summer many moose warning signs along the roads get stolen by people loving this (for them) exotic animal. Moose dung might be an attractive souvenir... :smile:

*looking around a bit with google*

Oh... It's not an urban legend. Here is a key ring with moose dung :laugh:
http://files.marianova.com/files/imagecache/normal/files/3272/a519d3f698b4068178840983943a7d7c.jpg
and why not invest in paper made from it?
http://www.cariann-of-sweden.com/paper10_.html
or this pair of lovely ear rings (not from Sweden but I read it is popular as souvenirs also)
http://www.unforgettable-jewelry.com/columbiaSC/wp-content/uploads/2010/03/moose-poop.jpg





ahhhh no worries man , just fucking razzing ya! :lol: i loved thinkers beauty bluefoot pic and your Claviceps was amazing as well ! i was just lucky.that was just my first or second nomination EVER!! :cheers:

NOW ABOUT THIS COOL MOOSE SHIT PAN !!! holy shit man, you find some really cool stuff !

and has anyone looked at your blueing Conocybes yet ? i would really love for you to confirm a Conocybe kuehneriana ! :headbanger: although they do look alot like my confirmed C cyanopus.


--------------------


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineFreshShrooms
Stranger
 User Gallery

Registered: 03/23/09
Posts: 128
Last seen: 4 years, 8 months
Re: Panaeolus alcidis, a rare species on moose dung [Re: psylosymonreturns]
    #15094638 - 09/18/11 07:17 AM (5 years, 7 months ago)

Thanks for posting:)


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinerev0kadavur
Forager
Female User Gallery


Registered: 03/18/10
Posts: 1,199
Loc: Richmond & Beyond - California Flag
Last seen: 1 year, 2 months
Re: Panaeolus alcidis, a rare species on moose dung [Re: FreshShrooms]
    #15151856 - 09/29/11 11:22 AM (5 years, 6 months ago)

Moose are my favorite! & these mushrooms are just adorable!


--------------------
- Question # Everything -



Post Extras: Print Post  Remind Me! Notify Moderator
Offlineknarkkorven
Entheoholic
Male User Gallery

Registered: 06/22/05
Posts: 1,326
Loc: Sweden Flag
Last seen: 22 days, 13 hours
Re: Panaeolus alcidis, a rare species on moose dung [Re: rev0kadavur]
    #15237924 - 10/17/11 12:58 PM (5 years, 6 months ago)

Update with new photos.

Not fruting in big numbers anymore, but still som nice shots:



Post Extras: Print Post  Remind Me! Notify Moderator
Offlinepsylosymonreturns
aka Gym Sporrison
Male


Registered: 10/16/09
Posts: 13,946
Loc: Mos Eisley,
Last seen: 5 months, 19 days
Re: Panaeolus alcidis, a rare species on moose dung [Re: knarkkorven]
    #15237950 - 10/17/11 01:04 PM (5 years, 6 months ago)

very cool knaark!! i found out they grow here too. gotta find me some moose shit! :smile:


--------------------


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinesuchen
Once and Future Noob
Male User Gallery


Registered: 06/28/11
Posts: 8,835
Loc: Shangri-la
Last seen: 1 year, 9 days
Trusted Identifier
Re: Panaeolus alcidis, a rare species on moose dung [Re: psylosymonreturns]
    #15238029 - 10/17/11 01:25 PM (5 years, 6 months ago)

:mustnotfap:


--------------------
Rod Tulloss said:

The bulb is the bulb.

The volva is the volva.

They have a very long term realtionship, but they’re “just friends.”


Post Extras: Print Post  Remind Me! Notify Moderator
Invisibleinnerview
Dreamer
Male User Gallery

Registered: 08/16/11
Posts: 846
Loc: USA/Sweden Flag
Re: Panaeolus alcidis, a rare species on moose dung [Re: suchen]
    #15238073 - 10/17/11 01:35 PM (5 years, 6 months ago)

:super: Great images!!!


Post Extras: Print Post  Remind Me! Notify Moderator
Offlineknarkkorven
Entheoholic
Male User Gallery

Registered: 06/22/05
Posts: 1,326
Loc: Sweden Flag
Last seen: 22 days, 13 hours
Re: Panaeolus alcidis, a rare species on moose dung [Re: innerview]
    #15238209 - 10/17/11 02:07 PM (5 years, 6 months ago)

Thanks!


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineMollyLucyMaryJane
MlMj
Male Arcade Champion: Beermat, Disc Dash, Smack the Rabbit, Space Hunter, Typing Test


Registered: 09/11/11
Posts: 1,193
Last seen: 25 days, 11 hours
Re: Panaeolus alcidis, a rare species on moose dung [Re: knarkkorven]
    #15238338 - 10/17/11 02:34 PM (5 years, 6 months ago)

Yes they r perty panaeolus, Are they active?


Post Extras: Print Post  Remind Me! Notify Moderator
Invisiblemaynardjameskeenan
The white stipes
Male


Folding@home Statistics
Registered: 11/11/10
Posts: 16,309
Loc: 'Merica
Trusted Identifier
Re: Panaeolus alcidis, a rare species on moose dung [Re: MollyLucyMaryJane]
    #15238742 - 10/17/11 04:22 PM (5 years, 6 months ago)

:banana: :congrats: Love the new pictures.


--------------------
May you be filled with loving kindness.
May you be well.
May you be peaceful and at ease.
May you be happy.



AMU Q&A


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery

Registered: 03/10/07
Posts: 42,885
Last seen: 1 day, 10 hours
Trusted Identifier
Re: Panaeolus alcidis, a rare species on moose dung (updated 17:th October with more photos) [Re: knarkkorven]
    #15841159 - 02/21/12 05:34 AM (5 years, 2 months ago)

Conclusion:  It is Panaeolus alcis.  All microscopic features match well.  Molecular evidence says that this species is closely related to Panaeolus papilionaceus.

http://mushroomobserver.org/obs/88085

Panaeolus alcidis was declared invalid due to IBC Art. 36.1.

Cheilocystidia abundant.  Pleurocystidia absent.

Spores (15.5) 17.0 - 19.3 (19.5) x (8.9) 9.0 - 10.2 (10.9) μm.

15.55 x 8.88
17.00 x 9.23
17.08 x 9.32
17.36 x 8.75
17.91 x 8.61
18.26 x 9.86
18.40 x 9.02
18.61 x 8.81
18.95 x 9.09
19.09 x 10.13
19.23 x 10.90
19.25 x 10.27
19.36 x 9.02
19.37 x 9.58
19.37 x 9.93
19.51 x 9.09


ITS1 sequence:

TATGATATGCTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGGTCAAATGGTTCAAGTTGTCCAAGTCAATGGACGGTT
AGAAGCGGGGCAAACACCTTTTTACAGCAATCCTAGACCACGGCGTAGATAATTATCACACCAATAGATAGGTTTGCGCG
GGGCACCCACTAATTCATTTGAGAGGAGCTGACCTTTCGGCCTGCAGAAACCTCCACATCCAAGCCATCATCACAAAAGC
GATGAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCTTCGGAATACCAAAGAGCGCAAGGTGCGTTCAAAGATTC
GATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCC
GTTGCTGAAAGTTGTATATAGTTTATAGGCTTAGAGCCCATTGAATCGTTCTGTTACTTTCAATAGTGTATATGTATAAG
CATAGGACCTGAACGTCAAGGAATTGCTTCCCTTCCCTCCAGACCTACAGTGTGTTCACAGGTGGAAAAACAAAAAAGGT
AAGGCGTGCACAGTTCCCCCGAGAGGGACAGCAACAACCCACCCAGTTTATTCGATAATGATCCTTCCGCAGGTCACCTA
CGGAAACCTTGTTACGACTTTTACTTCCTCTAA

BLAST matches:

Panaeolus sphinctrinus isolate AFTOL-ID 1499 18S ribosomal RNA gene from Worcester, PA - 99% query coverage, 99% match
Panaeolus campanulatus voucher 10141 18S ribosomal RNA gene from Italy - 96% query coverage, 99% match
Panaeolus rickenii voucher 12446 18S ribosomal RNA gene from Italy - 96% query coverage, 99% match


If you want to compare the DNA, it is very easy.  Go to neucleotide blast, paste the sequence into the Query Sequence window, for the database select Neucleotide sequence (nr/nt) and press BLAST.

Cheilocystidia



Spores 1000x



Post Extras: Print Post  Remind Me! Notify Moderator
Offlinefux234
Woodgnome
Male User Gallery


Registered: 09/22/10
Posts: 1,198
Loc: Westwood
Last seen: 14 days, 45 minutes
Re: Panaeolus alcidis, a rare species on moose dung (updated 17:th October with more photos) [Re: Alan Rockefeller]
    #15841809 - 02/21/12 11:27 AM (5 years, 2 months ago)

:congrats:
again great work Alan!


--------------------
"Carpe diem!"

P.Semilanceata  Germany




Post Extras: Print Post  Remind Me! Notify Moderator
OfflineswampyAppleseed
Friendliest kid you ever met
 User Gallery


Registered: 06/23/11
Posts: 1,116
Last seen: 3 days, 5 hours
Re: Panaeolus alcidis, a rare species on moose dung (updated 17:th October with more photos) [Re: fux234]
    #15841866 - 02/21/12 11:46 AM (5 years, 2 months ago)

that's awesome!


--------------------
A little nonsense now and then, is relished by the wisest men


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinelowbrow
crazy fucker
Male User Gallery

Registered: 09/12/08
Posts: 2,383
Last seen: 1 day, 12 hours
Re: Panaeolus alcidis, a rare species on moose dung (updated 17:th October with more photos) [Re: swampyAppleseed]
    #15842223 - 02/21/12 01:26 PM (5 years, 2 months ago)

Active?


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineNeoSporen
Antibiotic cream
Male User Gallery


Registered: 09/05/09
Posts: 4,137
Loc: Washington State Flag
Last seen: 1 month, 4 days
Re: Panaeolus alcidis, a rare species on moose dung (updated 17:th October with more photos) [Re: lowbrow]
    #15842319 - 02/21/12 01:53 PM (5 years, 2 months ago)

:murray: Awesome work Alan.


--------------------
Having lived through an existence close to nature, one accepts the small and simple things as most important in life. Sun, wind, rain and snow. The sounds birds make, smells of fresh wild flowers. Love of all kinds, from friends and family, thy self and our neighbors. Beautiful sunrises to the darkest clouds dancing above in the sky. To forgive, learn, share and express. This is the only thing a man such as myself can ask for. What comes as the result is nothing short of the core of human existence, to truly live free in body and mind.


Post Extras: Print Post  Remind Me! Notify Moderator
Offlineknarkkorven
Entheoholic
Male User Gallery

Registered: 06/22/05
Posts: 1,326
Loc: Sweden Flag
Last seen: 22 days, 13 hours
Re: Panaeolus alcidis, a rare species on moose dung (updated 17:th October with more photos) [Re: NeoSporen]
    #15842843 - 02/21/12 04:01 PM (5 years, 2 months ago)

Great work again! Alan rocks! :thumbup:

lowbrow: unfortunately it's probably not active.


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery

Registered: 03/10/07
Posts: 42,885
Last seen: 1 day, 10 hours
Trusted Identifier
Re: Panaeolus alcidis, a rare species on moose dung (updated 17:th October with more photos) [Re: lowbrow]
    #15846209 - 02/22/12 07:35 AM (5 years, 2 months ago)

Quote:

lowbrow said:
Active?





No.

No blue staining and it is very closely related to other inactive Panaeolus species.


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery

Registered: 03/10/07
Posts: 42,885
Last seen: 1 day, 10 hours
Trusted Identifier
Re: Panaeolus alcidis, a rare species on moose dung (updated 17:th October with more photos) [Re: Alan Rockefeller]
    #20997362 - 12/19/14 03:51 AM (2 years, 4 months ago)

This collection is now in GenBank - KM982723.    http://www.ncbi.nlm.nih.gov/nuccore/726965694.  It isn't the first collection from shroomery to end up in GenBank, but it is the first one I personally submitted.  Many more to follow.

While Gerhardt 1996 places this in __Panaeolus__ section __Laevispora__, ITS sequencing shows that this species has a close affinity to _Panaeolus papilionaceus_, which is in Panaeolus section Panaeolus.

Here is a phylogenetic tree that highlights the position of Panaeolus alcis:





Post Extras: Print Post  Remind Me! Notify Moderator
OfflineAnglerfish
boleting
Male User Gallery


Registered: 09/08/10
Posts: 8,574
Loc: Norvegr Flag
Last seen: 1 day, 4 hours
Trusted Identifier
Re: Panaeolus alcidis, a rare species on moose dung (updated 17:th October with more photos) [Re: Alan Rockefeller]
    #20997402 - 12/19/14 04:12 AM (2 years, 4 months ago)

Quote:

Alan Rockefeller said:
While Gerhardt 1996 places this in __Panaeolus__ section __Laevispora__, ITS sequencing shows that this species has a close affinity to _Panaeolus papilionaceus_, which is in Panaeolus section Panaeolus.





How close are the two?

Could perhaps the situation be similar with Protostropharia semiglobata and Protostropharia alcis?


--------------------


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery

Registered: 03/10/07
Posts: 42,885
Last seen: 1 day, 10 hours
Trusted Identifier
Re: Panaeolus alcidis, a rare species on moose dung (updated 17:th October with more photos) [Re: Anglerfish]
    #20997417 - 12/19/14 04:18 AM (2 years, 4 months ago)

The closest P. papilionaceus sequence is two base pairs different.  There are a few species going under the name Panaeolus papilionaceus - some are 15 base pairs away.    To see the alignments, click on the link to Panaeolus alcis and then click Run BLAST from the sidebar on the right.


Post Extras: Print Post  Remind Me! Notify Moderator
Offlineknarkkorven
Entheoholic
Male User Gallery

Registered: 06/22/05
Posts: 1,326
Loc: Sweden Flag
Last seen: 22 days, 13 hours
Re: Panaeolus alcidis, a rare species on moose dung (updated 17:th October with more photos) [Re: Alan Rockefeller] * 1
    #20997428 - 12/19/14 04:23 AM (2 years, 4 months ago)

Nice to see that the mushrooms from this collection had some scientific value :smile:


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineAlan RockefellerM
Mycologist
Male User Gallery

Registered: 03/10/07
Posts: 42,885
Last seen: 1 day, 10 hours
Trusted Identifier
Re: Panaeolus alcidis, a rare species on moose dung (updated 17:th October with more photos) [Re: knarkkorven]
    #20997432 - 12/19/14 04:27 AM (2 years, 4 months ago)

They will have even more scientific value if I can find the collection and deposit it in a herbarium.  I am not very hopeful though, a grocery bag full of interesting collections hasn't been seen since my last move.  Let me know if you are able to recollect.


Post Extras: Print Post  Remind Me! Notify Moderator
Offlineknarkkorven
Entheoholic
Male User Gallery

Registered: 06/22/05
Posts: 1,326
Loc: Sweden Flag
Last seen: 22 days, 13 hours
Re: Panaeolus alcidis, a rare species on moose dung (updated 17:th October with more photos) [Re: Alan Rockefeller]
    #20997484 - 12/19/14 04:51 AM (2 years, 4 months ago)

I will collect some next year.

I will also start collecting other Panaeolus species. The genus is a mess when it comes to spinchtrinus/papilionaceus/campanulatus/rickenii/etc.


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineAnglerfish
boleting
Male User Gallery


Registered: 09/08/10
Posts: 8,574
Loc: Norvegr Flag
Last seen: 1 day, 4 hours
Trusted Identifier
Re: Panaeolus alcidis, a rare species on moose dung (updated 17:th October with more photos) [Re: knarkkorven]
    #20997495 - 12/19/14 04:59 AM (2 years, 4 months ago)

Quote:

knarkkorven said:
I will collect some next year.




I guess you'll be able to find them more or less year round? Obviously as long as it isn't heavy frost and lots of snow...


--------------------


Post Extras: Print Post  Remind Me! Notify Moderator
Offlineknarkkorven
Entheoholic
Male User Gallery

Registered: 06/22/05
Posts: 1,326
Loc: Sweden Flag
Last seen: 22 days, 13 hours
Re: Panaeolus alcidis, a rare species on moose dung (updated 17:th October with more photos) [Re: Anglerfish]
    #20997559 - 12/19/14 05:35 AM (2 years, 4 months ago)

No, from my experience the season is actually just a few weeks long. (and this is a place where elk dung is found every 10 meters).
Just like most other mushrooms I guess.... :wink:


Edited by knarkkorven (12/19/14 05:36 AM)


Post Extras: Print Post  Remind Me! Notify Moderator
Jump to top. Pages: 1 | 2 | 3  [ show all ]

Amazon Shop for: Microscope

Mushrooms, Mycology and Psychedelics >> Mushroom Hunting and Identification

Similar ThreadsPosterViewsRepliesLast post
* agarics a monster and very rare species bmarley3434 1,305 11 10/25/04 06:10 PM
by MushroomFriend
* NEW - 350 Photos of 4 Copelandia Species From Various Origins mjshroomer 1,808 8 03/14/05 06:07 PM
by LouiseLouise
* Which edible mushrooms can be found in pastures/dung?
( 1 2 all )
megaman3 13,922 30 02/09/04 07:33 AM
by joe_millionaire
* Unknown Psilocybe species - Colima, Mexico Alan RockefellerM 3,794 14 01/29/09 02:10 PM
by Mr. Mushrooms
* ID found in cow dung Odins Mushroom 1,151 14 05/11/13 07:37 PM
by Alan Rockefeller
* Pictures - Assorted mushsrooms on a horse dung compose pile live_for 2,136 4 06/04/04 04:33 PM
by mjshroomer
* Panaeolus species (maybe 3 differnet ones?) from tropical Asia (pics)
( 1 2 all )
Asianbuffalo 2,060 25 05/07/12 03:31 PM
by Asianbuffalo
* if you wish so strong,it will become real. new specie or a new begginig
( 1 2 all )
cactu 2,916 21 08/19/07 10:05 AM
by World Spirit

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: ToxicMan, karode13, inski, Alan Rockefeller, TimmiT, Joust, Tmethyl
6,210 topic views. 13 members, 48 guests and 10 web crawlers are browsing this forum.
[ Toggle Favorite | Print Topic | Stats ]
Search this thread:
MRCA Tyroler Gluckspilze
Please support our sponsors.

Copyright 1997-2017 Mind Media. Some rights reserved.

Generated in 0.11 seconds spending 0.004 seconds on 13 queries.