Home | Community | Message Board

Magic Mushrooms Zamnesia
This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Kraken Kratom Red Vein Kratom   Original Sensible Seeds Bulk Cannabis Seeds   Left Coast Kratom Buy Kratom Extract   MagicBag.co All-In-One Bags That Don't Suck   North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   Mushroom-Hut Mono Tub Substrate   Myyco.com Isolated Cubensis Liquid Culture For Sale   PhytoExtractum Kratom Powder for Sale

Jump to first unread post Pages: 1 | 2 | 3 | 4  [ show all ]
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
Offlineknarkkorven
Entheoholic
Male User Gallery

Registered: 06/22/05
Posts: 1,709
Loc: Sweden Flag
Last seen: 22 days, 3 hours
Conocybe cyanopus (or smithii). Updated with microscope photos and more photos Feb 22,
    #14895064 - 08/09/11 09:19 AM (12 years, 8 months ago)

last year, at my best liberty cap spot (and I mean best, check this out) I found lots of conocybe in the same habitat. I suspected them to be an active conocybe but they didn't stain blue so I ignored them, I didn't look very close at the bases over time... But today, when I was there to look for liberty caps (which I found BTW, some as close as 20cm from the conocybe) there was more conocybe than psilocybe. At first, I cursed them and in my mind I saw them competing with my libs and stealing nutrients... but I decided to look at them more closely this time. And to my surprise the bases got blue within 30 seconds.

Great! this must be Conocybe cyanopus. there is a possibility that it might be Conocybe kuehneriana, also supposed to grow in my country and is reported to contain small amounts of psilocybin, but I'm leaning towards cyanopus. What do you guys think?

Also, look at the close resemblance with the mushrooms psylosymonreturns found last year http://www.shroomery.org/forums/showflat.php/Number/12727534 Even the same habitat with lots of Trifolium.

In one photo, one liberty cap is shown to compare sizes.



Habitat:


Close up of blue stain:


Edited by knarkkorven (02/22/12 10:13 AM)

Extras: Filter Print Post Top
OfflineRhizohunter
myco-nerd
Male


Registered: 04/22/11
Posts: 7,894
Last seen: 5 years, 6 months
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: knarkkorven]
    #14895067 - 08/09/11 09:21 AM (12 years, 8 months ago)

holy shit those look good to me:thumbup:

I'm still a noob of course

Extras: Filter Print Post Top
InvisibleSporulator
Male User Gallery

Registered: 03/08/11
Posts: 1,643
Loc: Europe
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: Rhizohunter]
    #14895089 - 08/09/11 09:30 AM (12 years, 8 months ago)

Great find!  :thumbup:

Take some spore prints on aluminum foil!


--------------------
                 

Edited by Sporulator (08/09/11 09:47 AM)

Extras: Filter Print Post Top
InvisibleSpilalot
Male User Gallery

Registered: 12/06/09
Posts: 790
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: Sporulator]
    #14895275 - 08/09/11 10:12 AM (12 years, 8 months ago)

:hatsoff: brilliant find


--------------------

Extras: Filter Print Post Top
Invisiblemaynardjameskeenan
The white stipes
Male


Folding@home Statistics
Registered: 11/11/10
Posts: 16,391
Loc: 'Merica
Trusted Identifier
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: Sporulator]
    #14895279 - 08/09/11 10:13 AM (12 years, 8 months ago)

:congrats:


--------------------
May you be filled with loving kindness.
May you be well.
May you be peaceful and at ease.
May you be happy.



AMU Q&A

Extras: Filter Print Post Top
Invisiblemaynardjameskeenan
The white stipes
Male


Folding@home Statistics
Registered: 11/11/10
Posts: 16,391
Loc: 'Merica
Trusted Identifier
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: maynardjameskeenan]
    #14895287 - 08/09/11 10:14 AM (12 years, 8 months ago)

did you or are you going to eat them?


--------------------
May you be filled with loving kindness.
May you be well.
May you be peaceful and at ease.
May you be happy.



AMU Q&A

Extras: Filter Print Post Top
Offlineehtdaedlufetarg
Toadstool Taxonomy
Male User Gallery


Registered: 04/26/07
Posts: 2,076
Loc: Oregon
Last seen: 11 years, 8 days
Trusted Identifier
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: maynardjameskeenan]
    #14895362 - 08/09/11 10:28 AM (12 years, 8 months ago)

Nice work. The picture of the Libs rules.


--------------------

Extras: Filter Print Post Top
Offlinesuchen
Once and Future Noob
Male User Gallery


Registered: 06/28/11
Posts: 8,841
Loc: Shangri-la
Last seen: 3 years, 4 months
Trusted Identifier
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: ehtdaedlufetarg]
    #14895781 - 08/09/11 11:58 AM (12 years, 8 months ago)

:bow2: Second row photos :bow2:

Awesome finds. Those photos bring sunshine into my rainy Florida day.


--------------------
Rod Tulloss said:

The bulb is the bulb.

The volva is the volva.

They have a very long term realtionship, but they’re “just friends.”

Extras: Filter Print Post Top
OfflineAnglerfishM
hearing things
Male User Gallery


Registered: 09/08/10
Posts: 18,767
Loc: Norvegr Flag
Last seen: 10 hours, 9 minutes
Trusted Identifier
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: knarkkorven]
    #14895892 - 08/09/11 12:17 PM (12 years, 8 months ago)

Absofuckinlutely  b e a u t i f u l !

I've already been out in my lib fields, and among the thirty-ish
libs I swear I saw some little fellas very similar to yours. They
didn't compete with the libs in numbers, at least. I'll definitely
check up on these over the weekend when I'm going back.


--------------------



Extras: Filter Print Post Top
Offlinepsylosymonreturns
aka Gym Sporrison
Male


Registered: 10/16/09
Posts: 13,948
Loc: Mos Eisley,
Last seen: 3 years, 8 months
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: Anglerfish]
    #14896671 - 08/09/11 02:42 PM (12 years, 8 months ago)

fuckin rights Knarkkorven!! :congrats: those look realy really similar to mine!! definetly take prints just in case they are even more rare and are Conocybe kuehneriana !! :thumbup: now i really gotta find me some !!! :smile:


--------------------

Extras: Filter Print Post Top
InvisibleMikael
 User Gallery

Registered: 07/30/08
Posts: 905
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: psylosymonreturns]
    #14896879 - 08/09/11 03:20 PM (12 years, 8 months ago)

Such a cool find kk, nice! :cool::thumbup:

Extras: Filter Print Post Top
InvisibleByrain


Registered: 01/07/10
Posts: 9,664
Trusted Identifier
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: Mikael]
    #14896917 - 08/09/11 03:28 PM (12 years, 8 months ago)

:thumbup:

Extras: Filter Print Post Top
InvisibleThe Thinker

Registered: 09/01/10
Posts: 4,000
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: Byrain]
    #14896923 - 08/09/11 03:29 PM (12 years, 8 months ago)

great find and pics

Extras: Filter Print Post Top
OfflineAnglerfishM
hearing things
Male User Gallery


Registered: 09/08/10
Posts: 18,767
Loc: Norvegr Flag
Last seen: 10 hours, 9 minutes
Trusted Identifier
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: knarkkorven] * 1
    #14896965 - 08/09/11 03:41 PM (12 years, 8 months ago)

Quote:








This is poster material.


--------------------



Extras: Filter Print Post Top
Offlineknarkkorven
Entheoholic
Male User Gallery

Registered: 06/22/05
Posts: 1,709
Loc: Sweden Flag
Last seen: 22 days, 3 hours
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: The Thinker]
    #14897059 - 08/09/11 04:01 PM (12 years, 8 months ago)

Thanks everybody.

I'm taking a few spore prints, but with quite bad sterility, was mixed with chanterelles in a bag. Will do it better next time I'll go there. And I will take some more and better photos to. The battery was low when I got there so I had to be quick and didn't have time to optimize the settings.

Yes, my plan is to find enough to trip and I don't think that will be hard. There was lots of them last year and I picked 20 today and left about 20 to mature and spread their spores. And I will visit this place many more times. Stay tuned for updates. :smile:

Extras: Filter Print Post Top
InvisiblesporeRider
Proud sporeRider :)
 User Gallery

Registered: 09/11/06
Posts: 5,030
Loc: usa Flag
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: Anglerfish]
    #14897068 - 08/09/11 04:03 PM (12 years, 8 months ago)

:super::congrats: those are beautiful specimens man:drooling::headbanger:
Keep up the great work!!!

if you chow a healthy freshie for each lb of body weight - plus some - your in for a SPECIAL treat:trippinballs::awesomenod: Amazingly CLEAR CLEAN almost PURE VISUAL experience!!!!

Nice work man - thos and some libs would keep ya SMILING like the sun:shineon:


--------------------
http://

Extras: Filter Print Post Top
InvisibleBobzimmer
Crawlin' Kingsnake
 User Gallery

Registered: 09/07/08
Posts: 8,696
Loc: NY
Trusted Identifier
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: sporeRider]
    #14898090 - 08/09/11 07:47 PM (12 years, 8 months ago)

:handth: Good job, Knark!


--------------------
Mr. Mushrooms said:
I will confess something that should be quite obvious, CC.  I love mushrooms, i.e. fungi.  I really do.  I am talking about a strong feeling, i.e. emotion, for them.  I think they are beautiful.  I even dream of them.

Extras: Filter Print Post Top
OfflineTetragammatron
Burgeoning
 User Gallery

Registered: 08/21/10
Posts: 1,046
Loc: There! Where? There on th... Flag
Last seen: 6 years, 7 months
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: Bobzimmer]
    #14898400 - 08/09/11 09:03 PM (12 years, 8 months ago)

Very nice, will keep my eye out for these.

Extras: Filter Print Post Top
Offlineknarkkorven
Entheoholic
Male User Gallery

Registered: 06/22/05
Posts: 1,709
Loc: Sweden Flag
Last seen: 22 days, 3 hours
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: Tetragammatron]
    #14911558 - 08/12/11 02:15 PM (12 years, 8 months ago)

Will try that wiscokid, thanks!

I took the long walk to the site again today. Not so much bluing today. Must be due to dry weather. I snapped a few photos. Check out the last one, I love the colors. Larger resolution than the rest also...

And the other one with the stone as background actually features three species, as a trained eye will notice... Top group is Conocybe cyanopus, below another Conocybe spp, growing close with the others! and to the right, two dry liberty caps.

And I found one Conocybe cyanopus 5cm away from a (ugly as hell) liberty cap :smile:



Extras: Filter Print Post Top
InvisiblesporeRider
Proud sporeRider :)
 User Gallery

Registered: 09/11/06
Posts: 5,030
Loc: usa Flag
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: knarkkorven]
    #14912258 - 08/12/11 04:55 PM (12 years, 8 months ago)

:wow::congrats:
F'n AWESOME man:awesomenod: thats one hell of a patch with liberty caps in it also:headbanger:
Great pics:thumbup:
i like the comparison shot also - cool to see them compared to libs - i don't kno if libs are small or your cyanopus are HUGE:crazy2::laugh:

the other conocybes there are prob c.tenera - my spot where i find c.smithii also has LOTS of c.tenera and c.lactea fruiting right along with the smithii:cool:

Nice job man - hope to see more pics of future hunts as well

KEEP IT UP:cheers: Active conocybe :heart:


--------------------
http://

Extras: Filter Print Post Top
Offlinepsylosymonreturns
aka Gym Sporrison
Male


Registered: 10/16/09
Posts: 13,948
Loc: Mos Eisley,
Last seen: 3 years, 8 months
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: sporeRider]
    #14912337 - 08/12/11 05:11 PM (12 years, 8 months ago)

nice new pics man!! i am getting jealous out here. but its supposed to rain sunday so monday i will try to get out!!!

and ya its wierd how some wont bruise blue. i know if i eat them it will be only blueing specimens.


--------------------

Extras: Filter Print Post Top
InvisiblesporeRider
Proud sporeRider :)
 User Gallery

Registered: 09/11/06
Posts: 5,030
Loc: usa Flag
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: psylosymonreturns]
    #14912361 - 08/12/11 05:18 PM (12 years, 8 months ago)

also remember psylo to look for other key aspects of them too - as you said the blueing ones are gunna be the BEST - but if they have a white stem - same colored caps -and the slight bulbous base - they are gunna be good- the ones too look out for would be a c.phalaris which had its veil washed off by rains:eek::eek: they though would have the brown to tan colored stems - ----- sticking with the younger cyanopus ( all white fresh stems ) and some older aged blueing ones -i guarantee you a Funky time:trippinballs::cheers:


--------------------
http://

Extras: Filter Print Post Top
Offlineknarkkorven
Entheoholic
Male User Gallery

Registered: 06/22/05
Posts: 1,709
Loc: Sweden Flag
Last seen: 22 days, 3 hours
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: sporeRider]
    #14914306 - 08/13/11 01:30 AM (12 years, 8 months ago)

Yeah, the libs was very small and dry. Most c. cyanopus are the size of "ordinary" libs, but with smaller stem. Also, c. cyanopus is very fragile.

The other conocybe (c. tenera sounds right) makes it a bit harder to ID, but as you also noticed, the stem is yellow, and the gills didn't have the same shape as c. cyanopus.

But interesting to have all these species at the same spot. It's also just a few meters away from the spot where I found a new (for me) Deconica last year. (could be Deconica physaloides) http://www.shroomery.org/forums/showflat.php/Number/13078505

Extras: Filter Print Post Top
Offlinepsylosymonreturns
aka Gym Sporrison
Male


Registered: 10/16/09
Posts: 13,948
Loc: Mos Eisley,
Last seen: 3 years, 8 months
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: knarkkorven]
    #14914810 - 08/13/11 06:15 AM (12 years, 8 months ago)

i have all those plus P stuntzii growing together! :wink:


--------------------

Extras: Filter Print Post Top
Offlineknarkkorven
Entheoholic
Male User Gallery

Registered: 06/22/05
Posts: 1,709
Loc: Sweden Flag
Last seen: 22 days, 3 hours
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: psylosymonreturns]
    #14918910 - 08/14/11 02:22 AM (12 years, 8 months ago)

Lucky bastard. :smile: I only got Cantharellus tubaeformis in the forest behind the pasture.

Extras: Filter Print Post Top
Offlineknarkkorven
Entheoholic
Male User Gallery

Registered: 06/22/05
Posts: 1,709
Loc: Sweden Flag
Last seen: 22 days, 3 hours
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: knarkkorven]
    #14985308 - 08/27/11 02:33 AM (12 years, 7 months ago)

Libery caps now dominates the place again, about 100-200 liberty caps and only about 20-30 conocybe cyanopus and 10-20 conocybe tenera.


Extras: Filter Print Post Top
Invisiblebloodworm
cube con·nois·seur
Male User Gallery

Registered: 05/22/10
Posts: 10,926
Loc: 352
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: knarkkorven]
    #14985334 - 08/27/11 02:48 AM (12 years, 7 months ago)

shit man, really?  :brilliant:
i am fucking jealous.
beautiful.
absolutely wonderful. :biggrin:
keep posting, please. :super:

i dream about picking liberty caps. had the chance in portland about a year ago...
but had to leave early due to family issues and and didn't get to do that much hunting there (which was the reason for me going in the first place).
:lmafo:
but whatever...nice finds man.
:cheers:

:stoned:

:aliendance:
peace and love
bloodworm 

:aliendance:
peace and love
bloodworm

Extras: Filter Print Post Top
Invisibleinnerview
Dreamer
Male User Gallery

Registered: 08/16/11
Posts: 847
Loc: USA/Sweden Flag
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: bloodworm]
    #14985431 - 08/27/11 04:24 AM (12 years, 7 months ago)

Shit! I'm studying these but I seem to be getting more confused... :confused:

I will make a post of some I found today... I'll call it
27/8 Finds... and hope I can get some clarity.

:peace: Om Shanti

Extras: Filter Print Post Top
Offlinefux234
Woodgnome
Male User Gallery


Registered: 09/22/10
Posts: 1,198
Loc: Westwood
Last seen: 5 years, 4 months
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: innerview]
    #14985531 - 08/27/11 06:16 AM (12 years, 7 months ago)

:wow::congrats:

dammit! knark! this is really amazing!


--------------------
"Carpe diem!"

P.Semilanceata  Germany



Extras: Filter Print Post Top
Offlinepsylosymonreturns
aka Gym Sporrison
Male


Registered: 10/16/09
Posts: 13,948
Loc: Mos Eisley,
Last seen: 3 years, 8 months
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: fux234]
    #14987574 - 08/27/11 04:19 PM (12 years, 7 months ago)

nice man!!:thumbup:


--------------------

Extras: Filter Print Post Top
Offlineknarkkorven
Entheoholic
Male User Gallery

Registered: 06/22/05
Posts: 1,709
Loc: Sweden Flag
Last seen: 22 days, 3 hours
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: psylosymonreturns]
    #15022131 - 09/03/11 10:52 AM (12 years, 7 months ago)

Thanks again everyone!

Some photos from yesterday, it has been cold weather and much rain during this week. Found more conocybe cyanopus than last time.


Extras: Filter Print Post Top
InvisiblesporeRider
Proud sporeRider :)
 User Gallery

Registered: 09/11/06
Posts: 5,030
Loc: usa Flag
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: knarkkorven]
    #15022344 - 09/03/11 11:41 AM (12 years, 7 months ago)

:awedance::congrats::jamming:

Very VERY NICE Knarkkoven:awesomenod::awesomenod::awesomenod:

im sooooooooooo jealous man - you got some BEAUTIFUL specimens and BEAUTIFUL shots:super::super::cool:

Keep it up man - May the cyanopus and the semi's fill your baskets:shineon:


--------------------
http://

Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery

Registered: 03/10/07
Posts: 48,364
Last seen: 19 hours, 39 minutes
Trusted Identifier
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: knarkkorven]
    #15022806 - 09/03/11 01:33 PM (12 years, 7 months ago)

What is the spore size?

Extras: Filter Print Post Top
Invisiblemaynardjameskeenan
The white stipes
Male


Folding@home Statistics
Registered: 11/11/10
Posts: 16,391
Loc: 'Merica
Trusted Identifier
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: Alan Rockefeller]
    #15022934 - 09/03/11 02:01 PM (12 years, 7 months ago)

have you tired them yet? I have heard they are super potent. I'm kinda too chick shit to eat the ones that I dried.


--------------------
May you be filled with loving kindness.
May you be well.
May you be peaceful and at ease.
May you be happy.



AMU Q&A

Extras: Filter Print Post Top
Offlineknarkkorven
Entheoholic
Male User Gallery

Registered: 06/22/05
Posts: 1,709
Loc: Sweden Flag
Last seen: 22 days, 3 hours
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: maynardjameskeenan]
    #15022970 - 09/03/11 02:09 PM (12 years, 7 months ago)

wiscokid: Thanks man!

Alan: I don't know, I don't have a microscope.

Onlinemaynardjameskeenan: No, I'm still gathering to get enough.

Extras: Filter Print Post Top
Invisiblemaynardjameskeenan
The white stipes
Male


Folding@home Statistics
Registered: 11/11/10
Posts: 16,391
Loc: 'Merica
Trusted Identifier
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: knarkkorven]
    #15023021 - 09/03/11 02:19 PM (12 years, 7 months ago)

+---------------------------------------------------------------------------+
| CONOCYBE CYANOPUS (aka Conocybe cyanopoda, Galerula cyanopus)            |
+---------------------------------------------------------------------------+
| A small and uncommon but relatively strong mushroom, often found on lawns.|
| Found in the northern parts of the U.S., Canada and northern Europe.      |
+------+-----------------+--------------------------------------------------+
|CAP  | diameter        | 0.7-2.5 centimeters                              |
|      | color          | rusty/dark brown to black                        |
|      | appearance      | convex, nearly hemispherical, slightly expanding |
|      |                | slightly wrinkled at edges                      |
+------+-----------------+--------------------------------------------------+
|STEM  | diameter        | 1-1.5 millimeters                                |
|      | length          | 2-4 centimeters                                  |
|      | color          | white or slightly grayish                        |
|      | appearance      | silky, striated                                  |
+------+-----------------+--------------------------------------------------+
|GILLS | form            | not crowded                                      |
|      | color          | dull rust brown, white edges                    |
+------+-----------------+--------------------------------------------------+
|SPORES| color          | dull rust brown                                  |
|      | size            | 6.5-7.5 x 4.5-5 x 4.5-5 micrometers              |
|      | shape          | ellipsoid, distinct germ-pore                    |
+------+-----------------+--------------------------------------------------+
|DOSAGE| fresh grams    | N/A (LD), N/A (MD), N/A (HD)                    |
|      | mg/g psilocybin | 9.30-4.50                                        |
|      |      psilocin  | 0.70-0.00                                        |
|      |      baeocystin | 0.30-1.00                                        |
+------+-----------------+--------------------------------------------------+

here is a chart list potency of them. I think you more then enough for a crazy tip. I's doesn't give an exact dosage but you might want to compare the numbers with cubensis or liberty caps to get a rough estimate on how many you should eat. Hope this helps. :thumbup:


--------------------
May you be filled with loving kindness.
May you be well.
May you be peaceful and at ease.
May you be happy.



AMU Q&A

Extras: Filter Print Post Top
Offlineknarkkorven
Entheoholic
Male User Gallery

Registered: 06/22/05
Posts: 1,709
Loc: Sweden Flag
Last seen: 22 days, 3 hours
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: maynardjameskeenan]
    #15023459 - 09/03/11 03:55 PM (12 years, 7 months ago)

Yes, i know... There is an even more detailed analysis from Jochen Gartz, Magic mushrooms around the world:

Quote:

Selected Test Results on the Alkaloid Content
of Conocybe cyanopus (% of Dry Weight)

Mushroom, Dry Weight(mg), Psilocybin, Baeocystin
1, 5, 0.84%, 0.15%
2, 6, 0.73%, 0.12%
3, 7, 1.01%, 0.20%
4, 10, 0.91%, 0.16%
5, 12, 0.89%, 0.14%




I don't have enough yet. I want close communication with this one. :smile:

When I trip with liberty caps (which I rarely do) I want to go deep in to it, so about 4-6g = 100-150 liberty caps. :wink:

That means about the same amount in weight with  the conocybes, but not in numbers because they are tiny in comparison when dried.

Extras: Filter Print Post Top
Invisiblecactu
culture and magic
Male


Registered: 03/06/06
Posts: 3,913
Loc: mexicoelcentrodelconocimi...
Trusted Identifier
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: knarkkorven]
    #15023836 - 09/03/11 05:13 PM (12 years, 7 months ago)

so maybe conocybe are early season mushrooms since are there more liberty right now will you say knarkkorven  we where looking for some conocybe i found last year and did also blue  but where not lucky this time.. nice finds by the way


--------------------

cuando una rafaga del pensamiento nos pasa  al lado se puede sentir  que valio  la pena  haber vivido, y cuando ese pensamiento se  convierte en sueño no paramos de soñar hasta realizarlo

Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery

Registered: 03/10/07
Posts: 48,364
Last seen: 19 hours, 39 minutes
Trusted Identifier
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: knarkkorven]
    #15024497 - 09/03/11 06:58 PM (12 years, 7 months ago)

Quote:

knarkkorven said:
Alan: I don't know, I don't have a microscope.






Please mail one to someone that does have a microscope.  I would be happy to help, though I am in Mexico so I can't promise a quick turnaround time.

Extras: Filter Print Post Top
Offlinepsylosymonreturns
aka Gym Sporrison
Male


Registered: 10/16/09
Posts: 13,948
Loc: Mos Eisley,
Last seen: 3 years, 8 months
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: Alan Rockefeller]
    #15027322 - 09/04/11 11:51 AM (12 years, 7 months ago)

i didnt realize these are growing in woodchips???

thanky you alan, these definetly need to be looked at. i think you should look at them, since you have mine and wiscos C smithii too.

hey Cactu, my Conocybe cyanopus started fruiting last year much earlier than other actives in the field!! my first obvervation was as early as July!!! i then found them in 4 other spots throughout the summer and into the fall.


--------------------

Edited by psylosymonreturns (09/04/11 11:56 AM)

Extras: Filter Print Post Top
Invisiblemaynardjameskeenan
The white stipes
Male


Folding@home Statistics
Registered: 11/11/10
Posts: 16,391
Loc: 'Merica
Trusted Identifier
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: psylosymonreturns]
    #15027676 - 09/04/11 12:54 PM (12 years, 7 months ago)

Mine were also found growing in wood chips. Maybe it's a better habitat for them then book authors realize.:shrug:


--------------------
May you be filled with loving kindness.
May you be well.
May you be peaceful and at ease.
May you be happy.



AMU Q&A

Extras: Filter Print Post Top
Offlinepsylosymonreturns
aka Gym Sporrison
Male


Registered: 10/16/09
Posts: 13,948
Loc: Mos Eisley,
Last seen: 3 years, 8 months
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: maynardjameskeenan]
    #15027708 - 09/04/11 01:00 PM (12 years, 7 months ago)

Quote:

maynardjameskeenan said:
Mine were also found growing in wood chips. Maybe it's a better habitat for them then book authors realize.:shrug:




maybe they are C smithii then.


--------------------

Extras: Filter Print Post Top
Invisiblemaynardjameskeenan
The white stipes
Male


Folding@home Statistics
Registered: 11/11/10
Posts: 16,391
Loc: 'Merica
Trusted Identifier
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: psylosymonreturns]
    #15028049 - 09/04/11 01:55 PM (12 years, 7 months ago)

Quote:

psylosymonreturns said:
Quote:

maynardjameskeenan said:
Mine were also found growing in wood chips. Maybe it's a better habitat for them then book authors realize.:shrug:




maybe they are C smithii then.



They might be!?! But just from the looks of them I would say cyanopus. I don't own a microscope so I guess is all just speculation. :shrug:
From the looks of wisco's smithii finds they are not the same mushroom. Although morphology can be a bitch.
I think this is cyanopus

And this is smithii


--------------------
May you be filled with loving kindness.
May you be well.
May you be peaceful and at ease.
May you be happy.



AMU Q&A

Extras: Filter Print Post Top
Offlineknarkkorven
Entheoholic
Male User Gallery

Registered: 06/22/05
Posts: 1,709
Loc: Sweden Flag
Last seen: 22 days, 3 hours
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: maynardjameskeenan]
    #15028100 - 09/04/11 02:06 PM (12 years, 7 months ago)

Most grow in the grass in the middle of the tracks, but some are in the area where the grass meets the tracks, look at the habitat photo.

The Psilocybe semilanceata behaves in the same way, also grows like crazy (laaarge numbers) in the middle and also to the line where the wood chip starts.


Extras: Filter Print Post Top
Invisiblemaynardjameskeenan
The white stipes
Male


Folding@home Statistics
Registered: 11/11/10
Posts: 16,391
Loc: 'Merica
Trusted Identifier
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: knarkkorven]
    #15028122 - 09/04/11 02:10 PM (12 years, 7 months ago)

Quote:

knarkkorven said:
Most grow in the grass in the middle of the tracks, but some are in the area where the grass meets the tracks, look at the habitat photo.

The Psilocybe semilanceata behaves in the same way, also grows like crazy (laaarge numbers) in the middle and also to the line where the wood chip starts.






I have heard the vehicle tires spread the spore and that's why people find them in tire and snow mobile tracks.


--------------------
May you be filled with loving kindness.
May you be well.
May you be peaceful and at ease.
May you be happy.



AMU Q&A

Extras: Filter Print Post Top
Offlineknarkkorven
Entheoholic
Male User Gallery

Registered: 06/22/05
Posts: 1,709
Loc: Sweden Flag
Last seen: 22 days, 3 hours
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: maynardjameskeenan]
    #15028168 - 09/04/11 02:21 PM (12 years, 7 months ago)

But they are not in the track, they are a both sides of it and right there in the middle, not in the tracks itself, where the wheels would go.

And the wood chips was put there to soak up the water that would otherwise make it muddy and hard to walk on.

I think that is part of the reason this place is good. This is inside a cow pasture, the biggest part of the pasture is behind the camera. And it is on higher ground, sloping towards this place. The water goes through the pasture, taking spores and nutrients with it and everything collects down at my wonder patch. Keeping it moist, gathering spores, creating interesting threads at the Shroomery... What happens next? :wink:

cactu: Yes, earlier start, but I don't know when it ends. Will report back about that.

Extras: Filter Print Post Top
Offlinepsylosymonreturns
aka Gym Sporrison
Male


Registered: 10/16/09
Posts: 13,948
Loc: Mos Eisley,
Last seen: 3 years, 8 months
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: knarkkorven]
    #15028248 - 09/04/11 02:35 PM (12 years, 7 months ago)

my cyanopus fruited last year from july til october.

Knark i cant wait til they go under the scope :thumbup: they do look exactly like mine , and mine are confirmed. but the chips had me thinking.


--------------------

Extras: Filter Print Post Top
Offlineknarkkorven
Entheoholic
Male User Gallery

Registered: 06/22/05
Posts: 1,709
Loc: Sweden Flag
Last seen: 22 days, 3 hours
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: psylosymonreturns]
    #15028310 - 09/04/11 02:45 PM (12 years, 7 months ago)

You have to wait until November for a certain traveller to get home to his mailbox...

Oh, I just came to think of one other thing this place produced. This!
http://www.shroomery.org/forums/showflat.php/Number/13217430/page/2
just a feet away from one of the conocybe spots :laugh:

Extras: Filter Print Post Top
Offlinesuchen
Once and Future Noob
Male User Gallery


Registered: 06/28/11
Posts: 8,841
Loc: Shangri-la
Last seen: 3 years, 4 months
Trusted Identifier
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: knarkkorven]
    #15028316 - 09/04/11 02:48 PM (12 years, 7 months ago)

knark that is the coolest f*ing thing I've seen in a while. Awesome! Is that in the fungus on fungus thread as well?


--------------------
Rod Tulloss said:

The bulb is the bulb.

The volva is the volva.

They have a very long term realtionship, but they’re “just friends.”

Extras: Filter Print Post Top
Invisiblecactu
culture and magic
Male


Registered: 03/06/06
Posts: 3,913
Loc: mexicoelcentrodelconocimi...
Trusted Identifier
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: psylosymonreturns]
    #15028691 - 09/04/11 04:08 PM (12 years, 7 months ago)

Quote:

psylosymonreturns said:


hey Cactu, my Conocybe cyanopus started fruiting last year much earlier than other actives in the field!! my first obvervation was as early as July!!! i then found them in 4 other spots throughout the summer and into the fall.




good to know thanks , iam curius since i have only found then once and this time i fail so  was thinking about the date last year i found then more later in the season ...


--------------------

cuando una rafaga del pensamiento nos pasa  al lado se puede sentir  que valio  la pena  haber vivido, y cuando ese pensamiento se  convierte en sueño no paramos de soñar hasta realizarlo

Extras: Filter Print Post Top
Invisiblecactu
culture and magic
Male


Registered: 03/06/06
Posts: 3,913
Loc: mexicoelcentrodelconocimi...
Trusted Identifier
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: knarkkorven]
    #15028760 - 09/04/11 04:22 PM (12 years, 7 months ago)

Quote:

knarkkorven said:

cactu: Yes, earlier start, but I don't know when it ends. Will report back about that.



thanks  iam looking foward  to your veredit at the end of the season ..


--------------------

cuando una rafaga del pensamiento nos pasa  al lado se puede sentir  que valio  la pena  haber vivido, y cuando ese pensamiento se  convierte en sueño no paramos de soñar hasta realizarlo

Extras: Filter Print Post Top
Offlinepsylosymonreturns
aka Gym Sporrison
Male


Registered: 10/16/09
Posts: 13,948
Loc: Mos Eisley,
Last seen: 3 years, 8 months
Re: Conocybe cyanopus. (I found them! wohooo!) [Re: cactu]
    #15029374 - 09/04/11 06:29 PM (12 years, 7 months ago)

i wasnt able to make an early find this year since all my spots were under water. we had really high spring and summer water levels so its been different this year.


--------------------

Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,364
Last seen: 19 hours, 39 minutes
Trusted Identifier
Re: Conocybe cyanopus. (updated with new mycoporn September 03 !! ) [Re: knarkkorven]
    #15840384 - 02/20/12 10:51 PM (12 years, 1 month ago)

http://mushroomobserver.org/obs/88084

Scale divisions 10.00 micrometers.

Spores (7.5) 7.7 – 8.9 (10.3) x (4.3) 4.4 – 4.8 (4.9) μm.

7.53 × 4.52
7.76 × 4.37
8.09 × 4.32
8.18 × 4.51
8.23 × 4.52
8.31 × 4.32
8.37 × 4.41
8.37 × 4.41
8.37 × 4.51
8.41 × 4.79
8.51 × 4.51
8.51 × 4.60
8.55 × 4.83
8.69 × 4.65
8.74 × 4.41
8.93 × 4.88
10.37 × 5.25

ITS1 sequence:

TATTGATATGCTTAAGTTCAGCGGGTAATCCTACCTGATTTGAGGTCAAAATGATCATTAAGTTGGTTGGCAGGGCCAAC
GGTTAGAAGCAGAGTCCCACTCAAAGGCTGTCGTCTGCATAGCGTAGATAATTATCACACTAACAGATGGACTGCAGGGG
TTACACTCCAGCTAATGCATTTGAGGAGAGCAGACTGTGAGGCCCGCAAAGACTCCCAATTCCAAGCCGCTCTCTACACA
AAAATGTAAGAGTGGTTGATAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTC
AAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCA
AGAGATCCGTTGCTGAAAGTTGTATAGATTTTATAGGCTGTTTTAAGGCCTTCTAAACGTTCTGATACATTCTTTTGGGG
TATATTGTAATAACGTAGACCCTCTGGACGTTGCTCACAGGAAAGCCGACAGCAGTGAAGCTGCGCAGCAAACCTCAACT
CCGAGCCCAAAAGCTCGATAACCAGAATACGGGTCTACAGAAGGTGCACAGGTGGAAAAGTAAAAATGACAGACGTGCAC
AGTACTCCCTGAGGAGCCAGCAACAGTCCACCAAGTTTATTCATTAATGATCCTCCGCA





Conclusion:  The bluing Conocybe species have been transferred into Pholiotina.  Spore size matches Pholiotina smithii better than P. cyanopus. BLAST shows  that the closest DNA match is 85% similar to Conocybe coprophila.

Extras: Filter Print Post Top
Offlinesuchen
Once and Future Noob
Male User Gallery


Registered: 06/28/11
Posts: 8,841
Loc: Shangri-la
Last seen: 3 years, 4 months
Trusted Identifier
Re: Conocybe cyanopus. (updated with new mycoporn September 03 !! ) [Re: Alan Rockefeller]
    #15840402 - 02/20/12 10:55 PM (12 years, 1 month ago)

Very interesting. Good stuff  :strokebeard:


--------------------
Rod Tulloss said:

The bulb is the bulb.

The volva is the volva.

They have a very long term realtionship, but they’re “just friends.”

Extras: Filter Print Post Top
Offlinefux234
Woodgnome
Male User Gallery


Registered: 09/22/10
Posts: 1,198
Loc: Westwood
Last seen: 5 years, 4 months
Re: Conocybe cyanopus. (updated with new mycoporn September 03 !! ) [Re: suchen]
    #15841029 - 02/21/12 02:16 AM (12 years, 1 month ago)

Great work Alan, but what is it now? :congrats:
spores are matching better to pholiotina smithii and DNA to conocybe croprophila little bit confusing :biggrin:


--------------------
"Carpe diem!"

P.Semilanceata  Germany



Extras: Filter Print Post Top
Offlineknarkkorven
Entheoholic
Male User Gallery

Registered: 06/22/05
Posts: 1,709
Loc: Sweden Flag
Last seen: 22 days, 3 hours
Re: Conocybe cyanopus. (updated with new mycoporn September 03 !! ) [Re: fux234]
    #15842719 - 02/21/12 01:22 PM (12 years, 1 month ago)

Great work Alan. Thanks a lot for taking a look at it!

Weird result though. I don't think they macroscopically look like the smithii found in PNW more like the cyanopus. But you are a better judge, I almost don't know anything about spore features. :smile: But I believe this would be the first find of Conocybe smithii (=pholiotina smithii, damn I hate name changes :wink: ) in Sweden!

But is 85% good enough to say it's c. coprophila or is the missing 15% an uncertainty big enough to suggest it to be a non yet described/DNA-sequenced species?

Conocybe coprophila seems to be hard to find photos of. Google image search mostly get "false positives" like my photos from this thread, psylosymonreturns conocybe, and some other species like tenera, rickenii etc.

John Allen's photo here doesn't show much. Seems to be big mushrooms anyway, http://www.shroomery.org/8476/Poisonous-lookalikes

These might be right?
http://virtualmycota.landcareresearch.co.nz/webforms/vM_Species_Details.aspx?pk=38461

Extras: Filter Print Post Top
Invisiblemaynardjameskeenan
The white stipes
Male


Folding@home Statistics
Registered: 11/11/10
Posts: 16,391
Loc: 'Merica
Trusted Identifier
Re: Conocybe cyanopus. (updated with new mycoporn September 03 !! ) [Re: Alan Rockefeller]
    #15843023 - 02/21/12 02:42 PM (12 years, 1 month ago)

Quote:

Alan Rockefeller said:
http://mushroomobserver.org/obs/88084

Conclusion:  The bluing Conocybe species have been transferred into Pholiotina.  Spore size matches Pholiotina smithii better than P. cyanopus. BLAST shows  that the closest DNA match is 85% similar to Conocybe coprophila.




Does this mean that all active conocybes fit better in the genus Pholiotina, or just smithii?


--------------------
May you be filled with loving kindness.
May you be well.
May you be peaceful and at ease.
May you be happy.



AMU Q&A

Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,364
Last seen: 19 hours, 39 minutes
Trusted Identifier
Re: Conocybe cyanopus. (updated with new mycoporn September 03 !! ) [Re: knarkkorven]
    #15846192 - 02/22/12 05:26 AM (12 years, 1 month ago)

Quote:

fux234 said:
Great work Alan, but what is it now? :congrats:




Good question.  I guess Pholiotina smithii.  Or maybe Conocybe smithii is more accurate?  The pileipellis structure suggests Pholiotina.  Maybe C. coprophila should be in Pholiotina as well.

Blast is just one way of looking at things, I need to make a phylogenetic tree to get a more accurate picture.


Quote:

knarkkorven said:
Weird result though. I don't think they macroscopically look like the smithii found in PNW more like the cyanopus.




"Conocybe cyanopus differs from Conocybe smithii in the gills lacking cinnamon flush, wider spores, larger size and sturdier stature of the carpophores, greater number of pileocystidia, narrower cheilocystidia which are of a slightly different shape (rarely subcapitate), white silky stipe as is seen in Conocybe coprophilia and darker colour of pileus which is hardly if at all striate."

Quote:

But you are a better judge, I almost don't know anything about spore features. :smile: But I believe this would be the first find of Conocybe smithii (=pholiotina smithii, damn I hate name changes :wink: ) in Sweden!




Yes it would be.  I need to check the pileocystidia and cheilocystidia.

Quote:

But is 85% good enough to say it's c. coprophila or is the missing 15% an uncertainty big enough to suggest it to be a non yet described/DNA-sequenced species?




15% is a huge difference, I am surprised that there is nothing closer.  If it was really in Pholiotina I would expect many closer matches from other Pholiotina species.


Quote:

Conocybe coprophila seems to be hard to find photos of.

These might be right?
http://virtualmycota.landcareresearch.co.nz/webforms/vM_Species_Details.aspx?pk=38461




I would trust those guys.

Extras: Filter Print Post Top
Offlineknarkkorven
Entheoholic
Male User Gallery

Registered: 06/22/05
Posts: 1,709
Loc: Sweden Flag
Last seen: 22 days, 3 hours
Re: Conocybe cyanopus. (updated with new mycoporn September 03 !! ) [Re: Alan Rockefeller]
    #15846804 - 02/22/12 10:06 AM (12 years, 1 month ago)

Ok, I hope this will clear out after an inspection of pileocystidia and cheilocystidia then.

I went through my photos from last year and decided to pick out and post some more for you all.

Check out the moth! I missed it totally before, it's also peaking out from the grass in the second photo, posted a while back..



Edited by knarkkorven (02/22/12 12:03 PM)

Extras: Filter Print Post Top
Invisiblebloodworm
cube con·nois·seur
Male User Gallery

Registered: 05/22/10
Posts: 10,926
Loc: 352
Re: Conocybe cyanopus. (updated with new mycoporn September 03 !! ) [Re: knarkkorven]
    #15846865 - 02/22/12 10:31 AM (12 years, 1 month ago)

nice find knark and great work up Alan.
thanks for sharing.

:aliendance:
peace and love
bloodworm

Extras: Filter Print Post Top
OfflineAlan RockefellerM
Mycologist
Male User Gallery
Registered: 03/10/07
Posts: 48,364
Last seen: 19 hours, 39 minutes
Trusted Identifier
Re: Conocybe cyanopus. (updated with new mycoporn September 03 !! ) [Re: maynardjameskeenan]
    #24970167 - 02/05/18 09:56 PM (6 years, 2 months ago)

Quote:

maynardjameskeenan said:
Quote:

Alan Rockefeller said:
http://mushroomobserver.org/obs/88084

Conclusion:  The bluing Conocybe species have been transferred into Pholiotina.  Spore size matches Pholiotina smithii better than P. cyanopus. BLAST shows  that the closest DNA match is 85% similar to Conocybe coprophila.




Does this mean that all active conocybes fit better in the genus Pholiotina, or just smithii?





I don't think the bluing Conocybes will stay in Pholiotina - they either need a new genus, or could be moved to another genus that has already been created, perhaps a long time ago.

I uploaded this sequence to GenBank this week, hopefully this will help out the people who decide to circumscribe a genus for the bluing Conocybes.

https://www.ncbi.nlm.nih.gov/nuccore/MG871468

Might be the first time that Knarkkorven has been mentioned on a US government website.  : )

This collection is only 5 nucleotides different from http://mushroomobserver.org/134561, a maynardjameskeenan collection from Lebanon, Oregon.  Whether that means it's the same species or different is a matter of opinion, but it's super close in any case.


Extras: Filter Print Post Top
Offlineknarkkorven
Entheoholic
Male User Gallery

Registered: 06/22/05
Posts: 1,709
Loc: Sweden Flag
Last seen: 22 days, 3 hours
Re: Conocybe cyanopus. (updated with new mycoporn September 03 !! ) [Re: Alan Rockefeller] * 1
    #24980126 - 02/10/18 03:30 AM (6 years, 2 months ago)

Quote:

Might be the first time that Knarkkorven has been mentioned on a US government website.  : )



Yes, I only think I have been linked to from a EMCDDA report about psilocybin mushrooms before :wink:

Quote:

This collection is only 5 nucleotides different from http://mushroomobserver.org/134561, a maynardjameskeenan collection from Lebanon, Oregon.  Whether that means it's the same species or different is a matter of opinion, but it's super close in any case.



This is interesting. Wasn't there like 3 differences between P. cyanescens and P. allenii when you described it as a new species?

I found the bluing Conocybe on the same spot for the following 3 years, but haven't found any recently. The ground around the tracks was pretty muddy from cows walking there one summer and then the farmer filled it up with gravel. I have also searched a lot of other habitat never found any more. It seems to be very rare.

In 2010 (one year before the Conocybe find) the same place looked like this:



It was a very special habitat... Good memories! :smile:

Extras: Filter Print Post Top
Offlineleschampignons
Biochemistry + Mycology
Male User Gallery


Registered: 08/30/13
Posts: 1,584
Loc: NY/NJ/ME Flag
Last seen: 1 month, 5 days
Re: Conocybe cyanopus. (updated with new mycoporn September 03 !! ) [Re: knarkkorven]
    #24980519 - 02/10/18 09:24 AM (6 years, 2 months ago)

Fascinating. I wonder if this is a species that shares its range only with P. semilanceata or if it is more widespread than that. Here on the east coast, liberty caps are very rare, and found up north, if at all. Maybe the same is true for bluing conocybes or maybe they are all around us and simply rare...?


--------------------
leschampignons Trade List

Extras: Filter Print Post Top
Invisiblekarode13Facebook
Tāne Mahuta
 User Gallery


Folding@home Statistics
Registered: 05/19/05
Posts: 15,290
Loc: LV-426
Trusted Identifier
Re: Conocybe cyanopus. (updated with new mycoporn September 03 !! ) [Re: knarkkorven]
    #24982793 - 02/10/18 12:59 PM (6 years, 2 months ago)

Quote:

knarkkorven said:


In 2010 (one year before the Conocybe find) the same place looked like this:



It was a very special habitat... Good memories! :smile:





:awesomenod:


Really digging that middle shot.:goodmorning:


--------------------

Extras: Filter Print Post Top
Offlineknarkkorven
Entheoholic
Male User Gallery

Registered: 06/22/05
Posts: 1,709
Loc: Sweden Flag
Last seen: 22 days, 3 hours
Re: Conocybe cyanopus. (updated with new mycoporn September 03 !! ) [Re: Alan Rockefeller]
    #28077934 - 12/01/22 12:03 PM (1 year, 4 months ago)

Samples from my collection was analyzed in this newly released article.
Low on psilocybin, but relatively high baeocystin.

Quote:

A very interesting and rare species in our dataset is Pholiotina cyanopus, for which we
analyzed three fruiting bodies from a single fungarium collection. P. cyanopus contained
0.821–1.360 mg/g BA, 0.247–0.565 mg/g NB, less than or equal to 0.062 mg/g PS, and less
than or equal to 0.859 mg/g PSB. Our results were very similar to the previous study by
Halama et al. [13], who also reported a trace concentration of AE.
https://doi.org/10.3390/ijms232214068




I sent them to Jan Borovicka back in 2016. The years went by and I lost hope that I would see an article being published including them...
https://www.shroomery.org/forums/showflat.php/Number/22345076/

Extras: Filter Print Post Top
Jump to top Pages: 1 | 2 | 3 | 4  [ show all ]

Shop: Kraken Kratom Red Vein Kratom   Original Sensible Seeds Bulk Cannabis Seeds   Left Coast Kratom Buy Kratom Extract   MagicBag.co All-In-One Bags That Don't Suck   North Spore North Spore Mushroom Grow Kits & Cultivation Supplies   Mushroom-Hut Mono Tub Substrate   Myyco.com Isolated Cubensis Liquid Culture For Sale   PhytoExtractum Kratom Powder for Sale


Similar ThreadsPosterViewsRepliesLast post
* Frequently Updated MycoPorn from NJ/PA/NY nycomyco 1,266 2 09/04/04 02:12 PM
by nycomyco
* Let's Update the FAQ List of What's Found Where...
( 1 2 all )
ToxicManM 4,164 26 10/01/03 10:16 AM
by Ude
* bon conocybe jccc 1,996 15 05/01/07 07:53 AM
by snoot
* Conocybe cyanopus? Cherk 16,884 15 10/06/14 05:42 PM
by o8u
* conocybe cyanopus rungi 6,248 19 05/21/10 10:08 PM
by Mr. Mushrooms
* East TN, Rain, 6/18/03, 20 foot radius, Lawn debianlinux 1,851 6 06/20/03 05:34 PM
by ToxicMan
* Are These? Copelandia cyanescens *DELETED* thewolvebrigade 2,827 10 08/06/04 02:26 PM
by ivi
* Cyan mycoporn
( 1 2 all )
Psilygirl 3,408 22 11/22/04 09:37 AM
by Borealis

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: ToxicMan, inski, Alan Rockefeller, Duggstar, TimmiT, Anglerfish, Tmethyl, Lucis, Doc9151, Land Trout
19,856 topic views. 2 members, 135 guests and 9 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.052 seconds spending 0.008 seconds on 12 queries.