|
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
|
The Lightning
Mycology Enthusiast


Registered: 09/06/11
Posts: 3,889
|
Re: Panaeolus phylogenetic tree [Re: Joust]
#18198628 - 05/01/13 06:50 PM (10 years, 8 months ago) |
|
|
Quote:
I wanna guide for DNA of mushrooms and using BLAST
Here's the basic instructions, but more people will need to use the site and consider how it can be better designed, not that I'm one to complain:
1. Figure out what Psilocybe (or mushroom species) you want to study. Let's pick Psilocybe fasciata for this experiment.

2. What region or gene(s) do you want to study for this experiment? The proposed universal fungi DNA barcode is ITS. Let's pick ITS1 since the NCBI Advanced Search isn't working using ITS.
3. Let's go to this site: https://www.ncbi.nlm.nih.gov/
4. Type in "Psilocybe fasciata ITS1" and search. On the next screen hit Nucleotide.
5. Two sequences (as of today) appear. Let's take a moment to reflect on some of the info displayed before going further. What is an accession number? Also notice that one sequence is going to show us 1592 base pairs but the second one has 647 base pairs. What is a base pair?
|
The Lightning
Mycology Enthusiast


Registered: 09/06/11
Posts: 3,889
|
|
Quote:
What is an accession number?
The first Psilocybe fasciata listing on NCBI has Accession: AB158635.1.
This is simply a number assigned to the sequence for reference and organization. https://www.ncbi.nlm.nih.gov/Sequin/acc.html
Quote:
What is a base pair?
This is all about nucleotides.

Nucleotides for DNA = adenine (A), cytosine (C), guanine (G), & thymine (T)
A DNA "ladder" is made of these nucleotides. They are connected and form a spiral railroad track. Each "wood track" of the railroad so-to-speak is made of a base pair (two nucleotides connected to each other): G-C guanine-cytosine or A-T adenine-thymine.
When we look at DNA sequences, we are looking at base pairs - or more accurately 1/2 of the base pairs (ie one half of the rail road - or one strand of the two-strand DNA).

Example of a nucleotide sequence of Psilocybe fasciata:
1 aaggatcatt attgaatgaa cttggctcgg ttgcagctgg tcctctcgag ggcatgtgct 61 cgccgtgtca tctttatctc tccacctgtg caccttttgt agacctggat tagttaactt 121 tccgaggaaa ctcggtcggg aggattgctt tcacaagctc tccttgcaat taacccaggc 181 ctacgttttc atatacccca aagaatgtaa cagaatgtat tatattggcc ttgtgcctat 241 aaactatata caactttcag caacggatct cttggctctc gcatcgatga agaacgcagc 301 gaaatgcgat aagtaatgtg aattgcagaa ttcagtgaat catcgaatct ttgaacgcac 361 cttgcgctcc ttggtattcc gaggagcatg cctgtttgag tgtcattaaa ttctcaacct 421 taccagcttt tgctgataat ggcttggatg tgggggtctt ttgctggctt cgtcaagagg 481 tctgctcccc ttaaatgtat tagccggtgc cccgcgcaga gccgtctatt ggtgtgataa 541 ttatctacgc cgtggacctt tgcatgaatg ggattgcgct gcttctaacc gtccttcact 601 ggacaataca aatgacaatt tgacctcaaa tcaggtagga ctacccgctg aacttaagca 661 tatcaataag cggaggaaaa gaaactaaca aggattcccc tagtaactgc gagtgaagcg 721 ggaaaagctc aaatttaaaa tctggcggtc tttggccgtc cgagttgtaa tctagagaag 781 tgttatccgc gctggaccgt gtacaagtct cctggaatgg agcgtcatag agggtgagaa 841 tcccgtcttt gacacggact gccagggctt tgtgatgcgc tctcaaagag tcgagttgtt 901 tgggaatgca gctcaaaatg ggtggtaaat tccatctaaa gctaaatatt ggcgagagac 961 cgatagcgaa caagtaccgt gagggaaaga tgaaaagaac tttggaaaga gagttaaaca 1021 gtacgtgaaa ttgctgaaag ggaaacgctt gaagtcagtc gcgttgtccg gggatcaacc 1081 ttgcttttgc tgggtgtact ttccggttga cgggtcagca tcaattttga ccgttggata 1141 aagtctgtgg aaatgtggct tcttcggaag tgttatagtc catggtcgca tacaacggtt 1201 gggattgagg aactcagcac gccgaaaggc cgggtacttg taccacgttc gtgcttagga 1261 tgctggcata atggctttaa tcgacccgtc ttgaaacacg gaccaaggag tctaacatgc 1321 ctgcgagtgt ttgggtggaa aacccgagcg cgtaatgaaa gtgaaagttg agatccctgt 1381 cgcggggagc atcgacgccc ggaccagacc ttttgtgacg gatccgcggt agagcatgta 1441 tgttgggacc cgaaagatgg tgaactatgc ctgaataggg tgaagccaga ggaaactctg 1501 gtggaggctc gtagcgattc tgacgtgcaa atcgatcgtc aaatttgggt ataggggcga 1561 aagactaatc gaaccatcta gtagctggtt cc
So let's get an idea of what the above stuff is. We know our letters represent the four DNA nucleotides (GCAT) since this is a DNA nucleotide sequence we searched for.
What are the numbers on the left of each line? Count the letters in the first small group of the sequence. It's the same number of letters (10) for each group of letters until the very last group where the sequence ends. Each number listed on the left represents the starting number of the nucleotide as if it were a numbered list. (It is a numbered list!)
Remember ~ there were 1592 base pairs listed with this particular sequence as noted earlier. We're seeing one "side" (one strand!) and one half of the pairs throughout the sequence typed out above. Because we know one half of the two DNA "railroad sides" we also know the other half without mentioning it in the above sequence (A always connectes to T, and C always connects to G)*.
*There are actually exceptions to this but for the sake of getting on track (pun intended) let's keep it simple.
|
The Lightning
Mycology Enthusiast


Registered: 09/06/11
Posts: 3,889
|
|
So, let's continue...
We searched for Psilocybe fasciata and arrived here: https://www.ncbi.nlm.nih.gov/nuccore/?term=Psilocybe%20fasciata%20ITS1 - and now we'll click the first listing which takes us here: https://www.ncbi.nlm.nih.gov/nuccore/AB158635.1
To perform a BLAST (Basic Local Alignment Search Tool) of just this DNA sequence we'll click "Run BLAST" on the right side.
BLAST finds regions of similarity between biological sequences. The program compares nucleotide sequences (or protein sequences) to sequence databases and calculates the statistical significance of matches.
After clicking "Run BLAST" a new page will appear with a title "Standard Nucleotide BLAST". Notice the Accession Number was added into the "Enter Query Sequence" box. Scroll down and click the BLAST button.
Edited by The Lightning (05/02/13 08:41 AM)
|
The Lightning
Mycology Enthusiast


Registered: 09/06/11
Posts: 3,889
|
|
A new screen will appear. The first part looks like this:

The second part like this:

You can mouse-over each red line (each red line represents an individual sequence the BLAST was compared to). Reminder: Mouse-over and then click to show alignments, if you'd like to review an individual "alignment."
https://en.wikipedia.org/wiki/Sequence_alignment
Reminder:
Sequence Alignment
A sequence alignment is a way of arranging the sequences of DNA, RNA, or protein to identify regions of similarity that may be a consequence of functional, structural, or evolutionary relationships between the sequences. Aligned sequences of nucleotides are typically displayed in rows.

Let's test this idea out. (Click on the first red line). It will scroll down really fast on the same page and go to the actual sequence. The first match turned out to be the exact same Accession Number (ie the same sequence) as we BLASTed. In other words, we're now looking at the Psilocybe fasciata sequence compared to itself. This is just to get us familiar with the site so don't get frustrated.

The Query (the originally BLASTed accession number) is compared to another accession number which is listed as Sbjct.
(Again, in this case everything is identical because we're comparing a sequence to itself).
|
The Lightning
Mycology Enthusiast


Registered: 09/06/11
Posts: 3,889
|
|
Okay. So let's go back up near the top of that screen, below the graph where this info appears:

Notice the following categories (fields):
Max score Total score Query cover E value Max ident Accession - We already know what the Accession is. It's just the number assigned to this sequence.

Here's my understanding of these fields and what they mean, although I think re-wording will be needed as I grasp them further:
Max score: This number is based on how well the items match. The longer the sequence and the better the match, the higher the score. I would pay far more attention to the Query Coverage field and the Maximum Identity field.
Total score: Sum of scores of all aligned sequence. Again, pay more attention to the Query Coverage and the Maximum Identify.
Query coverage: Displays the percentage of the original sequence aligned to the listed item. You want a high percentage so there is a fair comparison going on.
E Value: The E value (Expect Value) represents the number of search hits you would expect to find on NCBI - by chance - based on the quality of the alignment and the size of the actual database (ie the entire NCBI database and the databases NCBI draws data from). It decreases exponentially as the Score (S) of the match increases. For example, an E value of 1 assigned to a hit can be interpreted as meaning that in a database of the current size one might expect to see 1 match with a similar score simply by chance.
Max ident (Maximum Identity): The maximum percentage of identical identity between the accession number and another sequence.
|
maynardjameskeenan
The white stipes



Registered: 11/11/10
Posts: 16,391
Loc: 'Merica
|
|
You do good work, I'm am glad to see others taking interest in this subject. This is where the the future of mycology is headed, data based analysis beats guess-work any day.
Have you made any phylogenetic tree's yet? Would you be interested in collaborating on a Psilocybes of the PNW tree, if you have any extra time? I love to see how species relate to one another.
-------------------- May you be filled with loving kindness. May you be well. May you be peaceful and at ease. May you be happy. AMU Q&A
|
The Lightning
Mycology Enthusiast


Registered: 09/06/11
Posts: 3,889
|
|
Quote:
Have you made any phylogenetic tree's yet?
This tree was constructed using phylogeny.fr (http://www.phylogeny.fr/version2_cgi/index.cgi):

This is based on hand-picked entries of Psilocybe species after an NCBI search for "Psilocybe ITS1." I had to leave out species which were still labelled as Psilocybe species and were actually Deconica species. It doesn't tell us much and lacks any usefulness for the time being.
Quote:
Would you be interested in collaborating on a Psilocybes of the PNW tree, if you have any extra time?
Yes. Maybe you can do the next tree and we can explore the DNA Species Concept together.
|
maynardjameskeenan
The white stipes



Registered: 11/11/10
Posts: 16,391
Loc: 'Merica
|
|
Did you use MAFFT for aligning the data collected from BLAST?
Here is a rough tree for the Psilocybes that occur in Oregon. There are still a few species missing from the genbank.
-------------------- May you be filled with loving kindness. May you be well. May you be peaceful and at ease. May you be happy. AMU Q&A
|
The Lightning
Mycology Enthusiast


Registered: 09/06/11
Posts: 3,889
|
|
I'm not sure what MAFFT gives us that the NCBI site isn't already giving us.
|
maynardjameskeenan
The white stipes



Registered: 11/11/10
Posts: 16,391
Loc: 'Merica
|
|
Aesthetics, mostly. It's also helpful for comparing collection that are not genitally similar.

This tree could not be possible using the NCBI website.
-------------------- May you be filled with loving kindness. May you be well. May you be peaceful and at ease. May you be happy. AMU Q&A
|
Alan Rockefeller
Mycologist

Registered: 03/10/07
Posts: 48,276
Last seen: 9 hours, 52 minutes
|
|
Quote:
The Lightning said: I'm not sure what MAFFT gives us that the NCBI site isn't already giving us.
It has some nice tools for getting rid of the sequences that don't align well.
|
The Lightning
Mycology Enthusiast


Registered: 09/06/11
Posts: 3,889
|
|
Quote:
maynardjameskeenan said: Aesthetics, mostly. It's also helpful for comparing collection that are not genitally similar.
Were you able to properly compare different genes or regions between species?
For example, taking one sequence of Psilocybe semilanceata that has a standard ITS region sequence (ITS1, 5.8S, and ITS2) complete, and comparing it to a sequence of Psilocybe fasciata that only has a CO1 sequence?
This does not seem logical but maybe I'm missing something here.
|
maynardjameskeenan
The white stipes



Registered: 11/11/10
Posts: 16,391
Loc: 'Merica
|
|
Quote:
The Lightning said:
Quote:
maynardjameskeenan said: Aesthetics, mostly. It's also helpful for comparing collection that are not genitally similar.
Were you able to properly compare different genes or regions between species?
For example, taking one sequence of Psilocybe semilanceata that has a standard ITS region sequence (ITS1, 5.8S, and ITS2) complete, and comparing it to a sequence of Psilocybe fasciata that only has a CO1 sequence?
This does not seem logical but maybe I'm missing something here.
Hmmmm.... I not sure how to answer this.
I think that under the summery of any mushroom you look up it lists multiply gene regions sequenced. ie;
Psilocybe fasciata [18S ribosomal RNA gene, partial sequence;] [internal transcribed spacer 1, 5.8S ribosomal RNA gene,[ and internal transcribed spacer 2, complete sequence;]] [28S ribosomal RNA gene, partial sequence]
Psilocybe azurescens [voucher PRM 901174 18S small subunit ribosomal RNA gene, partial sequence;] [internal transcribed spacer 1, 5.8S ribosomal RNA gene,[ and internal transcribed spacer 2, complete sequence; and 28S large]] [subunit ribosomal RNA gene, partial sequence]
I think that maybe the brackets separate gene regions and just as long as the two samples you are comparing test the same regions you should get meaningful data.
I'm still kinda new to this stuff, so please be patient with me and forgive my mistakes.
-------------------- May you be filled with loving kindness. May you be well. May you be peaceful and at ease. May you be happy. AMU Q&A
|
The Lightning
Mycology Enthusiast


Registered: 09/06/11
Posts: 3,889
|
|
Quote:
I think that maybe the brackets separate gene regions and just as long as the two samples you are comparing test the same regions you should get meaningful data.
This is what I'm wondering, too.
I get the feeling (when reading scientific papers) that mycologists are accidentally "aligning" regions that are dissimilar.
The ITS region (which is made up of ITS1, 5.8S, and ITS2 - as a complete sequence) is the DNA barcode for fungi including Psilocybe - at least for now.
To compare an ITS region barcode to a CO1 gene or the Small SubUnit region seems like comparing my arm to your foot. But again, there may be a way to align these regions that hasn't been explained to me yet.
Knock, knock, knockin' on Alan's door....Oh yeah....
|
Alan Rockefeller
Mycologist

Registered: 03/10/07
Posts: 48,276
Last seen: 9 hours, 52 minutes
|
|
You need to compare the same region to get any meaningful results.
If you are comparing different regions they won't align at all.
You can view the alignments with a tool like mafft, and drop any sequences that don't align well. Then make the tree.
|
nomendubium



Registered: 05/16/14
Posts: 500
Last seen: 6 years, 10 months
|
|
|
Alan Rockefeller
Mycologist

Registered: 03/10/07
Posts: 48,276
Last seen: 9 hours, 52 minutes
|
Re: Panaeolus phylogenetic tree [Re: nomendubium]
#20061981 - 05/30/14 05:10 PM (9 years, 7 months ago) |
|
|
Why do you think that one is Panaeolina foenisecii?
I got the first results of sequencing back from the lab work I have been doing recently, here is a sequence for Panaeolus papilionaceus from Pico de Orizaba, the tallest volcano in North America. I found this at over 4000 meters elevation, well above the tree line.
http://mushroomobserver.org/114447
ITS sequence: AATCGTCATTATCGAATAAACTGGGTGGGTTGTTGCTGTCCCTCTCGGGGGAACTGTGCACGCCTTACCTTTTTTGTTTTTCCACCTGTGAACACACTGTAGGTCTGGAGGGAAGGGAAGCAATTCCTTGACGTTCAGGTCCTATGCTTATACATATACACTATTGAAAGTAACAGAACGATTCAATGGGCTCTAAGCCTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCATCGCTTTTGTGATGATGGCTTGGATGTGGAGGTTTCTGCAGGCCGAAAGGTCTGCTCCTCTCAAATGAATTAGTGGGTGCCCCGCGCAAACCTATCTATTGGTGTGATAATTATCTACGCCGTGGTCTAGGATTGCTGTAAAAAGGTGTTTGCCCTGCTTCTAACCGTCCATTGACTTGGACAACTTGAACCATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTCTTCGATTGTCCGAGTTGTAATCTAGAGAAGCATTATCCGCGCTGGACCGTGTACAAGTCTCCTGA
It's a good match for Panaeolus papilionaceus from Italy and Germany. Makes sense that it is an imported species since it grows on cow dung and they didn't have cows in North America until they were brought over here.
|
nomendubium



Registered: 05/16/14
Posts: 500
Last seen: 6 years, 10 months
|
|
because Nomendubium said
Quote:
The strangely positioned "Paneaolus subbalteatus" AB104674.2 If you click on the pubmed entry 12808251 This is a DNA sequence of a Powdered mushroom! from 2003 I might add. At the time of publication they probably didn't have a lot of sequences to compare to and elected to call it Panaeolus subbalteatus because that species was the closest thing yet sequenced at the time. Now 12 years later it is clear that the correct identity for the entry would have been/is Panaeolina foenisecii
and it happens to be on your tree with 3 foes
Edited by nomendubium (05/30/14 05:23 PM)
|
nomendubium



Registered: 05/16/14
Posts: 500
Last seen: 6 years, 10 months
|
Re: Panaeolus phylogenetic tree [Re: nomendubium]
#20062034 - 05/30/14 05:28 PM (9 years, 7 months ago) |
|
|
here is the paper, it is j2, collected in 1983, sequenced in 2003 https://www.jstage.jst.go.jp/article/cpb/51/6/51_6_710/_pdf
|
Alan Rockefeller
Mycologist

Registered: 03/10/07
Posts: 48,276
Last seen: 9 hours, 52 minutes
|
Re: Panaeolus phylogenetic tree [Re: nomendubium]
#20062634 - 05/30/14 08:52 PM (9 years, 7 months ago) |
|
|
I believe that it is a species of Panaeolus which is not in genbank yet. The closest Panaeolina foenisecii sequence is 9 base pairs away. BLAST seems to think that it is closer to Panaeolus papilionaceus.
|
|