|
 Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
|
 Teotzlcoatl
Teotzlcoatl
Registered: 06/29/07
Posts: 2,421
Loc: South-Eastern USA
Last seen: 16 years, 2 months
|
 Who grows their own Ayahuasca? 
#7128687 - 07/04/07 01:49 PM (16 years, 9 months ago) |
|
|
How many of you guys grow your own caapi, psychotria or other Aya' plants???
Post species names and pics.......
--------------------
"We are the one's we have been waiting for"-Hopi proverb
|
 Stonehenge
Alt Center
Registered: 06/20/04
Posts: 14,850
Loc: S.E.
|
Re: Who grows their own Ayahuasca? [Re: Teotzlcoatl]
#7128853 - 07/04/07 02:33 PM (16 years, 9 months ago) |
|
|
I grow both PV and caapi. I have several large caapi plants. One is growing like a bush. I have a stand of around a dozen pv plants. They are in flower now. Both of those are easy to grow. I also have a number of other plants, cacti and so on.
--------------------
“A democracy cannot exist as a permanent form of government. It can only exist until the voters discover that they can vote themselves largesse from the public treasury. From that moment on, the majority always votes for the candidates promising the most benefits from the public treasury with the result that a democracy always collapses over loose fiscal policy, always followed by a dictatorship.” (attributed to Alexis de Tocqueville political philosopher Circa 1835)
Trade list http://www.shroomery.org/forums/showflat.php/Number/18047755
|
CptnGarden
fuck this site
Registered: 05/13/04
Posts: 11,945
Last seen: 14 years, 11 months
|
Re: Who grows their own Ayahuasca? [Re: Stonehenge]
#7128933 - 07/04/07 03:02 PM (16 years, 9 months ago) |
|
|
|
Teotzlcoatl
Teotzlcoatl
Registered: 06/29/07
Posts: 2,421
Loc: South-Eastern USA
Last seen: 16 years, 2 months
|
Re: Who grows their own Ayahuasca? [Re: CptnGarden]
#7129328 - 07/04/07 04:52 PM (16 years, 9 months ago) |
|
|
Whats that? Captain?
--------------------
"We are the one's we have been waiting for"-Hopi proverb
|
Legoulash
Stranger
Registered: 09/07/02
Posts: 4,347
Last seen: 12 years, 9 months
|
Re: Who grows their own Ayahuasca? [Re: Teotzlcoatl]
#7129472 - 07/04/07 05:44 PM (16 years, 9 months ago) |
|
|
seems like a hint..
not realy needed though
Iv grown both those plants but couldnt keep either alive, i live in a preaty harsh climate here though. Its tough to keep exotic plants alive.
|
felixhigh
Scientist
Registered: 06/24/01
Posts: 7,565
Loc: Ly
Last seen: 4 days, 22 hours
|
Re: Who grows their own Ayahuasca? [Re: Legoulash]
#7129618 - 07/04/07 06:58 PM (16 years, 9 months ago) |
|
|
I do. But I live in a sunny and warm country so it´s not that extraordinarie.
FH
|
Teotzlcoatl
Teotzlcoatl
Registered: 06/29/07
Posts: 2,421
Loc: South-Eastern USA
Last seen: 16 years, 2 months
|
Re: Who grows their own Ayahuasca? [Re: felixhigh]
#7129849 - 07/04/07 08:34 PM (16 years, 9 months ago) |
|
|
Yea for some reason i dont think id be able to keep them alive, im in zone 7 of the USA
--------------------
"We are the one's we have been waiting for"-Hopi proverb
|
Teotzlcoatl
Teotzlcoatl
Registered: 06/29/07
Posts: 2,421
Loc: South-Eastern USA
Last seen: 16 years, 2 months
|
Re: Who grows their own Ayahuasca? [Re: Teotzlcoatl]
#7138910 - 07/06/07 07:32 PM (16 years, 9 months ago) |
|
|
do you use them fresh pick straight from the plant or dry them?
/
--------------------
"We are the one's we have been waiting for"-Hopi proverb
|
Knoa6
Sunn 0)))
Registered: 04/25/07
Posts: 1,237
Loc: USA-zone 7
|
Re: Who grows their own Ayahuasca? [Re: Teotzlcoatl]
#7142955 - 07/07/07 05:40 PM (16 years, 9 months ago) |
|
|
My P.Viridis do well in zone 7 during the spring and summer outdoors, although in some parts of zone 7 lack of humidity may be an issue. Bugs really like my Psychotrias. I had an issue with scales and a constant ant/garlic battle on the blooms, but now I have tons of blooms and seeds ripening so they seem happy.{they have to go inside when it gets cold}
Caapi on the other hand I haven't been so successful with, I bought a bunch of overpriced seeds and none germinated.(I think they where old and dormant).My neighbor bought a nice rooted Caapi cutting from Ebay and it soon died, I don't know if it was the zone 7 conditions or lack of care though;)
I think Caapi would be best grown somewhere it could be left outside all year long, but it's worth a shot.
My wife works for a company that genetically modifies cotton. They have isolated genes(mostly from South African plants)that make bugs die after they eat some of the plant.They have also isolated "Round-up resist" gene, which is self explanatory, and several other cool functional genes. Right now they are producing plants that have both genes at the rate of 1 in 64 plants or better. I don't know how these techniques would transfer cross species into other plants but I don't think it would work with the materials I have access to. There is however, this possibility in all plants to unlimited extent almost. Imagine a genetically modified Caapi vine that would be very frost tolerant, potent, fast growing, etc. There is very little or no research like this going on for entheogens, but it will come. Alot of people have a problem with genetically modified lifeforms but they are mostly Creationists. anyways
good luck
|
Teotzlcoatl
Teotzlcoatl
Registered: 06/29/07
Posts: 2,421
Loc: South-Eastern USA
Last seen: 16 years, 2 months
|
Re: Who grows their own Ayahuasca? [Re: Knoa6]
#7143599 - 07/07/07 08:47 PM (16 years, 9 months ago) |
|
|
that's awesome!
--------------------
"We are the one's we have been waiting for"-Hopi proverb
|
thallus
Stranger thanyou
Registered: 08/15/06
Posts: 629
Loc: Hiding in Plain Sight
|
Re: Who grows their own Ayahuasca? [Re: Teotzlcoatl]
#7144951 - 07/08/07 02:19 AM (16 years, 9 months ago) |
|
|
felixhigh there some nice pics.
|
durban_poison
myco contractor
Registered: 09/19/01
Posts: 2,417
|
Re: Who grows their own Ayahuasca? [Re: Knoa6]
#7158654 - 07/10/07 11:27 PM (16 years, 9 months ago) |
|
|
|
Teotzlcoatl
Teotzlcoatl
Registered: 06/29/07
Posts: 2,421
Loc: South-Eastern USA
Last seen: 16 years, 2 months
|
Re: Who grows their own Ayahuasca? [Re: durban_poison]
#7167237 - 07/12/07 05:55 PM (16 years, 9 months ago) |
|
|
durban is that caapi?
--------------------
"We are the one's we have been waiting for"-Hopi proverb
|
ApacheShaman
Stranger
Registered: 06/27/06
Posts: 1,346
|
Re: Who grows their own Ayahuasca? [Re: Teotzlcoatl]
#7167256 - 07/12/07 05:59 PM (16 years, 9 months ago) |
|
|
haha no that a Psychotria.
|
Teotzlcoatl
Teotzlcoatl
Registered: 06/29/07
Posts: 2,421
Loc: South-Eastern USA
Last seen: 16 years, 2 months
|
Re: Who grows their own Ayahuasca? [Re: ApacheShaman]
#7168783 - 07/12/07 10:48 PM (16 years, 9 months ago) |
|
|
sorry, could'nt tell, looked like a vine....but ya the glossy leaves give it away
--------------------
"We are the one's we have been waiting for"-Hopi proverb
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG
Registered: 01/07/04
Posts: 7,752
|
Re: Who grows their own Ayahuasca? [Re: Teotzlcoatl]
#7169017 - 07/12/07 11:33 PM (16 years, 9 months ago) |
|
|
I was told the leaf crumpling like that is due (at least partially) to a lack of a breeze.
--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
CptnGarden
fuck this site
Registered: 05/13/04
Posts: 11,945
Last seen: 14 years, 11 months
|
Re: Who grows their own Ayahuasca? [Re: Koala Koolio]
#7170429 - 07/13/07 10:12 AM (16 years, 9 months ago) |
|
|
i find leaf crumpling to occur with too little humidity, or when a cold spell flows through. fresh air or just moving air in general has not done much for my viridis...
when it warms up to 90 and the humidity goes up in the greenhouse, the viridis straightens its leafs...
|
Teotzlcoatl
Teotzlcoatl
Registered: 06/29/07
Posts: 2,421
Loc: South-Eastern USA
Last seen: 16 years, 2 months
|
Re: Who grows their own Ayahuasca? [Re: CptnGarden]
#7231071 - 07/27/07 04:04 PM (16 years, 8 months ago) |
|
|
does anybody have anything to add?
--------------------
"We are the one's we have been waiting for"-Hopi proverb
|
entheoindole
Seāð Wīdfarend
Registered: 04/04/04
Posts: 595
Loc: Eormensyll, Vīnland
|
Re: Who grows their own Ayahuasca? [Re: Teotzlcoatl]
#7231261 - 07/27/07 04:46 PM (16 years, 8 months ago) |
|
|
I've had great success with PV as well as caapi hear where I live. The area I live in is somewhere between zone 8 & 9.
I have some large PV which are potted, ranging in height from 4.5' to 8' tall. They are very easy to flower and set seed. I just cover them with visquing (plastic) and then blankets when it gets frosty around here which is only for a month or two.
My caapi's are a different story. I have two in pots that are slow going. They are healthy though. I've never had them flower for me but I'm hoping one day they will! I have 4 other caapi's which are planted in the ground. Just a little experiment to see how they'll do in the winter.
I happened to come by these cuttings when I traveled to a friends house in south FL. His caapi was a monster. It had almost completely covered his entire back yard. We had to tear it down because his neighbors were complaining to the city about his yard.
We didn't tear the entire thing down but did remove most of it. It was such a job! We used a bobcat (machine) to pull it out of the trees.
He gave me all the stems and cuttings (I'm looking to trade these cuttings) I could carry, plus a few live pieces to plant.
The transplants took quite well. I'm hoping to get these bad boys to flower.
I also grow Alternanthera lehmannii. Another one of the myriad add-mixture plants which go into ayahuasca. It is said to cause an intoxication similar to alcohol. This one grows like a weed. If you're not careful it'll take over your yard! Very easy to grow. Very easy to take cuttings from too.
I use fish emulsion as a fert and neem oil, water pressure and my fingers as pest control for all of my plants.
|
truffleupagus
Registered: 02/19/06
Posts: 3,103
|
Re: Who grows their own Ayahuasca? [Re: entheoindole]
#7232113 - 07/27/07 09:38 PM (16 years, 8 months ago) |
|
|
Here's a top view of my baby psychotria:
I'm in New York so it sure as hell isn't nice year round where I am. But I don't plan on putting it outside anytime really soon anyway. I'm pretty confident that it'll do okay. I'll just move it around inside my house if need be and try to keep the humidity high enough.
If things go well with the viridis I might try my hand at growing some caapi too. But for starters anyway, I'm just gonna plan on using leaves from my viridis plant in combination with online bought caapi.
|
|
Threaded
Previous
Index
Next
All-In-One Bags That Don't Suck 
Autoflowering Cannabis Seeds 
North Spore Mushroom Grow Kits & Cultivation Supplies 
Bridgetown Botanicals 
Red Vein Kratom 
Maeng Da Thai Kratom Leaf Powder
Edit 
Reply 
Pachanguero
1 2 all )
SalviaEngland
Psilocybeingzz
Funguy
MOTH
kadakuda