|
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
|
kaniz
That one, overthere.
Registered: 07/23/04
Posts: 4,166
Loc: Ontario
|
Smoked DMT - how does it 'look' to the trip sitter?
#5225226 - 01/26/06 08:54 AM (18 years, 2 months ago) |
|
|
A friend of a friend may be getting some DMT soon. While I've read the trip reports, and have some idea of what they should expect from the trippers point of view. One thing I havent seen much of, is 'how it looks from the trip sitters point of view'.
Anything to look for that would point to a health risk/etc in which medical attention is needed? How does the typical tripper act while on DMT? Is it just sitting there with eyes bulged out as they get thrust into hyperspace?
I know some psychedelics can do quite the number on the tripper, and they may seem to be acting 'odly' to the watcher. So, just curious to whats normal, and no need to cause alarm, and what is 'abnormal' and may indicate that they need some sort of help - either from the sitter, or medical attention.
|
leery11
I Tell You What!
Registered: 06/24/05
Posts: 5,998
Last seen: 8 years, 11 months
|
Re: Smoked DMT - how does it 'look' to the trip sitter? [Re: kaniz]
#5225511 - 01/26/06 10:51 AM (18 years, 2 months ago) |
|
|
i'm not sure how you could need medical attention from using DMT, since it's a natural chemical in the body.
i mean like for example if i'm goofing around tripping i might start going into "convulsions" because I'm messing with my energy flow and noticing certain blockages, and I may even spasm real violently once in a while while stoned if I start falling asleep then drastically wake up....
to someone else it might look like i'm dying or having a seisure or something but I'm not.
So I don't know.
-------------------- I am the MacDaddy of Heimlich County, I play it Straight Up Yo! ....I embrace my desire to feel the rhythm, to feel connected enough to step aside and weep like a widow, to feel inspired, to fathom the power, to witness the beauty, to bathe in the fountain, to swing on the spiral of our divinity and still be a human...... Om Namah Shivaya, I tell you What!
|
Kingkole
im not a noob...im a a doob
Registered: 11/30/03
Posts: 506
Loc: canadiana
Last seen: 7 years, 3 months
|
Re: Smoked DMT - how does it 'look' to the trip sitter? [Re: leery11]
#5225536 - 01/26/06 10:57 AM (18 years, 2 months ago) |
|
|
maybe some one has a video of some of smoking DMT out there in netland?
|
dblaney
Human Being
Registered: 10/03/04
Posts: 7,894
Loc: Here & Now
|
Re: Smoked DMT - how does it 'look' to the trip sitter? [Re: kaniz]
#5225546 - 01/26/06 10:59 AM (18 years, 2 months ago) |
|
|
Lie down and relax. Tell the sitter of any medical conditions you may have. DMT can raise your blood pressure, so make sure the sitter doesn't mistake a change in bp as something dangerous. The important things are vitals (pulse, breathing, bp). If you take a high enough dose, you may become temporarily unresponsive.
Medical attention would be needed only if your heart stops or your breathing stops, or something else obviously dangerous, such as coughing up blood.
-------------------- "What is in us that turns a deaf ear to the cries of human suffering?" "Belief is a beautiful armor But makes for the heaviest sword" - John Mayer Making the noise "penicillin" is no substitute for actually taking penicillin. "This country, with its institutions, belongs to the people who inhabit it. Whenever they shall grow weary of the existing government, they can exercise their constitutional right of amending it, or their revolutionary right to dismember or overthrow it." -Abraham Lincoln
|
kaniz
That one, overthere.
Registered: 07/23/04
Posts: 4,166
Loc: Ontario
|
Re: Smoked DMT - how does it 'look' to the trip sitter? [Re: leery11]
#5225563 - 01/26/06 11:03 AM (18 years, 2 months ago) |
|
|
^^
Thats what I'm refering to. I recall reading a trip report where the persons eyes bugged out, they started to scream like mad, and I think started to bleed. His friends freaked out, called 911 - they took him to the hospital.
He got let out, 100% fine, and in his mind - he had a lovely trip, but to the bystanders, it looked like he was completly freaking out and on the verge of death.
So, I guess thats what I'm curious about - is having convlusions/seizures/etc 'normal' and if the sitter should be worried at all.
However, just because something is produced in the body, doesnt mean its 100% safe, espically when taking it in from an external source, and in doses far greater than what naturally exist in your body. GHB is produced by the body - but ODing on it can (and has) lead to death.
Also, just curious - are there any health risks from accidently taking too much DMT. ie: accidently smoking say, 200mg instead of 60mg? Or, is the only risk just having a trip more intense then you had bargained for?
Smoking DMT does cause quite an increase in blood pressure, which I'd imagine wouldnt be that good for people with health issues/etc.
|
Land_Crab
NeuroticPsychonaut
Registered: 08/29/04
Posts: 2,194
Loc: U.S.
|
Re: Smoked DMT - how does it 'look' to the trip sitter? [Re: kaniz]
#5225697 - 01/26/06 11:43 AM (18 years, 2 months ago) |
|
|
No, going spastic is not a normal side effect. In my experience, it's more of a "sitting there with the eyes bulged out as you go into hyperspace" kind of thing. If you have experience with psychedelics and are as prepared as one can be, you should be fine.
As far as I know, DMT is very safe. In fact, if you or anyone else can find a source explaining how someone died from only taking DMT, I should like to read it.
It's not impossible that you might act a little funny, like making animal noises or something. Part of the blessing and the curse of DMT is that it's over quickly. So even if it frightens you or something, you'll begin coming down at ballpark 10 minutes, and at an hour, you'll be at maybe 90% of baseline.
So unless you're hammering your chest, your face turns blue, and you're making gurgling noises, you have little to worry about. The first of the very few times I've watched someone else smoking DMT, he just got real quiet and lay there, periodically giggling.
|
kaniz
That one, overthere.
Registered: 07/23/04
Posts: 4,166
Loc: Ontario
|
Re: Smoked DMT - how does it 'look' to the trip sitter? [Re: Land_Crab]
#5225737 - 01/26/06 11:52 AM (18 years, 2 months ago) |
|
|
I figured as much, and in my reading / research, I've never seen anything mentioned about death, just the possible risk with the sudden increase in blood pressure.
But, I have also read cases of spasms/siuzures/etc happening and the sitters freaking out and calling 911 (but they didnt need to, just paniced as they didnt know what to expect).
But, just mostly wanted to know that I could inform them, that
"If they start having a seizure and screaming in tounges, they are fine and there is no need to call 911" (While not 100% normal, it can happen, and not to be that worried about)
Just wanted/needed a bit of reconfirmation on the subject based on what I've read from other sources.
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG
Registered: 01/07/04
Posts: 7,752
|
Re: Smoked DMT - how does it 'look' to the trip sitter? [Re: kaniz]
#5225769 - 01/26/06 12:05 PM (18 years, 2 months ago) |
|
|
It just looks like they're tripping, and lay down for a nap... maybe stretching or squirming a bit... smile on the face. I've seen 5 people smoke DMT, never have I seen anyone scream, or even speak for the first few minutes. Both times I did it, it was extremely euphoric, extremely intense, but I can't imagine it being scary for anyone who can deal with sheer intensity.
Also, I find it rude and awkward to sit around while someone else smokes DMT, and I don't find it good as a group thing. One person goes, then the next, etc. Theres really no interaction with the person. "Are you feeling it yet?" deserves a slap in the face with most psychedelics... DMT 100x that. And it just feels kind of creepy just staring at the person, and there isn't much else you can do. I usually leave the room once they put the pipe down, poke my head in now and then to see if they're back, and make sure they're okay.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
kaniz
That one, overthere.
Registered: 07/23/04
Posts: 4,166
Loc: Ontario
|
Re: Smoked DMT - how does it 'look' to the trip sitter? [Re: Koala Koolio]
#5225823 - 01/26/06 12:16 PM (18 years, 2 months ago) |
|
|
Yeah, not big on big-group tripping either. Typically its just me and my BF.
Most likely, it'd be 'smoke, lay down on bed and let them be untill they surface'.
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG
Registered: 01/07/04
Posts: 7,752
|
Re: Smoked DMT - how does it 'look' to the trip sitter? [Re: kaniz]
#5225913 - 01/26/06 12:49 PM (18 years, 2 months ago) |
|
|
I like group tripping, but it just doesn't work for dmt.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
Kurenchai
Gnome
Registered: 11/24/05
Posts: 215
Loc: The Garden
Last seen: 10 years, 5 months
|
Re: Smoked DMT - how does it 'look' to the trip sitter? [Re: Koala Koolio]
#5226004 - 01/26/06 01:11 PM (18 years, 2 months ago) |
|
|
Actually elgr, i think group tripping with DMT is great and should be embraced often, in certain numbers of people, 3, 5, 7. We've had large circles of some 10 people, as silent as possible and everyone smoke at the same time. It's fucking fantastic, hearing everyones DEEEEP breathing is orgasmic almost. Actually, my first 'alien' contact experience on D was with a group.
Edit: I realize you were speaking on a personal basis, so group tripping may not apply to you. I really do enjoy smoking D alone the best though. Alone is when i get initiated.
-------------------- things that are oooobvious...
|
ph30n1x
the next jerry
Registered: 08/21/05
Posts: 201
Loc: just a few notes away
Last seen: 16 years, 5 months
|
Re: Smoked DMT - how does it 'look' to the trip sitter? [Re: kaniz]
#5226037 - 01/26/06 01:19 PM (18 years, 2 months ago) |
|
|
Quote:
kaniz said: But, I have also read cases of spasms/siuzures/etc happening and the sitters freaking out and calling 911 (but they didnt need to, just paniced as they didnt know what to expect).
Are you sure these people didn't have seizure-related health problems before smoking DMT. Are you sure these trip reports were true. It just seems odd to me that one person in this thread said that DMT was very safe and you say that there are these people seizuring from it.
|
kaniz
That one, overthere.
Registered: 07/23/04
Posts: 4,166
Loc: Ontario
|
Re: Smoked DMT - how does it 'look' to the trip sitter? [Re: ph30n1x]
#5226075 - 01/26/06 01:30 PM (18 years, 2 months ago) |
|
|
Well, it depends if you think having a seizure / twitching a bit is 'unsafe'.
But, I've read through a number of trip reports on erowid, and have seen it mentioned a few times where the tripper has seemingly 'freaked out' (to the people watching), which has caused the sitters to panic and think it was an unsafe situation.
Although, that seems to be more in regards to 5-meo-DMT, which is different then DMT (me thinks I was having trip reports mixed up in my head).
But, I have had 'twitchy limbs' before while tripping (LSA), where while laying in bed - I could feel my arms/legs twitching all over - to the outside observer, this could of easily looked like a seizure I think - my legs and arms would just kind of fling themself whichever way they felt like. I felt 100% fine/healthy/at peace during this time - but I could see how to an outsider, it would look awfully odd.
|
Teknition
herbal explorer
Registered: 08/11/05
Posts: 65
Last seen: 13 years, 1 month
|
Re: Smoked DMT - how does it 'look' to the trip sitter? [Re: kaniz]
#5226743 - 01/26/06 04:27 PM (18 years, 2 months ago) |
|
|
never tried DMT but it does sound interesting....oh and kaniz...haha..i really like your shaking head guy...kinda makes me wanna look at it while tripping...:)
|
Help on the Way
Slipknot420
Registered: 08/12/00
Posts: 2,893
Loc: Another World
|
Re: Smoked DMT - how does it 'look' to the trip sitter? [Re: Teknition]
#5226774 - 01/26/06 04:37 PM (18 years, 2 months ago) |
|
|
when we did it, people looked kinda shocked/overwhelmed right as it hit and then closed their eyes and went to "sleep" for a few minutes....
be ready to lie down as soon as you smoke it, you dont wanna be standing up or something because your body will probably fall or something and YOU will be nowhere around to control it
-------------------- *Divine Moments of Truth* "Limitless undying love which shines around me like a million suns - it calls me on and on across the universe" ~ John Lennon "Once in a while you get shown the light in the strangest of places if you look at it right" ~The Grateful Dead "Religionists, with their guaranteed eventual paradise, of which they know nothing, taking it all on 'faith,' can't be expected to understand or sympathize with those with a yen to storm the Gate of Heaven and see for themselves what all the praying's about!" ~Robert Hunter
|
|