Home | Community | Message Board


This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: PhytoExtractum Kratom Powder for Sale   Mushroom-Hut Grow Bags   Myyco.com Isolated Cubensis Liquid Culture For Sale   Bridgetown Botanicals CBD Concentrates   Left Coast Kratom Buy Kratom Capsules   North Spore Bulk Substrate   Original Sensible Seeds High THC Strains   MagicBag.co All-In-One Bags That Don't Suck

Jump to first unread post Pages: 1
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
OfflineFatalshatter
Shroom to theDoom!

Registered: 12/08/04
Posts: 28
Loc: Shroom land lol
Last seen: 14 years, 2 months
Phoenix Oyster Mushroom *DELETED*
    #3468213 - 12/08/04 11:27 PM (19 years, 3 months ago)

Post deleted by Fatalshatter

Reason for deletion: old


Extras: Filter Print Post Top
OfflineIGnosticAbhorI
Stranger-er

Registered: 11/06/04
Posts: 4,899
Last seen: 10 months, 2 days
Re: Phoenix Oyster Mushroom [Re: Fatalshatter]
    #3468247 - 12/08/04 11:34 PM (19 years, 3 months ago)

I just pmed you, you might want to read it and these arent P Cubes,
The Phoenix Oyster is an aggressive mushroom that fruits easily on a wide range of substrates. This is the most popular mushroom for beginners and is the top choice for introductory mushroom cultivation demonstrations.
Classification: Pleurotus Pulmonarius

Cultivation Difficulty: Easy

Mushroom Type: Edible

Substrate: Pasteurized Straw, Wood Chips, Sawdust, Grains, Coffee Grounds, Agricultural Waste, Newspaper, Cardboard

Colonization/Fruiting Temperatures: 75-85F/50-75F

They're more so used for cooking with, if you want an out of body experience, then these defiently aren't the way lol
Psilocyban Cubensis have psiloban in them which gives you the whoa, w/o it, you're just eatin mushrooms, heh, read the pm i sent. Gl

Extras: Filter Print Post Top
Offlineatomic1
enthusiast
Male

Registered: 09/18/03
Posts: 1,123
Loc: Appalachia
Last seen: 4 years, 5 months
Re: Phoenix Oyster Mushroom [Re: IGnosticAbhorI]
    #3468290 - 12/08/04 11:43 PM (19 years, 3 months ago)

I'd recommend going with one of the vendors here and get a P. cubensis strain like IGnosticAbhorI said if you are infact looking for a psychoactive shroom. Get yourself a syringe and then we'll get you through it. BTW, you should use tweezers to twist and pull your shrooms off whereas cutting them would leave the bottoms with open tissue which could start to rot and then contam. :goodluck:

Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Phoenix Oyster Mushroom [Re: atomic1]
    #3468435 - 12/09/04 12:06 AM (19 years, 3 months ago)

Btw, instead of going to sporebank go to sporeworks. bank gets theirs there, so it'll obviously be cheaper.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!

Extras: Filter Print Post Top
OfflineFatalshatter
Shroom to theDoom!

Registered: 12/08/04
Posts: 28
Loc: Shroom land lol
Last seen: 14 years, 2 months
Re: Phoenix Oyster Mushroom [Re: Koala Koolio]
    #3468585 - 12/09/04 12:39 AM (19 years, 3 months ago)

Thanks soo much guys.

Extras: Filter Print Post Top
Jump to top Pages: 1

Shop: PhytoExtractum Kratom Powder for Sale   Mushroom-Hut Grow Bags   Myyco.com Isolated Cubensis Liquid Culture For Sale   Bridgetown Botanicals CBD Concentrates   Left Coast Kratom Buy Kratom Capsules   North Spore Bulk Substrate   Original Sensible Seeds High THC Strains   MagicBag.co All-In-One Bags That Don't Suck


Similar ThreadsPosterViewsRepliesLast post
* Crushed Oyster Shell babyshroom 5,648 13 03/27/02 11:13 AM
by babyshroom
* Using RICE MILK to grow mycelium/mushrooms??????
( 1 2 all )
jokerGD 4,903 24 03/05/18 10:19 AM
by Shroomarican
* NEW PF TEK: How to alter the dna of mushrooms!
( 1 2 all )
Jammer 7,087 23 02/19/02 11:56 PM
by Jammer
* albino mushroom *DELETED* blacksabbathrulz 843 4 06/30/02 08:27 PM
by BIGSWANG
* Help needed *DELETED* Majortrippz 1,089 11 12/10/01 02:22 PM
by FreakShow
* pin set vs. colonization time *DELETED* Majortrippz 1,249 5 01/08/02 01:10 PM
by Anonymous
* first time :) casing log - how am I doing? *DELETED* Majortrippz 881 5 01/05/02 09:54 PM
by Anonymous
* puny B+ *DELETED* Majortrippz 513 1 12/03/01 08:33 PM
by Zen Peddler

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Shroomism, george castanza, RogerRabbit, veggie, mushboy, fahtster, LogicaL Chaos, 13shrooms, Stipe-n Cap, Pastywhyte, bodhisatta, Tormato, Land Trout, A.k.a
743 topic views. 22 members, 150 guests and 86 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.024 seconds spending 0.009 seconds on 14 queries.