Home | Community | Message Board


FreeSpores.com
Please support our sponsors.

Feedback and Administration >> Shroomery Polls

Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Jump to first unread post. Pages: 1 | 2 | Next >  [ show all ]
Offlinetoneloke
Stranger
 User Gallery
Registered: 11/21/04
Posts: 38
Last seen: 8 years, 2 months
Cigarettes!
    #3394530 - 11/21/04 10:24 PM (8 years, 5 months ago)

To smoke or not to smoke, that is the question.
Smoking cigarettes, good or bad?
You may choose only one
waste of time don't do anything, bad!
can't live without em


Votes accepted from (11/21/04 02:00 PM) to (No end specified)
You must vote before you can view the results of this poll



Post Extras: Print Post  Remind Me! Notify Moderator
Offlinelilbil
republican hippy(only one)

Registered: 10/09/04
Posts: 114
Loc: Montana, usa
Last seen: 8 years, 4 months
Re: Cigarettes! [Re: toneloke]
    #3394602 - 11/21/04 10:39 PM (8 years, 5 months ago)

what!!!!!! cig are the shit, fuck you guys if you dont want them, give them to me :laugh:


--------------------
----------------------------------------------

if ignorance is bliss, then sadly my mom and dad are very happy......


Post Extras: Print Post  Remind Me! Notify Moderator
Anonymous

Re: Cigarettes! [Re: toneloke]
    #3396610 - 11/23/04 02:54 AM (8 years, 5 months ago)

This poll is a little extreme. Everything in moderation, I say.


Post Extras: Print Post  Remind Me! Notify Moderator
Invisiblesilversoul7
Chill the FuckOut!
 User Gallery

Registered: 10/10/02
Posts: 27,301
Loc: mndfreeze's puppet army
Re: Cigarettes! [Re: ]
    #3396875 - 11/23/04 04:24 AM (8 years, 5 months ago)

Quote:

Max Headroom said:
This poll is a little extreme. Everything in moderation, I say.



:thumbup:


--------------------


"It is dangerous to be right when the government is wrong."--Voltaire


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleSuper_Blunt
Candyman
 User Gallery

Registered: 10/25/04
Posts: 3,140
Re: Cigarettes! [Re: silversoul7]
    #3396879 - 11/23/04 04:27 AM (8 years, 5 months ago)

I don't know I'd smoke 10 cigarettes at once if i had the money :lol:

at $9.00 a pack, this is only a fantasy of mine.


--------------------


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleLocus
Male

Folding@home Statistics
Registered: 03/11/04
Posts: 6,036
Loc: ny/europe
Re: Cigarettes! [Re: toneloke]
    #3396994 - 11/23/04 05:30 AM (8 years, 5 months ago)

to me, they're stupid and no point really in smoking them, no offense to the smokers though.


--------------------


"Fear is the great barrier to human growth." ~ Dr. Robert Monroe

The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein


~~~*Dosis sola facit venenum*~~~

*Check my profile to listen to my music* :smile:


Post Extras: Print Post  Remind Me! Notify Moderator
InvisiblePsilostylin
Captain Save Em'
Registered: 03/13/04
Posts: 678
Loc: New Orleans!
Re: Cigarettes! [Re: Locus]
    #3397137 - 11/23/04 07:14 AM (8 years, 5 months ago)

$9 a pack! christ, dude, why even smoke? you could get a bag of weed for the price of 2 packs. around here cigarettes are from $2.75 to $4.00. i smoke way too much. i hate cigarettes.

a good addition to this poll would be... 'what brand of cigarettes do you smoke?' personally i smoke camel...but normally when i'm low on funds (which is most of the time), i smoke bronco's. a cheap columbian brand of smokes sold at $2.00 a pack. horible quality, but, when ya need a joe, it does the trick.


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineCaRnAgECaNdYS
NOVA's groupie
Female User Gallery

Registered: 04/09/04
Posts: 11,492
Loc: Billy Howerdel's closet
Last seen: 11 months, 3 hours
Re: Cigarettes! [Re: toneloke]
    #3397312 - 11/23/04 09:39 AM (8 years, 5 months ago)

I used to smoke. I quit awhile back. I don't miss them at all, then again I didn't smoke that much to begin with. I only would smoke about 3 cigs a day.


--------------------

The secret to being funny is to say smart things stupidly, or is it stupid things smartly? Whatever..it's not rocket surgery...or something like that.


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineXbollweevilX
Student
Male User Gallery

Registered: 04/09/06
Posts: 174
Last seen: 1 year, 3 months
Re: Cigarettes! [Re: CaRnAgECaNdY]
    #5712154 - 06/04/06 08:06 PM (6 years, 11 months ago)

It's a love hate relationship.


--------------------
There is no such thing as a civilian.


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinewhatever123
Whatever I did, I'm sorry
Male User Gallery

Registered: 04/07/05
Posts: 2,613
Loc: San Diego, CA
Last seen: 2 years, 2 months
Re: Cigarettes! [Re: toneloke]
    #5712206 - 06/04/06 08:20 PM (6 years, 11 months ago)

Christ, I really dislike these polls. How about this?

If you don't smoke, don't vote in the second poll.
Do you smoke cigarettes?
You may choose only one
Very heavily
A lot
Meh, a few a day, sometimes none
Once in a blue moon
Never
Do you want to quit smoking as much/entirely?
You may choose only one
Nope, I'm fine
I should stop smoking as often
I want to stop


Votes accepted from (06/04/06 08:20 PM) to (No end specified)
View the results of this poll | Filter by response



--------------------
Koala Koolio said:
there should be a 3 month waiting period between registration and posting. :wink:


Edited by whatever123 (06/04/06 08:21 PM)


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleToiletDuk
Give me Librium or give me Meth!
 User Gallery

Registered: 05/17/03
Posts: 81,283
Loc: Earthfarm 1
Re: Cigarettes! [Re: toneloke]
    #5713054 - 06/05/06 12:12 AM (6 years, 11 months ago)

I smoke 'em. Wish I didn't though. I'm hooked like a big dog. :frown:


--------------------


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinewhatever123
Whatever I did, I'm sorry
Male User Gallery

Registered: 04/07/05
Posts: 2,613
Loc: San Diego, CA
Last seen: 2 years, 2 months
Re: Cigarettes! [Re: ToiletDuk]
    #5713584 - 06/05/06 02:34 AM (6 years, 11 months ago)

My poll > your poll


--------------------
Koala Koolio said:
there should be a 3 month waiting period between registration and posting. :wink:


Post Extras: Print Post  Remind Me! Notify Moderator
OfflinePSylopHiLe
stoner
Male User Gallery

Registered: 06/04/06
Posts: 86
Last seen: 6 years, 5 months
Re: Cigarettes! [Re: whatever123]
    #5743603 - 06/12/06 10:38 PM (6 years, 11 months ago)

I am a former smoker and i have been clean for a month with no desire for a cigarette. All i can say is that it is a nasty, expensive habit.


--------------------
"Try not to let your mind wander, it might not come back"


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinedeadheadjpc2000
Blade
Male

Registered: 02/27/06
Posts: 1,277
Loc: Emerald Triangle, U.S.A.
Last seen: 4 years, 10 months
Re: Cigarettes! [Re: PSylopHiLe]
    #5745715 - 06/13/06 03:20 PM (6 years, 11 months ago)

And former smokers are the worst...


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Cigarettes! [Re: deadheadjpc2000]
    #5747173 - 06/13/06 10:14 PM (6 years, 11 months ago)

Yeah, that first poll was damn terrible.

How about a "have you ever tried to quit? how the hell did that go?" poll.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineMaverick
Lover of Earwigs!
Male User Gallery

Folding@home Statistics
Registered: 12/18/05
Posts: 10,794
Loc: Northern Nevada Flag
Last seen: 6 hours, 34 minutes
Re: Cigarettes! [Re: Koala Koolio]
    #5747176 - 06/13/06 10:15 PM (6 years, 11 months ago)

I finally quit smoking I think. I quit about a week ago. Should I pick it up again? ;P


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineEkstaza
stranger thanmost
 User Gallery

Registered: 04/11/03
Posts: 4,315
Loc: Around the corner
Last seen: 4 days, 13 hours
Re: Cigarettes! [Re: Maverick]
    #5747651 - 06/14/06 12:19 AM (6 years, 11 months ago)

Let's see, I started smoking at about age 12 and quit for a year when I was in high school. I started back because I wanted to date this chick who smoked. Real DUMB. I smoked from then on(except for 2 months when Uncle Sam had control of it) to the age of about 25 when I used the nicotine lozenges to kick the habit for another year. New Years Eve '03 was a blast. Lots of X and plenty of smokes. Newports go so well with MDMA. It's been off and on since then sometimes making it to the 6 month point only to give in while drunk. At the moment, I'm off of them with every intention of staying quitter. That reminds me, I NEED ANOTHER NICOTINE LOZENGE!

True Story


--------------------
YOUR EXPERIENCE WITH ANY GIVEN DRUG ISN'T THE DEFINITIVE MEASURE OF THE DRUGS EFFECTS.


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinevintage_gonzo
Stranger

Registered: 04/08/06
Posts: 457
Last seen: 5 years, 2 months
Re: Cigarettes! [Re: Ekstaza]
    #5747670 - 06/14/06 12:24 AM (6 years, 11 months ago)

i smoke cloves. they give a much greater buzz that marlboro lights ever did and taste better


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Cigarettes! [Re: vintage_gonzo]
    #5747908 - 06/14/06 01:37 AM (6 years, 11 months ago)

... and are much worse for you. :smile:


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineIamthewalrus
every evening Idied and everynight I wasreborn
Male User Gallery

Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 4 years, 7 months
Re: Cigarettes! [Re: Koala Koolio]
    #5748780 - 06/14/06 08:33 AM (6 years, 11 months ago)

I smoke but want to quit


Post Extras: Print Post  Remind Me! Notify Moderator
Jump to top. Pages: 1 | 2 | Next >  [ show all ]

Feedback and Administration >> Shroomery Polls

Similar ThreadsPosterViewsRepliesLast post
* Smokers: Cigs, Weed, Both, Or None?
( 1 2 all )
Lifenergy 4,131 39 08/01/08 11:32 PM
by NIMH
* Cigarettes: addictive or not? moog 884 14 06/19/05 03:22 PM
by Redstorm
* Do You Smoke Cigarettes?
( 1 2 all )
EffedM 2,670 30 04/17/04 03:45 AM
by Gumby
* What you smoke?
( 1 2 all )
mystery
2,182 25 07/09/07 10:44 PM
by RedRabbit
* Cigarettes MisterMuscaria 998 14 07/29/08 02:19 AM
by flibius
* Have you ever smoked laced weed and had a bad trip?
( 1 2 3 all )
EmbracingShadows 19,262 52 03/18/10 11:54 PM
by Ms.BuzzLightBeer
* Do you smoke pot everyday?
( 1 2 3 all )
Stonerguy 3,733 49 06/02/06 11:12 AM
by inoculatedGreif
* Do you smoke pot?
( 1 2 3 4 all )
TheHateCamel 7,439 64 03/20/07 12:38 PM
by Meedio

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Ythan, Anno, Thor, Link, Seuss, geokills, Wiccan_Seeker
1,568 topic views. 0 members, 1 guests and 0 web crawlers are browsing this forum.
[ Toggle Favorite | Print Topic ]
Search this thread:
Myco Supply
Please support our sponsors.

Copyright 1997-2013 Mind Media. Some rights reserved.

Generated in 0.105 seconds spending 0.056 seconds on 31 queries.