|
 Wiccan_Seeker
INFJcounselor-idealist
 
Registered: 02/06/02
Posts: 23,156
Loc: Virgo Supercluster (or b...
Last seen: 5 hours, 23 minutes
|
 Poppies - from Poppyseed to Opium 
#4016111 - 04/05/05 09:15 AM (5 years, 4 months ago) |
|
|
Log in to view attachment
The above file is the entire thread until July 25 2006
Poppies - from Poppyseed to Opium.
Okay, Shroomerites, this is an open-and-shut case: As for my second post in this thread: You CUT it, you PASTE it, you PRINT it and ?then- you READ it!
If you have an interest in Poppies, growing pretty flowers and beautiful pods for your floral arrangements or perhaps other poppy pleasures, then this thread is for you!
The next post is about 8 printed pages and it tells you just about everything that is known regarding poppies from seed to opium. Beware that anything beyond culinary use of poppyseed, or sowing culinary poppyseed itself, is a criminal act in many countries. This edited version of a DEA manuscript I?ve found online will blow you away with anything you ever wanted to know about this plant. In case you wonder: yes, it is the viable poppyseed you can find in the supermarket spice rack that the following document is about, so don?t (accidentally or otherwise) break any local laws.
The following document is provided for informational purposes only, be warned that there may be severe laws against poppies and their products where you live, that high dosages of even poppyhead tea can be lethal and that upon slight misuse poppy products are ?very likely- to destroy your life through habituation and addiction. Opium and plant parts containing it are to be considered Hard Drugs, often legally but certainly in their (mis)use.
If you have any information to add that's useful and not covered or detailed by said post, please post it. Let's make this thread The Mother Of All Poppy-Posts 
Please do not post about heroin or synthetics, painkillers or other such shite: this thread is about the Opium Poppy, Papaver Somniferum, and the natural products of this plant that require no chemical treatments nor go beyond Opium.
This thread is all about the Poppy!
And now, here comes the best poppy-post you ever read in your life, thanks to the DEA and the true ?drug warriors? who have put it online in the public domain!
Edited by Wiccan_Seeker (07/27/06 09:17 AM)
|
Wiccan_Seeker
INFJcounselor-idealist
Registered: 02/06/02
Posts: 23,156
Loc: Virgo Supercluster (or b...
Last seen: 5 hours, 23 minutes
|
 Re: Poppies -- from Poppyseed to Opium [Re: Wiccan_Seeker]
#4016118 - 04/05/05 09:16 AM (5 years, 4 months ago) |
|
|
POPPIES -- FROM POPPYSEED TO OPIUM
Opium is the name for the latex produced within the seed pods of the opium poppy, Papaver somniferum. The plant is believed to have evolved from a wild strain, Papaver setigerum, which grows in coastal areas of the Mediterranean Sea. Through centuries of cultivation and breeding for opium, the species somniferum evolved. Today, P. somniferum is the only species of Papaver used to produce opium. Opium contains morphine, codeine, noscapine, papaverine, and thebaine. All but thebaine are used clinically as analgesics to reduce pain without a loss of consciousness. Thebaine is without analgesic effect but is of great pharmaceutical value due to its use in the production of semisynthetic opioid morphine analogues such as oxycodone (Percodan), dihydromorphenone (Dilaudid), and hydrocodone (Vicodin).
The psychological effects of opium may have been known to the ancient Sumerians (circa 4,000 B.C.) whose symbol for poppy was hul, "joy" and gil, "plant". The plant was known in Europe at least 4,000 years ago as evidenced by fossil remains of poppy seed cake and poppy pods found in the Neolithic Swiss Lake Dwellings. Opium was probably consumed by the ancient Egyptians and was known to the Greeks as well. Our word opium is derived from the Greek. The poppy is also referred to in Homer's works the Iliad and the Odyssey (850 B.C.). Hippocrates (460-357 B.C.) prescribed drinking the juice of the white poppy mixed with the seed of nettle.
The opium poppy probably reached China about the fourth century A.D. through Arab traders who advocated its use for medicinal purposes. In Chinese literature, there are earlier references to its use. The noted Chinese surgeon Hua To of the Three Kingdoms (220-264 A.D.) used opium preparations and Cannabis indica for his patients to swallow before undergoing major surgery.
The beginning of widespread opium use in China is associated with the introduction of tobacco smoking in pipes by Dutch from Java in the 17th century. The Chinese mixed Indian opium with the tobacco, two products that were being traded by the Dutch. This practice was adopted throughout the region and predictably resulted in increased opium smoking, both with and without tobacco.
By the late-1700s the British East India Company controlled the prime Indian poppy growing regions and dominated the Asian opium trade. By 1800, they had a monopoly on opium; controlling supply and setting prices.
In 1805, the German pharmacist Friedrich W. Serturner isolated and described the principal alkaloid and powerful active ingredient in opium. He named it morphium after Morpheus, the Greek god of dreams. We know it today as morphine. This event was soon followed by the discovery of other alkaloids of opium: codeine in 1832 and papaverine in 1848. By the 1850s these pure alkaloids, rather than the earlier crude opium preparations, were being commonly prescribed for the relief of pain, cough, and diarrhea. This period also saw the invention and introduction of the hypodermic syringe.
By the late eighteenth century opium was being heavily used in China as a recreational drug. The Imperial court had banned its use and importation but large quantities were still being smuggled into China. In 1839 the Qing Emperor ordered his minister Lin Zexu to address the opium problem. Lin petitioned Queen Victoria for help but was ignored. In reaction, the emperor confiscated 20,000 barrels of opium and detained some foreign traders. The British retaliated by attacking the port city of Canton. Thus the First Opium War began. The Chinese were defeated and the Treaty of Nanjing was signed in 1842. The British required that the opium trade be allowed to continue, that the Chinese pay a large settlement, and that the Chinese cede Hongkong to the British Empire. The Second Opium War began and ended in 1856 over western demands that opium markets be expanded. The Chinese were again defeated and opium importation to China was legalized.
In the United States during the 19th century, opium preparations and 'patent medicines' containing opium extract such as paregoric (camphorated tincture of opium) and laudanum (deodorized opium tincture) became widely available and quite popular. In the 1860s morphine was used extensively pre- and post-operatively as a painkiller for wounded soldiers during the Civil War. Civil War physicians frequently dispensed opiates. In 1866 the Secretary of War stated that during the war the Union Army was issued 10 million opium pills, over 2,840,000 ounces of other opiate preparations (such as laudanum or paregoric), and almost 30,000 ounces of morphine sulphate. The inevitable result was opium addiction, called the 'army disease' or the 'soldier's disease.' These opium and morphine addiction problems prompted a scientific search for potent but nonaddictive painkillers. In the 1870s, chemists synthesized a supposedly non-addictive, substitute for morphine by acetylating morphine. In 1898 the Bayer pharmaceutical company of Germany was the first to make available this new drug, 3,6-diacetylmorphine, in large quantities under the trademarked brand name Heroin. 3,6-diacetylmorphine is two to three times more potent than morphine. Most of the increase is due to its increased lipid solubility, which provides enhanced and rapid central nervous system penetration.
In December 1914, the United States Congress passed the Harrison Narcotics Act which called for control of each phase of the preparation and distribution of medicinal opium, morphine, heroin, cocaine, and any new derivative that could be shown to have similar properties. It made illegal the possession of these controlled substances. The restrictions in the Harrison Act were most recently redefined by the Federal Controlled Substances Act of 1970. The Act lists as a Schedule II Controlled Substance opium and its derivatives and all parts of the P. somniferum plant except the seed.
In 1997, Southeast Asia still accounts for well over half of the world's opium production. It is estimated that the region has the capacity to produce over 2 kT (2.000 metric tons) of Opium annually.
The chemical structure of opiates is very similar to that of naturally produced compounds called endorphins and enkephalins. These compounds are derived from an amino acid pituitary hormone called beta-lipotropin which when released is cleaved to form met-enkephalin, gamma-endorphin, and beta-endorphin. Opiate molecules, due to their similar structure, engage many of the endorphins' nerve-receptor sites in the brain's pleasure centers and bring about similar analgesic effects. In the human body, a pain stimulus usually exites an immediate protective reaction followed by the release of endorphins to relieve discomfort and reward the mental learning process. Opiates mimic high levels of endorphins to produce intense euphoria and a heightened state of well-being. Regular use results in increased tolerance and the need for greater quantities of the drug. Profound physical and psychological dependence results from regular use and rapid cessation brings about withdrawal sickness.
In addition to the pleasure/pain centers, there is also a concentration of opiate receptors in the respiratory center of the brain. Opiates have an inhibiting effect on these cells and in the case of an overdose, respiration can come to a complete halt. Opiates also inhibit sensitivity to the impulse to cough.
A third location for these receptors is in the brain's vomiting center. Opiate use causes nausea and vomiting. Tolerance for this effect is built up very quickly. Opiates effect the digestive system by inhibiting intestinal peristalsis. Long before they were used as painkillers, opiates were used to control diarrhea.
The opium poppy, Papaver somniferum, is an annual plant. From a very small round seed, it grows, flowers, and bears fruit (seed pods) only once. The entire growth cycle for most varieties of this plant takes about 120 days. The seeds of P. somniferum can be distinguished from other species by the appearance of a fine secondary fishnet reticulation within the spaces of the coarse reticulation found all over their surface. When compared with other Papaver species, P. somniferum plants will have their leaves arranged along the stem of the plant, rather than basal leaves, and the leaves and stem will be 'glabrous' (hairless). The tiny seeds germinate quickly, given warmth and sufficient moisture. Sprouts appear in fourteen to twenty-one days. In less than six weeks the young plant has grown four large leaves and resembles a small cabbage in appearance. The lobed, dentate leaves are glaucous green with a dull gray or blue tint.
Within sixty days, the plant will grow from one to two feet in height, with one primary, long, smooth stem. The upper portion of this stem is without leaves and is the 'peduncle'. One or more secondary stems, called 'tillers', may grow from the main stem of the plant. Single poppy plants in Southeast Asia often have one or more tillers.
As the plant grows tall, the main stem and each tiller terminates in a flower bud. During the development of the bud, the peduncle portion of the stem elongates and forms a distinctive 'hook' which causes the bud to be turned upside down. As the flower develops, the peduncle straightens and the buds point upward. A day or two after the buds first point upward, the two outer segments of the bud, called 'sepals,' fall away, exposing the flower petals.
Opium poppies generally flower after about ninety days of growth and continue to flower for two to three weeks. The exposed flower blossom is at first crushed and crinkled, but the petals soon expand and become smooth in the sun. Opium poppy flowers have four petals. The petals may be single or double and may be white, pink, reddish purple, crimson red, or variegated. The petals last for two to four days and then drop to reveal a small, round, green fruit which continues to develop. These fruits or pods (also called 'seedpods', 'capsules,' 'bulbs,' or 'poppy heads') are either oblate, elongated, or globular and mature to about the size of a chicken egg. The oblate-shaped pods are more common in Southeast Asia.
The main stem of a fully-matured P. somniferum plant can range between two to five feet in height. The green leaves are oblong, toothed and lobed and are between four to fifteen inches in diameter at maturity. The mature leaves have no commercial value except for use as animal fodder.
Only the pod portion of the plant can produce opium alkaloids. The skin of the poppy pod encloses the wall of the pod ovary. The ovary wall consists of an outer, middle, and inner layer. The plant's latex (opium) is produced within the ovary wall and drains into the middle layer through a system of vessels and tubes within the pod. The cells of the middle layer secrete more than 95 percent of the opium when the pod is scored and harvested.
Cultivators in Mainland Southeast Asia tap the opium from each pod while it remains on the plant. After the opium is scraped, the pods are cut from the stem and allowed to dry. Once dry, the pods are cut open and the seeds are removed and dried in the sun before storing for the following year's planting. An alternative method of collecting planting seeds is to collect them from intentionally unscored pods, because scoring may diminish the quality of the seeds. Aside from being used as planting seed, the poppy seeds may also be used in cooking and in the manufacture of paints and perfumes. Poppy seed oil is straw-yellow in color, odorless, and has a pleasant, almond-like taste. The opium poppy grows best in temperate, warm climates with low humidity. It requires only a moderate amount of water before and during the early stages of growth. In addition, it is a 'long day' photo-responsive plant. As such, it requires long days and short nights before it will develop flowers.
The opium poppy plant can be grown in a variety of soils; clay, sandy loam, sandy, and sandy clay, but it responds best to sandy loam soil. This type of soil has good moisture-retentive and nutrient-retentive properties, is easily cultivated, and has a favorable structure for root development. Clay soil types are hard and difficult to pulverize into a good soil texture. The roots of a young poppy plant cannot readily penetrate clay soils, and growth is inhibited. Sandy soil, by contrast, does not retain sufficient water or nutrients for proper growth of the plant.
Excessive moisture or extremely arid conditions will adversely affect the poppy plant's growth and reduce the alkaloid content. Poppy plants can become waterlogged and die after a heavy rainfall in poorly drained soil. Heavy rainfall in the second and third months of growth can leach alkaloids from the plant and spoil the opium harvest. Dull, rainy, or cloudy weather during this critical growth period may reduce both the quantity and the quality of the alkaloid content.
Opium poppies were widely grown as an ornamental plant and for seeds in the United States until the possession of this plant was declared illegal in the Opium Poppy Control Act of 1942. New generations of plants from the self-sown seed of these original poppies can still be seen in many old ornamental gardens.
The major legal opium poppy growing areas in the world today are in govemment-regulated opium farms in lndia, Turkey and Tasmania, Australia. The major illegal growing areas are in the highlands of Mainland Southeast Asia, specifically Burma (Myanmar), Laos, and Thailand, as well as the adjacent areas of southern China and northwestern Vietnam. The area is known as the 'Golden Triangle'. In Southwest Asia, opium poppies are grown in Pakistan, Iran, and Afghanistan. Opium poppy is also grown in Lebanon, Guatemala, Colombia and Mexico.
The highlands of Mainland Southeast Asia, at elevations of 800 meters or more above sea level, are prime poppy growing areas. Generally speaking, these poppy-farming areas do not require irrigation, fertilizer, or insecticides for successful opium yields.
Most of the opium poppies of Southeast Asia are grown in Burma (Myamnar), specifically in the Wa and Kokang areas which are in the northeastern quadrant of the Shan State of Burma. Laos is the second-largest illicit opium-producing country in Southeast Asia and third-largest in the world.
In Laos, poppy is cultivated extensively in Houaphan and Xiangkhoang Provinces, as well as the six other northern provinces: Bokeo, Louangnamtha, Louangphabang, Oudomxai, Phongsali and Xaignabouli. Poppy is also grown in many of the remote, mountainous areas of northern Thailand, particularly in Chiang Mai, Chiang Rai, Mae Hong Son, Nan and Tak Provinces.
In China, opium poppies are cultivated by ethnic minority groups in the mountainous frontier regions of Yunnan Province, particularly along the border area with Burma's Kachin and Shan States. Son La Province, situated between China and Laos, is a major opium poppy cultivation area in Vietnam, as are Lai Chau and Nghe An Provinces.
It is noteworthy that the dominant ethnic groups of Mainland Southeast Asia are not poppy cultivators. The Burmans and Shan of Burma, the Lao of Laos, the Thai of Thailand, the Han Chinese of Yunnan, China, and the Vietnamese of Vietnam are lowlanders and do not traditionally cultivate opium poppies. Rather, it is the ethnic minority highlander groups, such as the Wa, Pa-0, Palaung, Lahu, Lisu, Hmong, and Akha who grow poppies in the highlands of the countries of Southeast Asia.
A typical nuclear family of Mainland Southeast Asian highlanders ranges between five and ten persons, including two to five adults. An average household of poppy farmers can cultivate and harvest about one acre of opium poppy per year. Most of the better fields can support opium poppy cultivation for ten years or more without fertilization, irrigation, or insecticides, before the soil is depleted and new fields must be cleared. In choosing a field to grow opium poppy, soil quality and acidity are critical factors and experienced poppy farmers choose their fields carefully. In Southeast Asia, westerly orientations are typically preferred to optimize sun exposure. Most fields are on mountain slopes at elevations of 1,000 meters (3,000 feet) or more above sea level. Slope gradients of 20 degrees to 40 degrees are considered best for drainage of rain water.
In Mainland Southeast Asia, virgin land is prepared by cutting and piling all brush, vines and small trees in the field during March, at the end of the dry season. After allowing the brush to dry in the hot sun for several days, the field is set afire. This method, called 'slash-and burn' or 'swidden' agriculture, is commonly practiced by dry field farmers - both highland and lowland - throughout Mainland Southeast Asia in order to ready the land for a variety of field crops. The slash-and-burn method is also used to clear fields for poppy cultivation. Before the rainy season in April, fields by the hundreds of thousands all over the region are set ablaze. A fog-like yellow haze hangs over the area for weeks, reducing visibility for hundreds of miles. In the mountains, the dense haze blocks out the sun and stings the eyes.
A typical highlander family will plant an area of two or three rai in opium poppy (2.53 rai is equivalent to one acre). In August or September, toward the end of the rainy season, highland farmers in Southeast Asia prepare fields selected for opium poppy planting. By this time, the ash resulting from the burn-off of the previous dry season has settled into the soil, providing additional nutrients, especially potash. The soil is turned with long-handled hoes after it is softened by the rains. The farmers then break up the large clumps of soil. Weeds and stones are tossed aside and the ground is leveled off.
Traditionally, most highland and upland farmers in Southeast Asia do not use fertilizer for any of their crops, including the opium poppy, but in recent years opium poppy farmers have started using both natural and chemical fertilizers to increase opium poppy yields. Chicken manure, human feces or the regions' abundant bat droppings are often mixed into the planting soil before the opium poppy seed is planted.
The planting must be completed by the end of October in order to take advantage of the region's 'long days' in November and December.
The opium poppy seed can be sown several ways: broadcast (tossed by hand); or fix-dropped by hand into shallow holes dug with a metal-tipped dibble stick. About one pound of opium poppy seed is needed to sow one acre of land. The seeds may be white, yellow, coffee-color, gray, black, or blue. Seed color is not related to the color of the flower petals. Beans, cabbages, cotton, parsley, spinach, squash and tobacco are crops typically planted with the opium poppy. These crops neither help nor hinder the cultivation of the opium poppy, but are planted for personal consumption or as a cash crop.
In the highlands of Southeast Asia, it is a common practice to plant maize and opium poppies in the same fields each year. The maize keeps down excessive weeds and provides feed for the farmer's pigs and ponies. It is grown from April to August. After harvesting the maize, and with the stalks still standing in the fields, the ground is weeded and pulverized. Just before the end of the rainy season, in successive sowings throughout September and October, the poppy seed is broadcast among the maize stalks. These stalks can protect young opium poppy plants from heavy rains.
The opium poppy plants form leaves in the first growth stage, called the 'cabbage' or 'lettuce' stage. After a month of growth, when the opium poppy is about a foot high, some of the plants are removed (called 'thinning') to allow the other plants more room to grow. The ideal spacing between plants is believed to be 20 to 40 centimeters, or about eight to twelve plants per square meter, although some researchers in northern Thailand have reported as many as 18 plants per square meter.
During the first two months, the opium poppies may be damaged or stunted by nature through the lack of adequate sunshine, excessive rainfall, insects, worms, hail storms, early frost, or trampling by animals. The third month of growth does not require as much care as the first two months. Three to four months after planting, from late December to early February, the opium poppies are in full bloom.
Mature plants range between three to five feet in height. Most opium poppy varieties in Southeast Asia produce three to five mature pods per plant. A typical opium poppy field has 60,000 to 120,000 poppy plants per hectare, with a range of 120,000 to 275,000 opium-producing pods. The actual opium yield will depend largely on weather conditions and the precautions taken by individual farmers to safeguard the crop. The farmer and his family generally move into the field for the final two weeks, setting up a small field hut on the edge of the opium poppy field.
The scoring of the pods (also called 'lancing,' 'incising,' or 'tapping') begins about two weeks after the flower petals fall from the pods. The farmer examines the pod and the tiny crown portion on the top of the pod very carefully before scoring.
The grayish-green pod will become a dark green color as it matures and it will swell in size. If the points of the pod's crown are standing straight out or are curved upward, the pod is ready to be scored. If the crown's points turn downward, the pod is not yet fully matured. Not all the plants in a field will be ready for scoring at the same time and each pod can be tapped more than once.
A set of three or four small blades of iron, glass, or glass splinters bound tightly together on a wooden handle is used to score two or three sides of the pod in a vertical direction. If the blades cut too deep into the wall of the pod, the opium will flow too quickly and will drip to the ground. If the incisions are too shallow, the flow will be too slow and the opium will harden in the pods. A depth of about one millimeter is desired for the incision.
Using a blade-tool designed to cut to that depth, scoring ideally starts in late afternoon so the white raw opium latex can ooze out and slowly coagulate on the surface of the pod overnight. If the scoring begins too early in the afternoon, the sun will cause the opium to coagulate over the incision and block the flow. Raw opium oxidizes, darkens and thickens in the cool night air. Early the next morning, the opium gum is scraped from the surface of the pods with a short-handled, flat, iron blade three to four inches wide.
Opium harvesters work their way backwards across the field scoring the lower, mature pods before the taller pods, in order to avoid brushing up against the sticky pods. The pods continue to produce opium for several days. Farmers will return to these plants - sometimes up to five or six times - to gather additional opium until the pod is totally depleted. The opium is collected in a container which hangs from the farmer's neck or waist.
The opium yield from a single pod varies greatly, ranging from 10 to 100 milligrams of opium per pod. The average yield per pod is about 80 milligrams. The dried opium weight yield per hectare of poppies ranges from eight to fifteen kilograms.
As the farmers gather the opium, they will commonly tag the larger or more productive pods with colored string or yarn. These pods will later be cut from their stems, cut open, dried in the sun and their seeds used for the following year's planting.
The wet opium gum collected from the pods contains a relatively high percentage of water and needs to be dried for several days. High-quality raw opium will be brown (rather than black) in color and will retain its sticky texture. Experienced opium traders can quickly determine if the opium has been adulterated with tree sap, sand, or other such materials. Raw opium in Burma, Laos and Thailand is usually sun-dried, weighed in a standard 1.6 kilogram quantity (called a 'viss' in Burma; a 'choi' in Laos and Thailand), wrapped in banana leaf or plastic and then stored until ready to sell, trade, or smoke. While opium smoking is common among most adult opium poppy farmers, heavy addiction is generally limited to the older, male farmers. The average yearly consumption of cooked opium per smoker is estimated to be 1.6 kilograms.
A typical opium poppy farmer household in Southeast Asia will collect 2 to 5 choi or viss (3 to 9 kilograms) of opium from a year's harvest of a one-acre field. That opium will be dried, wrapped and stacked on a shelf by February or March. If the opium has been properly dried, it can be stored indefinitely. Excessive moisture and heat can cause the opium to deteriorate but, once dried, opium is relatively stable. In fact, as opium dries and becomes less pliable, its value increases due to the decrease in water weight per kilogram.
Before opium is smoked, it is usually 'cooked'. Uncooked opium contains moisture, as well as soil, leaves, twigs, and other impurities which diminish the quality of the final product.
The raw opium collected from the opium poppy pods is placed in an open cooking pot of boiling water where the sticky globs of opium alkaloids quickly dissolve. Soil, twigs, plant scrapings, etc., remain undissolved. The solution is then strained through cheesecloth to remove these impurities. The clear brown liquid that remains is opium in solution, sometimes called 'liquid opium'. This liquid is then re-heated over a low flame until the water is driven off into the air as steam leaving a thick dark brown paste. This paste is called 'prepared', 'cooked', or 'smoking' opium. It is dried in the sun until it has a putty-like consistency. The net weight of the cooked opium is generally only eighty percent that of the original raw opium. Thus, cooked opium is more pure than its original, raw form, and has a higher monetary value.
Cooked opium is suitable for smoking or eating by opium users. Traditionally there is only one group of opium poppy farmers, the Hmong, who prefer not to cook their opium before smoking. Most other ethnic groups, including Chinese opium addicts, prefer smoking cooked opium. Raw or cooked opium contains more than thirty-five different alkaloids, including morphine, which accounts for approximately ten percent of the total raw opium weight.
|
 Cloud9
I don't feel, and it feels great
Registered: 07/03/03
Posts: 867
Loc: between here and there
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#4016136 - 04/05/05 09:24 AM (5 years, 4 months ago) |
|
|
Good info, thx for the post.
--------------------
 .
|
esin
cheesefondue
Registered: 11/21/01
Posts: 1,275
Loc: Lysergia
Last seen: 9 months, 6 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#4016383 - 04/05/05 10:56 AM (5 years, 4 months ago) |
|
|
Great write-up! Thanks!
One minor correction, the hypothesis that Papaver Somniferum originates from the mediterranean Papaver Setigerum has been disproven.
Quote:
The plant is closely related to opium poppy P. somniferum L. and some authors have treated it as a variety or sub-species of that species. Rouy and Foucand ([13] ) and Bonnier [(12)] listed it as a sub-species in floras dealing with southwestern Europe.
The cytological evidence of a close affinity between P setigerum and P somniferum is discussed by Fulton ([14] ). P. somniferum is diploid ( n=11) and P. setigerum is tetraploid ( n=22) with exactly twice the number of chromosomes. No other species of Papaver is known to have the number n=11 or a multiple of this number. This information indicates that P setigerum is not the wild ancestral species of the cultivated P somniferum, as was formerly believed since a diploid would not be derived from a tetraploid plant.
from: Detection of Morphine in Papaver setigerum DC
|
Wiccan_Seeker
INFJcounselor-idealist
Registered: 02/06/02
Posts: 23,156
Loc: Virgo Supercluster (or b...
Last seen: 5 hours, 23 minutes
|
Re: Poppies -- from Poppyseed to Opium [Re: esin]
#4016453 - 04/05/05 11:24 AM (5 years, 4 months ago) |
|
|
Interesting!
Your paper identifies Morphine as being a significant component of Papaver Setigerum, which means a whole range of opium alkaloids will be present and the dried juice of P.Setigerum can be considered an "Opium" albeit likely an inferior one.
BUT: The Controlled Substances schedules identify it thus:
"Opium poppy" means the plant of the species papaver somniferum L., except the seeds thereof.
This means that if you have a field of Papaver setigerum it is *not* an Opium Poppy field as described by US law, but if you do certain things to it you end up with "a preparation containing morphine" which ofcourse *is* illegal. Since many countries define their controlled substances definitions to the American template, this means that in many countries living plants of Papaver setigerum are *not* Opium Poppies by law because Papaver setigerum is NOT a somniferum.
...strictly speaking a floral arrangement of setigerum bulbs are not "Opium poppy capsules", but setigerum-opium would be a felony:
"Poppy straw" means all parts, except the seeds of the opium poppy, after mowing.
And Opium Poppy, if you recall, is defined as Somniferum only. Looks like a loophole in the US law which is interesting, but in a real court you would ofcourse be unconstitutionally nailed and haled off to prison with a fat mandatory minimum for smartassery.
But if these are the definition of all the lawtext on the topic, then your house could be one huge floral arrangement, your garden a Setigerum field and no *FAIR* judge could condemn you for it.
Edited by Wiccan_Seeker (04/06/05 03:31 PM)
|
MycoCakeEater
Old Hand
Registered: 06/16/03
Posts: 1,548
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#4016672 - 04/05/05 12:29 PM (5 years, 4 months ago) |
|
|
Alright, my turn. 
1. Introduction
The Opium Poppy(Papaver Somniferum) is the worlds most controversial flower. While some use it for the beautiful flowers, others use it for cooking,relive from pain,and best of all,for recreational and spiritual purposes. But beware,as frequent as the use comes, addiction follows. In no way is this drug to be abused, or you may be abused your self by Mother Opium. Opium is both an angel and a demon.Now without delay let the guide begin.
2. A Basic Rundown on the Opium Alkaloids
Opium is made of four main alkaloids morphine, codeine, thebaine and papaverine.About twenty other alkaloids exist in opium but they have little or no significance medically or economically. A number of other "opium alkaloids" are commercial products and are used medically(hydrocodone), but?they are not obtained directly from opium, but by conversion of morphine, codeine and thebaine.
Morphine being the most prevalent, Most raw opium usually has between 8% and 19% of morphine.The second most prevalent, but just as, is Codeine.The codeine content of opium is related inversely to the morphine content but only in a general way. Codeine percentage in opium can range from 1% to over 3%.The third most prevalent are Thebaine & Papaverine. Thebaine is the most poisonous opium alkaloid and is scarcely used medically.However, it is converted into several other products: hydrocodone & oxycodone.Papaverine has a considerable medical use, so much so that supplies available from opium have sometimes run short. It is then manufactured synthetically.
3. Growing
In the United States and Canada, poppy seeds are perfectly legal. This is because, like our very loved mushroom spores, poppy seeds do not actually contain any of the alkaloids that are in the fully-grown poppy plant.You can purchase seeds from many online retailers, gardening stores, hardware stores, and florists.
There are many strains of papaver:
Nigrum - White and purple Opium Poppies that produce whimsical, often peony-like flowers that mature to medium-sized pods of decent yield.
Persian Whites - These Opium Poppies produce gorgeous white flowers, and are considered a "high-yield" strain. They make an excellent addition to any garden, indoors or out.
Tazmanian - Big and beautiful, Tazmanian poppies are one of the largest somniferum strains. Considered by many to be the "best of the best", Tazmanian poppies produce monster-sized pods that produce many seeds with each generation.
Hens and Chicks - A unique pod that is composed of 1 main pod surrounded by 20-30 smaller pods.
Giganthemum- The largest opium poppy pod, size can range from golf ball to baseball sized pods. Yield is VERY good.
For this grow, our strain of choice Giganthemum (these are planted in the late fall in SE US, due to freak weather during weather they were growing but slowly through the winter) 
First we have to start with a few seeds.........
After about 2 weeks you'll see some seedlings like these. Its time to thin guys 
Then after a couple of weeks.....
Now lets fast forward a couple weeks.....
And a few more weeks of an unusual mild winter..........
And now its Spring time, and now they are officially supposed to grow and that they are!................
And now ladies and gents is the poppies as of today (April 05)
Lets say about 2 months from now  .............
When the pod is ready to slice......
And the final product...........
Now lets say that smoking opium just isn't your thing.
MCE's Poppy Tea Recipe
Grind pods into a flour with a coffee grinder, put the grounds into your French press. Now boil some water to a rolling boil. Take the water off of the heat and pour into your french press. Put the top on the french press, and push down the strainer so that the poppy straw is 1/3 down in the water. Slowly move it down throughout 10 minutes. Pour, add honey and fresh mint leaves. Enjoy!
All for now.
Be Safe. Be Responsible. Be Happy.
Thanks, MycoCakeEater
|
Wiccan_Seeker
INFJcounselor-idealist
Registered: 02/06/02
Posts: 23,156
Loc: Virgo Supercluster (or b...
Last seen: 5 hours, 23 minutes
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: MycoCakeEater]
#4017039 - 04/05/05 02:08 PM (5 years, 4 months ago) |
|
|
Wow! Just.. -wow- Beautiful photoshoot and a well-illustrated TEK!
Now let me take the stick from you and add some more.
This installment shall be from my herbal grimoire: LEMON LAUDANUM
Poppyheads contain Opium, because the juice has dried up in the pods. Unfortunately it also contains lots of other constituents which do not help the taste. Now the standard way to extract poppyheads is to make a tea of them. This tastes pretty foul in my opinion and far worse: it negatively affects both potency and richness of the experience, because many alkaloids are stripped from the opium that really ought to be in there. This happens because of heating over 70'C which destroys the Meconic acid which makes the alkaloids more soluble. Meconic acid and Narcotine/noscapine significantly potentiate the Opium without being true narcotics themselves.
To remedy the flavor and extract the whole opium into a tasty beverage I have developed my "Lemon Laudanum".
Be warned that Lemon Laudanum may be highly illegal, but it truely is highly addictive and not forgiving of overdose.
Firstly a quantity of poppyheads is ground to a powder and mixed well. The strength of this is determined. An oral dosage of standardized opium tends to lie in the range of 1-3 grains which is roughly 50-200mg. This strength is usually contained in 2-10gr ground poppyheads, with 4 grams usually falling between these extremes.
Then you know said batch has a given dosage per portion. You could then proceed to make Lemon Laudanum.
LEMON LAUDANUM
water................1/2 liter
lemon juice..........1 lemon/oz
honey................3 tablespoons
ground poppyheads....1 measured dose
1...put the water, honey and lemon juice in an empty 1 liter soda bottle.
2...put this in the refrigerator and chill.
3...add the ground poppyheads and vigorously shake.
4...put this in the refridgerator for at least 2 hours or 12 hours at most.
You can do all this before bedtime and wake up to a laudanum breakfast! It hits you best that way, on a completely empty stomach.
5...pour the liquid through a handkerchief and squeeze the liquid from the "dog", as poppy residue is often called.
6...drink the Lemon Laudanum ice cold and with determination.
It will come on strong rather rapidly on an empty stomach, will plateau after 1-2 hours and lasts the full 8-10 hours.
Once a year or less often I drink my Laudanum, and I've skipped over a year now. Perhaps this year I'll imbide again. You must make it a special occasion. My last occasion was with my mother in 2003, a mere few months before she died, where I showed her the satisfaction of poppies despite her depression. My next occasion will likely be with my best friends to celebrate the coming of the good season, spring or summer. (winters are cold here) It will be a celebration of friendship, chillin' in the forest on a warm day and it will be their first time to meet Opium. They're very experienced Travellers and want to taste the pleasures. Who can blame them. I'm educating them every now and then for months now so they can reconsider their desire to imbide.
A nearby park has a corner with good poppies, so that part's but minor. I could've harvested the shit out of that public patch year after year, or sown culinaries in the forest, but a few bulbs for tea are all you really need if you keep it a harmless pleasure.
And if you have nothing to binge on, you won't be able to find yourself craving the Opium after one such binge.
Personally I say: Once a year, or less, or not at all. And for me that works, because i realize that the opposite of that Heaven must be Hell.
|
Wiccan_Seeker
INFJcounselor-idealist
Registered: 02/06/02
Posts: 23,156
Loc: Virgo Supercluster (or b...
Last seen: 5 hours, 23 minutes
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#4017329 - 04/05/05 03:07 PM (5 years, 4 months ago) |
|
|
About lancing pods:
Some years ago AFOAF sowed some poppyseeds. No devious intent, he just wanted to see if it could be done with spicerack poppies.
And it -could- be done. Over small lettuces stood a few walnut-sized bulbs on top of gracefully curved stalks.
So to see if it could be done he decided to lance the poppyheads one evening, using a throw-away boxcutter blade. His plan was to score three slits on either side of the pod but ended up doing three slits on one quarter of each pod. His first lancing cut right through the surprisingly thin wall making the juice drip inside the pod.
The second lancing was about right, but the white juice spilled across the blade so he did his subsequent lancings upward instead of downward. Some drops of the juice spilled on the soil.
The other morning the drops on the pods had dried to dark brown ickiness. To see if it could be done he decided to scrape upwards to see if he could catch Opium. There was very little yield, perhaps 5-10 mg off of one pod. Wondering about the taste of Opium he put it to his tongue. It was sharp and VERY bitter.
Then he knew what he wanted to know. He spat out the brown dab, uprooted the plants and put them on his compost heap.
If he had *harvested* then he had grown poppies in the Dutch half-shade (temperate climate) from culinary seeds, gotten two-foot Nigrums with beautiful purplehearted flowers, light-grayish green pods big as walnuts and each of those single pods per plant would have yielded him, I guess, 10-30mg of Opium.
This is the only lancing story I know of:D
|
Cloud9
I don't feel, and it feels great
Registered: 07/03/03
Posts: 867
Loc: between here and there
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#4017403 - 04/05/05 03:19 PM (5 years, 4 months ago) |
|
|
Great pictorals, helps alot being able to see the life cycle.
--------------------
.
|
Locus
Registered: 03/11/04
Posts: 5,990
Loc: ny/europe
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#4018660 - 04/05/05 08:54 PM (5 years, 4 months ago) |
|
|
Wiccan/Myco
--------------------
"Fear is the great barrier to human growth." ~ Dr. Robert Monroe
The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein
~~~*Dosis sola facit venenum*~~~
*Check my profile to listen to my music*
|
World Spirit
PNW
Registered: 07/27/01
Posts: 9,811
Loc: Tibet by way of WA
|
 Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#4019365 - 04/05/05 11:49 PM (5 years, 4 months ago) |
|
|
Wow. Quite a thread!@
|
rocknliam
happy willowdweller
Registered: 12/12/03
Posts: 307
Last seen: 2 months, 22 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: World Spirit]
#4020226 - 04/06/05 04:15 AM (5 years, 4 months ago) |
|
|
Ok, so did i understand correctly, sow seeds at the beggining of winter? In Australia we don't get the frosts or anything, so maybe my cat should grow a little patch, and, he should plant them now. If this is the case he might sow some seeds on friday.
|
Wiccan_Seeker
INFJcounselor-idealist
Registered: 02/06/02
Posts: 23,156
Loc: Virgo Supercluster (or b...
Last seen: 5 hours, 23 minutes
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: World Spirit]
#4020876 - 04/06/05 11:12 AM (5 years, 4 months ago) |
|
|
It's not enough: it never is
With nothing to do this afternoon I've decided to put it to good use for all of you poppyheads 
For the last four hours printer booklets, stacks of yellowed photocopies, reference books, computer files and internet links have been all over the place and this mayhem on my real and virtual Desktops has resulted in me writing an article for all'a'yall!
The writing was one thing, but zipping a ton of info into an information-dense yet pleasant read quite another. I like to think I succeeded in all these things, but you be the judge. Most of the information you see here is NEW TO THE NET as I took them from assorted offline sources, including books from the 1920s, and have connected dots not connected before. The Shroomery gets the scoop, I'll take it to Erowid later.
So to all you poppyheads out there, sit back and enjoy. If you have printed MycoCakeEater's and my own teks and just ate up the DEA TEK then you definately want to run this through the printer, stacks of info you've never seen before!
Isn't sharing what this community is all about? 
---------------------------------------------------------------------
DUTCH COMMERCIAL POPPY CULTIVATION
An informational article by Wiccan_Seeker
INTRODUCTION
The Dutch have got a tradition of commercial Poppy cultivation on their own soil. They are among the few nations that are furthest from the equator, yet still manage to commercially compete in the international poppyseed trade. During the second World War and in the 1950s Holland experimented with extracting Opium alkaloids from harvested Poppy capsules but this has not proven to be economically viable.
Holland has significantly taken part in the ?East Indies? (Asian) Opium trade until the 1800s but on its own soil has not engaged in Opium production due to the high cost of labor. Dutch Poppies can produce Opium that is as high in quality as Turkish Opium, the world quality standard, but in significantly lesser amounts per Poppy capsule leading to an overall far smaller yield.
In Holland Poppies are either grown on farmlands of many acres for production of poppyseed, in small patches for semi-commercial production of poppyseed and dried Poppy capsules for floral arrangements and finally in personal garden patches for the beauty of their flowers and capsules as well as for private use of collected Opium and Poppy capsule infusions for inebriating and medicinal uses.
This article will outline the cultivation and harvest characteristics of Papaver somniferum var. ?nigrum? when sown in a cool, temperate climate and will focus on the semi-commercial and private cultivation of smaller patches of Poppies. The information density of this article is unusually high so please read carefully.
This article is written for informational purposes only and the author cannot be held responsible to anything directly or indirectly related or assumed to be related to this text, it?s content or assumed meaning thereof. The information contained herein is a consolidation of multiple offline and online information sources and by no means advocates the breaking of any law. Be warned that many things and acts surrounding the Poppy plant are illegal in many countries and that misuse of Poppy products may cause injury or death, and carries the high probability of physical and psychological addiction. The Poppy has been a grace to many, but the damnation of many more.
THE DUTCH CLIMATE
Dutch Poppies are generally cultivated in the province of Zeeland and the adjacent west part of Brabant, which lie close to the cost and tend to be more moderate in climate then the rest of Holland, as well as one of the major agricultural areas of the small country. Poppies tend to be sown in spring after the last frosts have passed, which is in March to April. As an ?emergency crop? it can be sown as late as early May but then will yield far less poppyseed than is economically viable.
Given the life cycle of 120 days the Dutch Poppy-growing season thus stretches out from March until August. If you look at the climatologic statistics for those months in that region you will notice a steady progression from an average temperature of 6?C/43?F at sowing time to 18?C/65?F monthly average temperature at harvest time.
During this time this area experiences an even 60-75mm precipitation, which after subtraction of evaporation yields a positive precipitation balance of 10-25mm/month.
From March onward the local sun exposure is 110-125-200-200-200-200-125 hours per month respectively. Holland lies in Climate Zone 8 (average annual minimum temperature -12 to -7?C = 10-20?F) while Papaver somniferum is hardy until Hardiness Zone 7 (AAMT -18 to -12?C = 0-10?F) which means that seeds shed in summer and fall will survive the Dutch winters and sprout in spring.
All this paints the picture of a cool, wet climate that has little sun exposure but despite this the tough Poppy thrives in Holland to the extent of allowing commercial poppyseed cultivation.
PREPARING THE SOIL AND FERTILIZING
Holland grows annual crops of between 500-10.000 hectares of Poppies, mostly in Zeeland province and western Brabant. Poppies can be grown after many kinds of crops in ?crop rotation? and can be regarded as universal in that respect. The soil needs to be prepared to yield a very fine sowing bed, as the seed is very small and slow to germinate. Many Poppy patches fail because of bad soil structure (crumbly clay) as Poppies prefer a fine, loose soil that drains well. It has been general practice to start out with 8-12 grams of Nitrogen fertilizer per square meter, given at the time of sowing, with Potassium and Phosphorus being added to meet soil analysis. Of particular importance are Nitrogen and Phosphorus.
A convenient way to fertilize small personal patches as practiced in the Third World which is endorsed by the FAO is the use of human urine, which weds the advantages of biological fertilizer with the rapid assimilation and availability of chemical fertilizer. In this virtually odorless practice one adult?s urine of one day is diluted with 5-10 volumes of water and used to fertilize one sq meter for the entire growing season. Trivial as it may seem this corresponds to 14gr of Nitrogen, 1.5gr of Potassium and 1gr of Phosphorus plus trace minerals which is sufficient for an entire season, fully biologic and incapable of harming crops if properly applied. The Nitrogen will be fully bio-available in 1-2 weeks. Urine is acidifying and said fertilization spends 1.5 ounce of lime (calcium carbonate) per sq meter from either the soil or through addition to balance pH.
Recently there has been experimentation to split the fertilization in two doses, one given at sowing time and the second at the onset of flowering. This increases yield and the likeliness of a good crop. For the small patch farmer it can be advantageous to continuously fertilize, but over-fertilization harms and in extreme cases kills the plant.
SEED AND SOWING
The seed is very fine and if fresh it can yield 1.000 seedlings per gram of seed. It is usually treated with TMTD to decontaminate it as fungal diseases are the Poppy?s only serious plagues. Old seed often germinates poorly and seed of poor quality ought to be treated in any case to assure a well-planted field.
The goal is to end up with 30-60 healthy plants per square meter, This tends to lead to smaller plants and smaller capsules then in tropical countries but a greater certainty of a good crop as the space of weak or dying plants is immediately claimed by it?s stronger neighbors which leads to strong Darwinian selection while at the same time it allows for greater cultivation setbacks: the fewer plants will produce more and bigger capsules and the cost of sowing seed is entirely unimportant compared to the yield of a successful crop.
In theory one kilo of poppyseed is entirely sufficient to yield a million poppies on two hectares of farmland, but in practice this amount is impossible to sow out commercially. Therefore commercial growers usually use 2-3 kilos of poppyseed per hectare (0.2-0.3gr/sq meter) and some even go to 0.5gr/sq meter, but in that case thinning is required to avoid yield reduction due to overcrowding. Often the seed is mixed with an inert material (such as white sand) to bulk up the volume for convenient sowing. A particularly advantageous mixture is that of one ounce of poppyseed with five ounces of White Clover. White Clover will shield the germinating Poppies from weeds and in fact fixates Nitrogen from the air to enrich the soil.
Poppies are sown when the frost has passed, usually in mid-April but it can even be sowed in early May. The earlier Poppies are sown, the greater the yield will be as optimal sun exposure is preferable. Poppies can take a bit of frost but are fragile to it in the seedling stage. Poppyseed is to be sown very shallowly, if covered at all.
Poppies can be sown in three ways.
The most convenient commercial way is to sow it in rows. Per meter there are three rows and the goal is to get ten to twenty healthy plants per row per square meter to end up with the desired 30-60 plants. This is accomplished by sowing more seeds and once they have come up using a 5-inch wide hoe to isolate plants by weeding perpendicular to the rows. Sowing in rows is the standard commercial way of poppy-farming as all stages in the growth cycle from sowing to harvest can be done with common farming machines instead of the far more expensive manual labor.
Sowing in rows is the technique used for the vast commercial multi-hectare poppyfields.
The semi-commercial smaller grower with a substantial patch tends to favor broadcast sowing, where the seed is tossed about widely by hand from a pouch worn around the waist. Broadcast sowing is the technique most often used in the tropical poppyfields and is favored by ?guerilla farmers?, being people who sow in the wild as it is done on the slash-and-burn Opium Poppy fields of Asia.
The third method is highly labor intensive and favored only by private cultivators of very small patches. It basically consists of poking 30-60 shallow holes evenly across a square meter and dropping a few seeds in each hole, sprinkled between the fingers like salt. If you divide a sq meter up into squares of 5x5 or 6x6 inch and sow some seeds in the middle, to leave one plant per square, you have created the ideal growing space for the Commercial Dutch Poppy, the seed of which is the often praised Dutch culinary poppyseed used mostly in baking bread and rolls. Poppies can be grown in pots, indoors or outdoors, as well, it can thrive in throwaway plastic 5oz coffee-cups with a draining hole but best results are obtained from 5-6 inch pots which have the added benefit of measuring out the optimal growing space if put side-by-side in squares.
GUERILLA FARMING
Poppies thrive on disturbed soil and are hardy up to Climate Zone 7, strongly re-seed and on most soils require no fertilizer or watering. This makes them excellently suitable for guerilla farming in most parts of the world. If you look at Guerilla Farming as it is done in western countries (without slash-and-burn methods) then this usually is done in one of two ways.
Broadcast-Prepared is the way most commercial Opium fields and garden patches are created. This is a successful technique that entails raking a piece of soil that supports weeds to both remove the weeds and loosen the soil, and then sowing poppyseed on the seedbed, treading it and leaving to create the next patch. The energy spent in this method is the manual labor of raking, but it yields a high certainty of successful germination. The other method can be called:
Broadcast-Unprepared. This method consists of broadcast-sowing Poppyseed on unraked soil which has not been worked in any way. If the areas are well-colonized (such as grassy meadows) the successful germination rate can shrink to almost zero but on semi-bare ground, sowing before most weeds have come up, germination rates can be quite good. The energy spent in this method is the cost of the additional sowing seed that is required because a successful germination rate of 1% can be considered high. Sowing upon worked farmland or ground disturbed for road construction etc. falls under ?Broadcast-Prepared? and successful germination rates can be very high. Broadcasting and not treading the seed, in the proximity of an ant-hill, often constitutes to feeding the ants because the seeds are 45% oil and high in protein, and the perfect size for an ant to haul off to it?s hill.
A curious device used for poppyseed guerilla farming is the ?poppy-gun?. The ?poppy-gun? consists of a short wide tube (like the inner roll of toiletpaper) closed off on one end with the loose rubber skin of a balloon. Some seed is dropped into it (10 grams still account for 10.000+ viable seeds) the bunch of seeds is grabbed and drawn back through the balloon like a rock in a catapult, and released, so that the seed is flung through the air up to 25 yards like fine buckshot, spreading out more efficiently then can be accomplished through broadcasting.
Be aware that guerilla farming changes the ecosystem where the seeds are introduced and that, unless confined to designated patches, it is disruptive to the local flora which means Broadcast-Unprepared techniques are to be discouraged according to common environmentalist ethics.
HARVESTING
Poppyseed should be allowed to ripen on the plant, which results in the plant wilting and drying while standing in the field. Totally unripe poppyseed of the Nigrum variety is white, then turns purple-red and ripens to a steel-blue color. At this time birds will start to take interest in the capsules and may break them to get to the nutritious seed. Poppyseed ?runs? easily, which means that if a bag or Poppy capsule has a small hole, most or all the seed will run out of it like sand through an hourglass. Bird pecking is detrimental to the harvesting of Poppy capsules as well, and spilled seed will come up as a weed in next year?s crop, causing over-seeding or growing like a weed among the species then planted in the crop rotation program.
The seed should be dried well and kept in the dark on a well-ventilated dry place, preferably in bags of fine cloth, semi-commercial growers often use pillowcases for the purpose awaiting purchase by bakers and herbalist shops.
The Dutch harvest around 80-300 grams of poppyseed per square meter, with a good yield being about 120 grams.
Poppy capsules from Dutch culinary poppies tend to be walnut-sized.
For florist purposes the prettiest poppies are selected and typically there will be 50-200 poppy capsules per square meter, with 100 poppy capsules being average. The poppy capsules are picked when they are dried and bound to bouquets that typically hold 100 capsules. The poppy capsules are picked with stem and sold intact with seeds to not damage the capsule.
For apothecary purposes poppy capsules were gathered in the distant past, and the pharmacopeia dictated they should be gathered with 4 inches/10 cm of stem below the knots and freed of seeds to yield the ?drogery? called Fructus Papaveris Sine Semine (Poppy Capsules without Seeds). The yield of Poppy capsules from Dutch Culinary Poppies lies between 50-200 grams with 100 grams from 100 capsules being typical. If standardized Opium of 10% Morphine content is taken as the standard, then the ripened unincised Poppy capsules contain 0.5-10gr Opium per square meter within them, with 2-4 grams of contained Opium being typical.
The poppy straw without the capsules contains one-tenth the concentration of Opium within them, so they are usually discarded.
The alkaloid content of poppy capsules increases as the capsule ripens, then diminishes somewhat as the poppyhead dries out on the stem. Snapping the dried poppy capsules off of their stems is the preferred method of harvesting Poppy products for apothecary purposes in guerilla farming as one can rapidly harvest far more opium equivalents by stem-snapping then through pod-lancing even though gum Opium would be the preferred product.
If for apothecary purposes the poppy capsules are lanced they will yield an Opium which can be as strong as Turkish Opium, but far lesser quantities of it. While the Tropical Poppies on average yield 80mg of Opium per Poppy capsule the Dutch Poppy, mostly because of the poor weather stays far behind that and produces, on average a mere 20mg. Even though far more labor intensive the high density of Poppy capsules per square meter of Dutch Poppies might still yield 1-4 grams of Opium per square meter, two grams on average, which rivals the best poppyfields were it not that the smaller stature of Dutch Poppies and their high sowing density makes it near impossible to lance within a field of them, as treading and brushing against them becomes unavoidable. The resulting lanced poppy capsules still contain significant amounts of Opium but are mostly depleted by the lancing.
HARVESTING SUPERIOR SEED
Poppies both cross-pollinate and self-pollinate to yield capsules and seed. The improvement of Dutch Poppies until now has not been intensive and mostly is done by selection from populations, even though selective pollination has been performed in the past. The Dutch Poppies are not GM because genetic manipulation bears great stigma in especially the health food sector where Dutch poppyseed is highly esteemed for it?s flavor, texture and culinary oil production.
Selection from population is a practice that is even commanded by the Bible as ?saving the best grain for next year?s planting?. Selection criteria vary for the purpose for which they are cultivated. A florist lays emphasis on more, prettier, bigger flowers and an esthetic plant. An Opium gatherer often lays emphasis on fewer but bigger capsules which yield more Opium with less labor involved. A Poppy capsule collector (for florist or apothecary purposes) would lay emphasis on the number of poppies and wants them as well-shaped as possible.
Dutch Culinary Poppies are improved upon criteria that meet the demands of the poppyseed trade. A smaller, tougher plant of reduced biomass which is more resistant to molds and plagues and has superior growth characteristics aimed at providing a healthy crop that yields the highest reliable yield of poppyseed, and it does so by the strategy of more plants with more somewhat smaller capsules, instead of fewer larger plants with fewer but larger capsules.
Dutch Culinary Poppies are ideal for those who are looking for a superior producer strain of poppyseed and walnut sized poppy capsules for florist or apothecary purposes that is improved to give reliably high yields in cooler, less sunny climates.
|
esin
cheesefondue
Registered: 11/21/01
Posts: 1,275
Loc: Lysergia
Last seen: 9 months, 6 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#4021290 - 04/06/05 01:09 PM (5 years, 4 months ago) |
|
|
Wow, even more! This needs to go into the Garden FAQ!
EDIT: Oh, I just noticed it is now sticky!
Edited by esin (04/06/05 01:12 PM)
|
Cloud9
I don't feel, and it feels great
Registered: 07/03/03
Posts: 867
Loc: between here and there
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: esin]
#4037552 - 04/10/05 05:12 PM (5 years, 4 months ago) |
|
|
I got a question about fertilizing, I was gonna water them with a 15-30-15 solution weekly, will it be too much and burn them? Or should I only fertilize every other week?
--------------------
.
|
MycoCakeEater
Old Hand
Registered: 06/16/03
Posts: 1,548
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Cloud9]
#4039138 - 04/11/05 12:51 AM (5 years, 4 months ago) |
|
|
When I did a prepared bed of poppies. I just used some good pro-mix w/ blood and bone meal added in. Poppies are very sensitive when young, but when they reach about cabbage size is when they hardy up. I wouldnt go with a weekly fert schedule. Id say more around the lines of once a month.
|
Wiccan_Seeker
INFJcounselor-idealist
Registered: 02/06/02
Posts: 23,156
Loc: Virgo Supercluster (or b...
Last seen: 5 hours, 23 minutes
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Cloud9]
#4041961 - 04/11/05 06:42 PM (5 years, 4 months ago) |
|
|
15-30-15 sounds right, but it must be diluted as directed.
The best thing to do is the piss plan, but if you really want the 153015 then it is best to measure out the correct dose of fert for the entire season. For 15-30-15 you need about two ounce of the pure fertilizer per square meter of poppies. Put this in a bottle. Use that one amount to spread out over the season in any way you see fit, since this on normal soil will not overfertilize. I'd say do it evenly, six portions of fert with each two weeks between them and should it form flowerbuds early, then adding the remainder.
Ideally you should sprinkle 1 ounce of lime (calcium carbonate) per square meter. You do this once. You can repeat the fert growing season after season, but the lime basically does not deplete.
Use ONLY this lime if the Nitrogen (the first 15) is not in nitrate form. If it is, or if the fert contains lime, leave it be.
Remember: 2oz fert/sq meter for the WHOLE SEASON!!
Like Myco says: it's best to either use it all two weeks before sowing, or like he suggests, when it cabbages. Seedlings are babies.. you don't feed babies bacon & eggs
Edited by Wiccan_Seeker (04/11/05 06:44 PM)
|
GeoMcCheeseburgers
one-eyed willie
Registered: 07/08/03
Posts: 37,963
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#4047953 - 04/12/05 11:47 PM (5 years, 4 months ago) |
|
|
Quick question. I assume you lance the pods before they open up and flower correct or no?
Also I have a pot that is 12 inches wide and about 13 inches deep. In theory how many total (maxed out) poppies could I grow in this pot if I wanted to push its limits? Thanks a lot guys.
Final question. I have two variety's of seeds. In theory if I was to grow indoors by sunlight through a window only no artificial light what variety would be my best choice? Giganthemum or Persian Whites?
--------------------
cortezthekiller said:
 dont you feel fucking special cause your user name is GeoMcCheeseburgers
Edited by mattzdope (04/12/05 11:58 PM)
|
Wiccan_Seeker
INFJcounselor-idealist
Registered: 02/06/02
Posts: 23,156
Loc: Virgo Supercluster (or b...
Last seen: 5 hours, 23 minutes
|
|
Quote:
Quick question. I assume you lance the pods before they open up and flower correct or no?
I don't lance poppies: I on occasion gather floral arrangements from a nearby park
But to your question: you've got the flowerbuds confused with the pods.
The flowerbuds must not be lanced.
You got a seedling, it becomes a "cabbage", the cabbage sends up the peduncle (main stem) and if you're lucky some tillers (secondary stems).
These produce upside down flowerbuds, they erect and open and you get the flowers. After the petals fall off the pods, from the heart of the flowers, will grow in size. Ten days after the petals drop you may or may not lance the poppies. If you leave them standing they will dry on the dying plant and the seed ripen into them. Yu may then choose to snap off the dried pods to extract the seed and perhaps keep the seedless pods for poppyhead tea which is as highly addictive as the opium.
From sowing to dried pods with ripe seeds 3-4 months pass.
Indoors Persian White would be best as they are smaller. Persians don't "cabbage" but develop fluently into flowering.
Ten plants for that pot would be reeeally pushing it, as you are counting on more growth around the pot then above it. You will have a thick bush growing from a relatively small pot. I'd say put one or two in the center of the pot and the rest around the rim. It's basically like growing a clump in a garden. In the windowsil you might consider one-quart tin cans with holes in the bottoms to really *use* that windowsil-space. One plant per tin can, centered. It takes three growth seasons of growing & selecting the best seeds for the next run to adapt a plant to the place where you're growing it.
You can think of "creating" (rather: selecting) a "Windowsil Poppy" which will then be 1-2ft high and still produce 1-3 walnut-sized pods per quart tin can. You'd want a dwarfed plant which still produces good pods, like the Dutch have done to weed.
Edited by Wiccan_Seeker (04/13/05 08:19 AM)
|
liveby
Wasted For Time
Registered: 06/15/04
Posts: 1,509
Last seen: 2 months, 9 days
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#4060559 - 04/15/05 10:35 PM (5 years, 4 months ago) |
|
|
hm i wonder if anyone has tried the old fashion 3rd world country way and piss on the garden?
--------------------
 
http://www.bruceeisner.com/ -Creating a Sensible Culture
|
butterflydawn
lucid dreamer
Registered: 01/25/04
Posts: 1,793
Loc: lost at sea
Last seen: 11 months, 12 days
|
Re: Poppies - from Poppyseed to Opium [Re: liveby]
#4061981 - 04/16/05 11:26 AM (5 years, 4 months ago) |
|
|
very nice thread!
--------------------
lucidal expansion
|
myndreach
philosopher
Registered: 08/07/04
Posts: 2,368
|
Re: Poppies - from Poppyseed to Opium [Re: butterflydawn]
#4095070 - 04/25/05 02:48 PM (5 years, 4 months ago) |
|
|
Great thread. When is a good plantint time for Arizona?
|
Stonerguy
I smoke penis
Registered: 05/29/04
Posts: 5,533
Loc: Lost
|
Re: Poppies - from Poppyseed to Opium [Re: liveby]
#4098211 - 04/26/05 10:42 AM (5 years, 4 months ago) |
|
|
Quote:
liveby said:
hm i wonder if anyone has tried the old fashion 3rd world country way and piss on the garden?
It works i think your piss is 90-0-0 Nitrogen up the ass!!! If you do do it dilute yoru piss alot or you will burn the little things.
--------------------
yawn...
SG
|
gobbler
Stranger
Registered: 04/26/05
Posts: 10
Last seen: 5 years, 4 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Stonerguy]
#4103961 - 04/27/05 08:30 PM (5 years, 4 months ago) |
|
|
i heart poppies, how long dfrom the time they open till lancing?
|
Cloud9
I don't feel, and it feels great
Registered: 07/03/03
Posts: 867
Loc: between here and there
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: gobbler]
#4119906 - 05/01/05 08:05 PM (5 years, 4 months ago) |
|
|
Mine are only about three weeks old and about 2" tall..
--------------------
.
|
JaguarWarrior101
ShamanicAlchemist InTraining
Registered: 03/24/05
Posts: 184
Loc: State of Euphoria
Last seen: 4 years, 1 month
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Cloud9]
#4130461 - 05/04/05 12:51 AM (5 years, 4 months ago) |
|
|
If guerrilla farming has low germination rates, would it be better to grow them in peat pots until germination, and then plant the peat pots?
--------------------
The above post is purely hypothetical, and should not be considered the true thoughts, opinions, or actions of a real life person.
We perceive. This is hard fact. But what we perceive is not a fact of the same kind, because we learn what to perceive.
~Carlos Castaneda
|
JaguarWarrior101
ShamanicAlchemist InTraining
Registered: 03/24/05
Posts: 184
Loc: State of Euphoria
Last seen: 4 years, 1 month
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: JaguarWarrior101]
#4131246 - 05/04/05 04:33 AM (5 years, 4 months ago) |
|
|
If only the seeds do not contain opium, is there a way or is it worth extracting it from the plant itself after harvest?
--------------------
The above post is purely hypothetical, and should not be considered the true thoughts, opinions, or actions of a real life person.
We perceive. This is hard fact. But what we perceive is not a fact of the same kind, because we learn what to perceive.
~Carlos Castaneda
|
Mykul
Shaman of Analog
Registered: 09/01/04
Posts: 11
Loc: From Seattle to Palm Spri...
Last seen: 4 years, 8 months
|
 Re: Poppies -- from Poppyseed to Cooked Opium [Re: JaguarWarrior101]
#4134909 - 05/04/05 11:21 PM (5 years, 4 months ago) |
|
|
I found that if one just cuts the stem of the poppy and then makes the cuts, holding the stem upside down over a liter or so of H2O or even allowing the heads of the poppy to rest just below the surface of the water, one can cut the hard part out completely. The latex mixes well with water and one can go from plant to cooked opium with out the painful task of the harvest. I know you can't harvest as much from one plant as you would if you did give it a couple of days, but if you have plenty of the flowers and was not trying to open your own drug store then this would work just fine. It has worked for me and I learned this in Laos. My mother is Hmong, and although it says most Hmong do not prefer it cooked some do. Just a little tip I picked up in my travels. Plus if you hang them over the water and add a little heat to the water to cause it to steam then the latex will drip into the water and begin the cooking process sooner.
--------------------
|
Iamthewalrus
every evening Idied and everynight I wasreborn
Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 10 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: MycoCakeEater]
#4161704 - 05/11/05 02:05 PM (5 years, 3 months ago) |
|
|
wow perfect day to find this thread...I've started some single red tasmanians as well grocery store variety for comparison...and I got pics and am pretty sure thye need some water but I don't wanna over do it obviously...this is only from 1 mornining in the sun...I'll get a pic of the left over seeds in a bit(they are red so looks like seed colour can in cases be in indicitive to flower colour :P and much smaller then grocery store seeds and from a VERY reliable source whos written an amazing guide as well just not sure about the water for now I wanna know how much water to add and if my method for adding water seems adequate(60cc syringe)
I have a horrible fuckin body flu so apologize if I'm not makign sense in anyway...I need 500mg naproxen plus an apple(since that much naproxen can cause ulsers without food, oh and I take effexor which will also contribute to stomach damage if I don't eat with the pill) sitting by my bed for when I wake up just to get up...I'm not used to pouding headaches ick...anyways on with the pics and advice(hopefully)
these first ones were taken when the sun was just about down..so I apologize for the sliht blurriness..I've never taken pics at sundown before
heres the pics of what needs to watered and obviously the 1 dosen't(ironically thats the spice :P)...anyways how much water should I had per lil tray when they get dry like that..I'm assuming I should water, they are around 2" x 2" x 2"...
heres what I was planning on watering very gently with
and I'll update this post with a pic of the seeds I used later on and I apologize again but stomach is burnin so prolly best to get something else in there to avoid stomach problems...last thing I want is an ulcer..so anyways I've been distratced while typing this up so if something don't makes sense since I'm cloudly headed as it is I'll edit that later too
Edited by Iamthewalrus (05/11/05 02:36 PM)
|
Iamthewalrus
every evening Idied and everynight I wasreborn
Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 10 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Iamthewalrus]
#4172682 - 05/13/05 10:41 PM (5 years, 3 months ago) |
|
|
I decided to mist lightly for watering instead and when it rains it goes under and old truck hood we got...since its not warm out theres no heat build up and they still get light...pretty sure I see some germination but its VERY hard to tell...the sinle red seeds are like grains of sand...heres the best pic I could get
|
Iamthewalrus
every evening Idied and everynight I wasreborn
Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 10 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Iamthewalrus]
#4172704 - 05/13/05 10:48 PM (5 years, 3 months ago) |
|
|
oh and I'll ask starter if I can post the guide he made for me...its the best I've seen so far(no offence or anything hes just pro all the way)
|
Wiccan_Seeker
INFJcounselor-idealist
Registered: 02/06/02
Posts: 23,156
Loc: Virgo Supercluster (or b...
Last seen: 5 hours, 23 minutes
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Iamthewalrus]
#4173830 - 05/14/05 09:38 AM (5 years, 3 months ago) |
|
|
Please post it right here in this thread!
I've had a personal communication the other day where someone told me he had a habit consisting of a daily shot of 100mg extracted hydrocodone. (extracted from 10 Vicodin, quite messy to shoot that)
Said person tried my Lemon Laudanum with 5 grams of ground poppyheads, which he soaked overnight. That morning he drank it down while experiencing physical withdrawal of not having shot his daily hydrocodone.
He ended up being surprised by the strength of the drug's effects. It was not as euphoric as shot hydrocodone but he experienced a strong body high as well as surprisingly strong mental effects.
5gr of poppyheads contains about 75-250mg (1-4 grains) of standardized Opium and is more than i'd recommend a newbie.
Still that its potency impressed someone with a shot 100mg hydrocodone habit shows that Lemon Laudanum (and poppyhead tea) certainly is no laughing matter.
|
Iamthewalrus
every evening Idied and everynight I wasreborn
Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 10 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#4174106 - 05/14/05 12:10 PM (5 years, 3 months ago) |
|
|
lol I dunno if I should talk what starter has done or not but I think this is ok...first time he tried edible opium he od'd lol...only funny cause he pulled through ...I love u dude seriously...I would love to have your level of patience and will power
EDIT: I'm waiting on starters word cause I don't think he made this guide public so I have to respect that he may not want it to be
Edited by Iamthewalrus (05/14/05 04:36 PM)
|
flowstone
blustering
Registered: 01/25/05
Posts: 6,485
Loc: precious
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#4175151 - 05/14/05 05:28 PM (5 years, 3 months ago) |
|
|
not sure if you saw my other thread, I will post my questions here for you.
(quoted from another thread, sorry for the cross reference no one gave me exact answers)
I was wondering if an ever clear extraction of pods would leave anything behind a hot water extraction would not.
And vice verse, does pod tea leave actives in the left over straw?
Quoted from W_S:
"This happens because of heating over 70'C which destroys the Meconic acid which makes the alkaloids more soluble. Meconic acid and Narcotine/noscapine significantly potentiate the Opium without being true narcotics themselves."
So a low simmer at less that 70'C is the best way to make pods tea, temperature wise?
Could these pods be used again in an everclear laudanum extraction for any effects?
70'C= how close to boiling temp? I always used to get the water hot just before it boils, and then pour it over my pods, but I am thinking a low simmer at or below 70C will be more beneficial.?
and one more ;0
Are you saying a 8 hour cold water soak will get everything a 10 minute simmer will?
--------------------
these long agonizing months without you...have been long and agonizing..
"War Doesn't Decide Who's Right... It Only Decides Who's Left."
|
flowstone
blustering
Registered: 01/25/05
Posts: 6,485
Loc: precious
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#4176968 - 05/15/05 03:13 AM (5 years, 3 months ago) |
|
|
Here is a tek to extract morphine from pods.
Quote:
iceolated smokeables
by Ab Strak
fresh pods were freezed, then ground in a blender, with 3 volume equivalents of cold water,
and allowed to stand for 1 hour.
The resulting goo was stirred, then sifted crudely, to retain the biggest pieces.
The filtrate was allowed to stand for 1 hour at room temperature, after which the fairly clear,
light brown top layer was decanted into a bottle, which was not to be filled completely.
The filter residue was extracted again with water, fractions were combined.
The closed bottle was kept still, in a freezer at -5 centigrade until 2/3 of the solution was frozen.
The freezing solution was filtrated, after which the ice was discarded.
The filtrate was put back in the bottle, and the freezing procedure was repeated.
The resulting brown solution was allowed to evaporate on a hot water bath,
yielding a brittle brown substance which was potent and tasteful enough to smoke pleasurably.
Hypothesis of the success of the procedure:
The active ingredient, a morphine salt, is highly soluble, even in cold water.
Acid or base addition is unnecessary and unwanted because of possible decomposition of the salt,
into possibly less soluble constituents.
Heating is unnecessary and unwanted because of possible degradation of saccharides and peptides (inflicted effect explained below),
and additional dissolving other unwanted materials, like lipids.
The crystallization of water in the solution forces other molecules than water out of the matrix.
Small molecules, like morphine maleate move easily to stay in the liquid phase.
Large molecules, like (poly)saccharides and (poly)peptides can not move easily enough, and are included in the ice.
An additional effect may be that plant saccharides have a high affinity to water.
So, may be, small saccharides are included in the ice as well.
The freezing therefore accomplishes a separation between alkaloids and "nutritional" materials.
This statement is confirmed by direct evaporation of cold water extract.
It is important not to break the ice crystals during formation, because cavities will form, enclosing active ingredients.
This is experimentally confirmed.
Additional note:
The extraction can be accomplished from dried pods also, however, a third extraction step is required,
and more time to allow for dissolving.
and here is the same tek written by another person, reworded( somewhat simpler to understand0
Quote:
1. Take pods, dried or fresh, and freeze them
2. Add 4 parts water for each 1 part pod material into a blender and grind it up good
3. Pour it over in a mug or similar, stirr it well for some minutes, then let it sit for about 1 hour in room temp.
4. Strain it to discard the biggest chunks, use a strainer with fairly big holes.
5. Fill the upper brown and most clear layer over into a bottle, let the rest stay in the mug
6. Extract the goo and particles left in the mug with more water, like was done with the pods in step 2 and 3.
7. Strain and pour this solution also over into the bottle
8. Shake bottle and put in a freezer (Dont cap the bottle, could explode if pressure expands it while freezing)
9. When half the solution in the bottle has frozen filtrate it with a cloth (t-shirts work fine) and discard the ice.
10. Put the solution back into bottle, shake it well, freeze it down again like in step 8 and 9.
11. Take this second filtrated solution and evaporate it in a pot placed in a larger pot with cooking water (warm bath)
12. The brown substance left in the smaller pot when evaporated, sometimes a bit like mexican tar, can be smoked.
This type of Morphine salt extracted with this method is highly soluble in cold water
No need for any acidic chemicals in the process, no ascorbic acid, lemon juice, etc. This makes it less soluble.
The morphine stays in the water, the junk in the ice that you discard.
--------------------
these long agonizing months without you...have been long and agonizing..
"War Doesn't Decide Who's Right... It Only Decides Who's Left."
|
Iamthewalrus
every evening Idied and everynight I wasreborn
Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 10 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: flowstone]
#4177019 - 05/15/05 03:33 AM (5 years, 3 months ago) |
|
|
I really fuckin hate how theres like 10 diff types of weeds around here that look pretty much identical to poppies(at an early stage) is there some kinda of test you can do or look for something? I really have no clue...I'm brand new to the horticulture world :P...well poppys for sure
|
flowstone
blustering
Registered: 01/25/05
Posts: 6,485
Loc: precious
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Iamthewalrus]
#4177067 - 05/15/05 03:57 AM (5 years, 3 months ago) |
|
|
HOLY MOLY!
THank goodness poppies.org is working
I just got through page twenty of the threads in the 'tea room', reading select threads.
GREAT INFO..
Something to note: When making tea from the stems, use only the top 5 inches of the stem. THe bottom portion of the stem contains aprox 30% alkaloids that the top 5 inches hold, or roughly only 10% that the pods would hold.
Also, always wipe your pods down to remove dust and anything on the outside. use a damp cloth and possible add a small amount of vinegar to the dampness.
--------------------
these long agonizing months without you...have been long and agonizing..
"War Doesn't Decide Who's Right... It Only Decides Who's Left."
|
BostonSteamer
Stranger
Registered: 05/16/05
Posts: 5
Last seen: 4 years, 3 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: flowstone]
#4183650 - 05/16/05 08:54 PM (5 years, 3 months ago) |
|
|
sorry to be off topic but.... Flowstone(or fellow shroomers) do you know of any teks for extracting hydrocodone from either dried pods or raw opium, thanks guys
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: BostonSteamer]
#4204537 - 05/21/05 09:17 PM (5 years, 3 months ago) |
|
|
Sowed these gigs last February, accidently broke a leaf and found some neat stuff. Apparently thinnings are also slightly active
I read at poppies.org how some veterns prefer to mix ground pods with Cookies and Cream ice-cream. They said less is used than with T and the taste is masked well, but I'd still like to try the Lemonaide.
I'm going to let the largest pods go to seed and collect and dry the rest for a floral arrangment a few days after they reach maturity, to avoid people seeing them and theft.
Does anyone have an opinion if the Nods are pronounced more from any one certain derivative? Or is codiene just the most desirable?
--------------------
  
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
rocknliam
happy willowdweller
Registered: 12/12/03
Posts: 307
Last seen: 2 months, 22 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: namaste]
#4213240 - 05/24/05 07:35 AM (5 years, 3 months ago) |
|
|
Flowstone, do you have any personal experience of that working? Or can anyone vouch for the method?
|
flowstone
blustering
Registered: 01/25/05
Posts: 6,485
Loc: precious
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: rocknliam]
#4223333 - 05/26/05 06:07 PM (5 years, 3 months ago) |
|
|
Never done it. It was an old thread over at poppies org
The people there seen to think it works. Keep in mind you would be leaving a lot of goodies behind because you would just be getting smoke-able morphine( I think)
Which means you could make tea for the codeine to get what is left over.
--------------------
these long agonizing months without you...have been long and agonizing..
"War Doesn't Decide Who's Right... It Only Decides Who's Left."
|
Iamthewalrus
every evening Idied and everynight I wasreborn
Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 10 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: flowstone]
#4229288 - 05/28/05 05:38 AM (5 years, 3 months ago) |
|
|
starter gave me the go ahead so tomorrow I'll find away to post his guide
|
Wiccan_Seeker
INFJcounselor-idealist
Registered: 02/06/02
Posts: 23,156
Loc: Virgo Supercluster (or b...
Last seen: 5 hours, 23 minutes
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Iamthewalrus]
#4229349 - 05/28/05 07:45 AM (5 years, 3 months ago) |
|
|
Hmm I feel this thread is derailing. It's originally about the natural products "from poppyseed to (cooked) opium" and now we are discussing things that are opium no longer but rather refined products that have lost several *kinds* of alkaloids.
Walrus, please post the morphine extraction in another thread because they deal with refined extracts.
Opium is the dried-up juice of the poppy. Poppyhead fluids are whole Opium dissolved in water. Cooked opium is a technique to remove physical impurities for smoking. To selectively change the nature of Opium into that of crude morphine is not the direction this thread was intended for, which basically revolves around the joys of cultivating poppies and the pleasures of opium.
It;s a bit like a "distilling fermented sugar into 200 proof spirits" in a winemaking thread.
I'd love to see the tek, but i think this thread will be taken off topic by it as far too many people have a isolated alkaloid fix-ation already.
|
Iamthewalrus
every evening Idied and everynight I wasreborn
Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 10 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#4232234 - 05/29/05 02:46 AM (5 years, 3 months ago) |
|
|
the guide is about growing tasmanian poppys, it does have some extraction stuff too towards the end...but there is much goodness about growing the poppies as well(plus making edible opium) all with good pics...I really think it belongs here but its your call
|
Wiccan_Seeker
INFJcounselor-idealist
Registered: 02/06/02
Posts: 23,156
Loc: Virgo Supercluster (or b...
Last seen: 5 hours, 23 minutes
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Iamthewalrus]
#4232640 - 05/29/05 08:50 AM (5 years, 3 months ago) |
|
|
The thing is this thread is basically about the virtues of opium and the growing of your own poppies. There are good reasons to draw distinctions between Whole Opium products vs isolates.
Opium throughout history has caused many dire problems, but the Opiate world literally went to shite when Morphine was invented along with the hypodermic syringe.
Part of the point of this thread is to turn pharmaceutical/street shite users back to Mother Nature and the finest opiate of all: whole Opium, as part of the whole back-to-nature and grow-your-own trend.
Homegrown whole opium cannot be unnaturally administered. If grown yourself it has natural limitations on its use and whole Opium, let it be known, gives a better, fuller Opiate experience than any Opioid including heroin and the stuff nowadays passed off as heroin.
People can put a patch in their garden, or the forest, or among the weeds on that vacant lot close to their home and be self-sufficient in their drug needs with no dealers or cutting agents involved. It's taking responsibility for your drug and your use of it right from the start.
The DEA document that kicked off this thread proceeded to detail isolation of morphine in 55 gallon drums, transportation of Choi bricks of 999 morphine to the labs to be converted to heroins 3 & 4 by the kilo. I chose to post the version I found where all that shite is snipped off, so it is just about the poppy and whole Opium.
I would love to see that Taz TEK here, I have little doubt it will be anything but a treasure. But please ask your friend if he'd consider snipping the parts that detail extracts other than whole Opium from the TEK as posted in this thread.
Whole Opium would be:
-Poppy plant juice & plant parts dry or fresh (pods!)
-Water extract of poppy plant parts made hot or cold, neat or acidified and drank whole
-Pod Putty which is evaporated water extract of poppy plant parts
-Opium (aka Raw Opium, Gum Opium) which is dried poppy juice (from lancing pods or juiced from the fresh plant parts)
-Opium tincture (Laudanum) which is whole opium dissolved in aquatic alcohol.
-Smoking Opium (Cooked Opium) which is Opium, disdsolved in water, filtered and evaporated until a paste is obtained.
All these techniques have three things in common: they are low-tech but more importantly: they produce products containing whole Opium and no selective isolates and can not be abused by injection.
Please ask your friend if its ok to have certain passages snipped from the TEK document to fit this thread. I think he'd likely understand and agree if he saw the rationale behind it.
You take it in your garden
You take it in your house
You take it in your body
Thats how it should be. Also, legally, 9/10 judges would view a person who makes tea of a herb with other eyes than one who isolates morphine and then perhaps bangs it in a syringe.
Please try to get the edited TEK in here. Neuro and I are discussing how to keep this thread ontopic and keep the info pouring in.
This thread is solid gold, lets go for a platinum thread on this fascinating culinary & gardening & psychoactive herb!
|
flowstone
blustering
Registered: 01/25/05
Posts: 6,485
Loc: precious
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#4241352 - 05/31/05 08:27 PM (5 years, 3 months ago) |
|
|
No, I would never inject ANY drug.
The reason I was asking about a salt cold water/freeze morphine extract is so I could get a smoke-able product from poppy straw.
See, tea is great and all, but sometimes you just want to experience the full spectrum.
I will admit smoking an extracted morphine will NOT be the same as smoking 'whole opium' lanced from the pods, but it would be the closest somebody like me could get.
Also, I DID make a separate thread about this, but no one seemed to have any answers.
--------------------
these long agonizing months without you...have been long and agonizing..
"War Doesn't Decide Who's Right... It Only Decides Who's Left."
|
Iamthewalrus
every evening Idied and everynight I wasreborn
Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 10 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#4241536 - 05/31/05 09:26 PM (5 years, 3 months ago) |
|
|
I pmed you about editing the guide...my buddy seems to have lost most interest in this forum so I doubt he'll mind the slight edit but after seeing it you may change your mind(its really good shit)...its not about extracting morphine its about taking your opium and refining it slightly again with some great pics(also a guide for mixing ice hash(which he made as well) with opium
EDIT: WOOHOO! my tassies have germinated(using the guide in question )
oh and btw I re-read what you think is suitable for this thread and I honestly think the whole guide is...the "extraction" part is a simple one that just gets the opium into a more pure form...theres nothing about extracting morphine or anything...the only part you may not want is the mixing with hash hes included including a pic of growroom(weed) he was once a mod at overgrow(not that that matters)
Edited by Iamthewalrus (06/02/05 05:59 AM)
|
Iamthewalrus
every evening Idied and everynight I wasreborn
Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 10 months
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#4249647 - 06/02/05 09:06 PM (5 years, 3 months ago) |
|
|
well I know your a busy man wiccan since I haven't gotten a response yet from my pm...so later on I'm gonna go ahead and post the guide myself...I'm keeping it in tact and anything you want out feel free to edit
|
Iamthewalrus
every evening Idied and everynight I wasreborn
Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 10 months
|
Re: Poppies - from Poppyseed to Opium *DELETED* [Re: Iamthewalrus]
#4249951 - 06/02/05 10:12 PM (5 years, 3 months ago) |
|
|
Post deleted by IamthewalrusReason for deletion: updated version of this tek is already posted so one of the mods can move it over since starter has given permission
|
Twirling
Barred Spiral
Registered: 02/03/03
Posts: 2,465
Last seen: 1 month, 28 days
|
Re: Poppies - from Poppyseed to Opium [Re: Iamthewalrus]
#4250413 - 06/02/05 11:59 PM (5 years, 3 months ago) |
|
|
Awesome thread. What are the differences in psychoactive effects of the different strains of poppies? I've read that giganthemum tend to be more narcotic, whereas the smaller varities are more euphoric. Any more input on that?
It's obvious to me that the drug war absolutly ruins the poppy and people's use of opiates/opioids because the profit for heroin is so much greater than that of morphine, and especially opium. Morphine can easily be converted into heroin, which is 5x's as potent, and thus allows drug networks to increase the volume they sell. Instead of people using a much more subtle drug, the market is flooded with the hardest and most damaging of the opiate/opioid chemicals. Opium has it's dangers, sure, but it's of a far different magnitude.
|
neuro
Phytophiliac
Registered: 08/11/99
Posts: 6,604
Loc: Rigel 7
Last seen: 3 days, 2 hours
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Iamthewalrus]
#4250548 - 06/03/05 12:38 AM (5 years, 3 months ago) |
|
|
Are you referring to this thread?
|
Iamthewalrus
every evening Idied and everynight I wasreborn
Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 10 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: neuro]
#4250980 - 06/03/05 02:36 AM (5 years, 3 months ago) |
|
|
ya thats the one I didn't know it was posted doh! lol...well I'll just continue posting it so its here in the poppy thread...he mentioned something about it being archived so that makes sense...oh well
EDIT: lol wiccan I just talked to starter and he mentioned that you asked about putting this guide in this thread already...I wish I knew that thread existed...anyways you can bring it over or I can continue posting its your call
Edited by Iamthewalrus (06/03/05 02:55 AM)
|
Iamthewalrus
every evening Idied and everynight I wasreborn
Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 10 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Iamthewalrus]
#4253623 - 06/03/05 09:28 PM (5 years, 3 months ago) |
|
|
this lil guy popped up RIGHT where I was planting my seeds...i've never grown poppies before so I can't be 100% but I'm pretty sure it is(nothing else around here that looks like that)...what do you guys think?
|
pshawny
Mycobian
Registered: 09/11/04
Posts: 1,332
Loc: Shroomery
Last seen: 1 year, 6 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: MycoCakeEater]
#4254344 - 06/04/05 12:59 AM (5 years, 3 months ago) |
|
|
Can empty pods be dried, ground into powder, capsuled, and ingested with positive results?
--------------------
|
Iamthewalrus
every evening Idied and everynight I wasreborn
Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 10 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: pshawny]
#4257677 - 06/05/05 12:18 AM (5 years, 3 months ago) |
|
|
well looks like starter updated the guide slightly since before it was public and also added a few more pics so one of the mods can move that one over here if they want(he gave me the go ahead so no need to ask) and I'm deleting my post
my tassies are germinating like crazy...I've heard they are in high demand with a low supply so I'll make sure to let some pods go to seed and spread em around
my store bought poppy seeds are also germinating but I plan to detroy them at cabbage stage since poppies will cross polinate(from what I've read) and obviously I wanna keep the tassies pure
|
ShroomOmatic
Ethno Apprentice
Registered: 10/15/04
Posts: 2,373
Loc: Sailing the Seas of Chees...
|
Re: Poppies - from Poppyseed to Opium [Re: Twirling]
#4258579 - 06/05/05 04:11 AM (5 years, 3 months ago) |
|
|
WOW! What an amazing post! Thank you for all the good info!
--------------------
|
rocknliam
happy willowdweller
Registered: 12/12/03
Posts: 307
Last seen: 2 months, 22 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Iamthewalrus]
#4258663 - 06/05/05 04:44 AM (5 years, 3 months ago) |
|
|
Iamthewalrus - Are they in pots? if so you could give them to a friend to raise, or you could try putting sandwhich bags or paper bags over the flowers to stop pollen spreading, Just a thought, might be too much work though, not sure what the size of your project is.
|
Iamthewalrus
every evening Idied and everynight I wasreborn
Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 10 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: rocknliam]
#4258711 - 06/05/05 05:14 AM (5 years, 3 months ago) |
|
|
they are in trays mostly in the pics I posted above...theres one pot(1 tassie pot too) but they haven't germinated in there yet(the store bought, tassies have)...tassies are WAY ahead...good call on the friend thing tho I think I'm gonna do that...don't wanna waste any goodies
EDIT: btw can anyone tell me if thats a poppy or not growing where I planted(I'm pretty sure it is based on the colour and shape of the leaves but again this is my first go so I can't be 100% sure...pretty sure its a tassie as well
Edited by Iamthewalrus (06/05/05 05:16 AM)
|
rocknliam
happy willowdweller
Registered: 12/12/03
Posts: 307
Last seen: 2 months, 22 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Iamthewalrus]
#4258738 - 06/05/05 05:32 AM (5 years, 3 months ago) |
|
|
I was leaning more towards non poppy as it doesnt look like any of the ones i have grown, the leaves tend to be more wavy and softer looking, hard to describe, but i could well be wrong, i have only grown twice before myself.
|
Iamthewalrus
every evening Idied and everynight I wasreborn
Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 10 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: rocknliam]
#4258746 - 06/05/05 05:34 AM (5 years, 3 months ago) |
|
|
either way I got lots germinating so its no biggie..its just RIGHT in the area I planted and nothing else around here looks like that...it also has a lot features of a poppy...and is getting bigger and bigger....guess we'll find out
thx for the response tho...was hoping SOMEONE would 
|
Iamthewalrus
every evening Idied and everynight I wasreborn
Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 10 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Iamthewalrus]
#4309484 - 06/18/05 12:34 AM (5 years, 2 months ago) |
|
|
I'll post pics of my poppies tomorrow...there coming along slowly...is it normal for them to be pretty slow in teh early stages? I'm just starting to get jaggy leaves coming out(single red tasmanian btw)...good news is they survived a massive heat wave recently thats about as hot as our summers get...so I'm confident they will be fine...its times like these that make me proud to be a canadian! :P
|
rocknliam
happy willowdweller
Registered: 12/12/03
Posts: 307
Last seen: 2 months, 22 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Iamthewalrus]
#4310186 - 06/18/05 06:28 AM (5 years, 2 months ago) |
|
|
Oh i thought you were Aussie, i'll post some pics of mine soon too.
|
Iamthewalrus
every evening Idied and everynight I wasreborn
Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 10 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: rocknliam]
#4312032 - 06/18/05 10:48 PM (5 years, 2 months ago) |
|
|
I didn't have access to the cam today(its not mine) so soon as I get it and its daylight I'll post pics
|
rocknliam
happy willowdweller
Registered: 12/12/03
Posts: 307
Last seen: 2 months, 22 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: rocknliam]
#4312760 - 06/19/05 02:42 AM (5 years, 2 months ago) |
|
|
Ok here are some pics of the small poppy grow i have at home. These originated from store bought spice rack poppy seeds. I grew them once, and these are grown from the seed that i collected from my first grow.
I think i may be a little tight on soil space, as this is my first time in pots, and i have only grown in the ground before, so i dont know how well these will go - we will have to see.
These are some little ones that were transplanted not long ago into this pot. Their growth is a little slower than that of the other poppies, i have used no fertilisers on any of them. My hand for size comparison.
 
This poppy is at about the same stage of growth as the later ones, but is much smaller, i am going to keep seed from this one seperate and hopefully get a little substrain of smaller poppies.
This is a bunch of poppy seeds that have just grown in a pot, i am debating on wether to thin these and get a bit of a usable product or just watch them and see which ones survive.
The next three pictures are of poppies that i have under my window. They are the largest of them all so far, and there are 7 plants, in two boxes. I think the boxes may be too small, but we'll see. (i've only grown in the ground once before, this is first time in pots)
  
|
Iamthewalrus
every evening Idied and everynight I wasreborn
Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 10 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: rocknliam]
#4312867 - 06/19/05 03:34 AM (5 years, 2 months ago) |
|
|
mine are still much smaller then those...just starting to get some jagged leaves coming out...I've decided I'm not thining(even tho they are in lil cubes)...I'm just gonna put the whole cubes in the ground once they are about as big as the ones in your first pic and see what happens...I'm happy to have even gotten germination my first go
|
Iamthewalrus
every evening Idied and everynight I wasreborn
Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 10 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Iamthewalrus]
#4315267 - 06/19/05 11:29 PM (5 years, 2 months ago) |
|
|
got the cam and will post pics in the mornin! ...they look so sexy...I'm just happy that they survived the last week when we had EXTREMELY high temps for this time of year...I know now they can take whatever my summer has to throw at them...and that gives them the perfect amount of time to grow full size and be ready in the fall(right along side with weed)
|
JaguarWarrior101
ShamanicAlchemist InTraining
Registered: 03/24/05
Posts: 184
Loc: State of Euphoria
Last seen: 4 years, 1 month
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Iamthewalrus]
#4315610 - 06/20/05 01:29 AM (5 years, 2 months ago) |
|
|
They grow fast, I seen them get 10x bigger in like a week after thinning out the extra ones. Mine are around the same size as rockinliam's.
--------------------
The above post is purely hypothetical, and should not be considered the true thoughts, opinions, or actions of a real life person.
We perceive. This is hard fact. But what we perceive is not a fact of the same kind, because we learn what to perceive.
~Carlos Castaneda
|
CloakandDagger
Stranger
Registered: 12/12/04
Posts: 95
Last seen: 3 years, 7 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: JaguarWarrior101]
#4315643 - 06/20/05 01:41 AM (5 years, 2 months ago) |
|
|
I've got mad germination my first time, indoor grow, within about 5 days i'm already seeing those nice little green stalks start to make their way out of the soil
|
JaguarWarrior101
ShamanicAlchemist InTraining
Registered: 03/24/05
Posts: 184
Loc: State of Euphoria
Last seen: 4 years, 1 month
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: CloakandDagger]
#4315661 - 06/20/05 01:49 AM (5 years, 2 months ago) |
|
|
I found germination outdoors to be very high, I put them in moisture domes and left them outside. Temps ranged from 4-13*c during the germination time. I've heard the cool temps are actually good for this.
--------------------
The above post is purely hypothetical, and should not be considered the true thoughts, opinions, or actions of a real life person.
We perceive. This is hard fact. But what we perceive is not a fact of the same kind, because we learn what to perceive.
~Carlos Castaneda
|
Iamthewalrus
every evening Idied and everynight I wasreborn
Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 10 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: JaguarWarrior101]
#4316153 - 06/20/05 06:30 AM (5 years, 2 months ago) |
|
|
I think the heat wave we had slowed em down a lil...they seemed to have picked up speed now that the temp has dropped...I'm gonna take a pic once the sun is out a lil more
|
Iamthewalrus
every evening Idied and everynight I wasreborn
Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 10 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Iamthewalrus]
#4316582 - 06/20/05 12:16 PM (5 years, 2 months ago) |
|
|
heres some of my baby tassies:
|
FooMan
Libertarian
Registered: 02/02/05
Posts: 7,205
Loc: Gulf Coast 
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#4319742 - 06/21/05 08:05 AM (5 years, 2 months ago) |
|
|
--------------------
"Those who would sacrifice a little freedom for a little order, will lose both, and deserve neither."
"When the people fear their government there is tyranny; when the government fears the people, there is liberty."
-The wise words of Thomas Jefferson
|
JaguarWarrior101
ShamanicAlchemist InTraining
Registered: 03/24/05
Posts: 184
Loc: State of Euphoria
Last seen: 4 years, 1 month
|
Re: Poppies - from Poppyseed to Opium [Re: FooMan]
#4322368 - 06/21/05 10:12 PM (5 years, 2 months ago) |
|
|
I might have to get some snap shots myself to share...
--------------------
The above post is purely hypothetical, and should not be considered the true thoughts, opinions, or actions of a real life person.
We perceive. This is hard fact. But what we perceive is not a fact of the same kind, because we learn what to perceive.
~Carlos Castaneda
|
Wiccan_Seeker
INFJcounselor-idealist
Registered: 02/06/02
Posts: 23,156
Loc: Virgo Supercluster (or b...
Last seen: 5 hours, 23 minutes
|
|
POPPIES - FROM POPPYSEED TO OPIUM
The thread that delivers, delivers..
And keeps on delivering
Oook it's Poppy Garden time! Last year I bought a supermarket gardenseed packet for Papaver somniferum var. "Danish Flag"http://files.shroomery.org/files/05-25/943014364-danishpoppy02.jpg>
.
Hmm, a poppy closeup! Look at those flowers! My garden was swarming with bumblebees eager to pollinate the flowers, and there's one in the left flower right now. They flew from flower to flower, I saw the pollination of flower X with Y happen before my eyes! I had a pic where one bumblebee was "doing" a flower and another patiently hovered over it for his turn - but the pic was a blur.
.
.
This is a true Ethno Garden pic! Here you see a psychoactive Danish poppy, and the wooden bowl below it holds last years harvest, from the best of which that very poppy was sown.
The 24gr poppies in the bowl will give 2 cups of (4gr) Lemon Laudanum to each of three voyagers, making for a luxurious Opium day.
--------------------------------
come on people, keep it coming!
its the best poppythread ever!
--------------------------------
|
JaguarWarrior101
ShamanicAlchemist InTraining
Registered: 03/24/05
Posts: 184
Loc: State of Euphoria
Last seen: 4 years, 1 month
|
 Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#4327289 - 06/23/05 02:54 AM (5 years, 2 months ago) |
|
|
How do you like these little guys?
--------------------
The above post is purely hypothetical, and should not be considered the true thoughts, opinions, or actions of a real life person.
We perceive. This is hard fact. But what we perceive is not a fact of the same kind, because we learn what to perceive.
~Carlos Castaneda
|
MeneerCactus
Free Spore RingEurope
Registered: 01/20/02
Posts: 1,094
Loc: The Low Lands
Last seen: 10 months, 15 days
|
 Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#4327497 - 06/23/05 04:13 AM (5 years, 2 months ago) |
|
|
High,
On your special request here the copy and paste from topic http://www.shroomery.org/forums/showflat.php/Cat/0/Number/4319765/an/0/page/1/gonew/1#UNREAD
High All,
It is time for a new post. It is entheo garden related and I think this is the right forum to place my pictures.
Papaver Somniferum is a very easy and beautifull plant to grow. Just through the seeds in your garden in spring or fall and nature does the rest. After a few years your garden is cased with poppie seed and it will act like weed.
Many rivers to cross and a few steps to have a nice smoke.
Here we go...
All that is needed.
Yesterdays fresh harvest.
The harvest is put into some water.
The water is heated (30 minutes) "Au Bain Marie" poppie water does not boil.
I used aquariumfilter synthetic cotton (polyfill alike) to filter the O-water.
Filtered the O-water twice this way.
Placed the juice in a petries under a lamp (warm not hot).
14 hrs later it was dried and ready to scratch.
A nice result and transformation of yesterdays harvest.
And a kind of close up.
Thats all fooks, I hope you enjoyed the show!
--------------------
"Millions of years of evolution just to .... light up a joint"
|
JaguarWarrior101
ShamanicAlchemist InTraining
Registered: 03/24/05
Posts: 184
Loc: State of Euphoria
Last seen: 4 years, 1 month
|
Re: Poppies - from Poppyseed to Opium [Re: MeneerCactus]
#4328220 - 06/23/05 01:18 PM (5 years, 2 months ago) |
|
|
Any word on how to extract alkaloids from the plant itself? It's a shame to let them go to waste...
--------------------
The above post is purely hypothetical, and should not be considered the true thoughts, opinions, or actions of a real life person.
We perceive. This is hard fact. But what we perceive is not a fact of the same kind, because we learn what to perceive.
~Carlos Castaneda
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#4329409 - 06/23/05 07:14 PM (5 years, 2 months ago) |
|
|
Update on my Gigs
All plants seem to have four pods each...quite happy so far
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
JaguarWarrior101
ShamanicAlchemist InTraining
Registered: 03/24/05
Posts: 184
Loc: State of Euphoria
Last seen: 4 years, 1 month
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#4330394 - 06/23/05 11:13 PM (5 years, 2 months ago) |
|
|
Nice!
--------------------
The above post is purely hypothetical, and should not be considered the true thoughts, opinions, or actions of a real life person.
We perceive. This is hard fact. But what we perceive is not a fact of the same kind, because we learn what to perceive.
~Carlos Castaneda
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
|
Thank you
Quote:
Any word on how to extract alkaloids from the plant itself? It's a shame to let them go to waste...
My understanding is that the pod and the five inches of stem below are the most worthy and everything else...heh, maybe you could try pod puddy on the leaves, and compost the rest.
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
JaguarWarrior101
ShamanicAlchemist InTraining
Registered: 03/24/05
Posts: 184
Loc: State of Euphoria
Last seen: 4 years, 1 month
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#4332081 - 06/24/05 01:06 PM (5 years, 2 months ago) |
|
|
I read somewhere here that the plant contains 10% of the alkaloids as the pods, if this is true and though that is low, the amount of biomass of the plant would mean that's still quite a bit.
Looking at your poppies makes me feel like I planted mine a little late... 
--------------------
The above post is purely hypothetical, and should not be considered the true thoughts, opinions, or actions of a real life person.
We perceive. This is hard fact. But what we perceive is not a fact of the same kind, because we learn what to perceive.
~Carlos Castaneda
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
|
I guess we'll have to wait for an expert.
I sowed mine Feb/March, the first warm day the snow melted. I'm in zone 5, last year I didn't plant till May 1, but still got a nice harvest in August.
I'm starting to think the most important part of sowing is to magically time the bloom with your summer's drought 
Was just reading over at PORG, I never knew that the longer you let them grow, the bigger they get
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
Wiccan_Seeker
INFJcounselor-idealist
Registered: 02/06/02
Posts: 23,156
Loc: Virgo Supercluster (or b...
Last seen: 5 hours, 23 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#4333033 - 06/24/05 05:42 PM (5 years, 2 months ago) |
|
|
indeed: dried pods contain 1.5-5% Opium (as 10% morphine) whereas dried plant contains 0.15-0.5% per weight. Still that means that 40gr dried poppy plant (1/25 kg) holds a dose of 60-200mg Opium, the orally active range of 1-3 grains.
2-10gr pods = 20-100gr plant
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#4333827 - 06/24/05 10:23 PM (5 years, 2 months ago) |
|
|
Quote:
2-10gr pods = 20-100gr plant
WoW!
After two weeks of rain, the thunderclouds came. Knowing these were immature I thought it would be best to pick them rather than let them become diluted. Got these seeds from Lifenergy, Thank you wherever you are 
and something that looks like boobs
Thank you for all the great info Wiccan, I'm always telling my wife stories about you. We have decided to let the pods dry, and save them for very special occaisions (once or twice a year), where they'll be mixed with yogurt or ice-cream, sposta be more efficient and less bitter 
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
MeneerCactus
Free Spore RingEurope
Registered: 01/20/02
Posts: 1,094
Loc: The Low Lands
Last seen: 10 months, 15 days
|
|
Quote:
JaguarWarrior101 said:
Any word on how to extract alkaloids from the plant itself? It's a shame to let them go to waste...
On poppies.org forum in the tearoom is a post about a kind of ICE O Lation process which extracts pure O from poppie tea (pt). I gues this tek can also work for the parts you suggested.
--------------------
"Millions of years of evolution just to .... light up a joint"
|
JaguarWarrior101
ShamanicAlchemist InTraining
Registered: 03/24/05
Posts: 184
Loc: State of Euphoria
Last seen: 4 years, 1 month
|
Re: Poppies - from Poppyseed to Opium [Re: MeneerCactus]
#4342870 - 06/27/05 02:10 PM (5 years, 2 months ago) |
|
|
Quote:
MeneerCactus said:
Quote:
JaguarWarrior101 said:
Any word on how to extract alkaloids from the plant itself? It's a shame to let them go to waste...
On poppies.org forum in the tearoom is a post about a kind of ICE O Lation process which extracts pure O from poppie tea (pt). I gues this tek can also work for the parts you suggested.
I can't seem to do a search on there because I'm not a member, and they aren't accepting new members. Any chance you could post or PM me a link?
--------------------
The above post is purely hypothetical, and should not be considered the true thoughts, opinions, or actions of a real life person.
We perceive. This is hard fact. But what we perceive is not a fact of the same kind, because we learn what to perceive.
~Carlos Castaneda
|
DeQuincy
Paddo hunter
Registered: 03/16/01
Posts: 68
Loc: The Netherlands
Last seen: 2 years, 7 months
|
|
This Iceolation process originates from a someone called Ab Strak and was first publiced (to my knowledge) on an site called clubopium.tk
Here's a link:
http://adh.2.forumer.com/index.php?s=e70268609213f3dd4fffb021016c2a42&showtopic=171
Good luck.
--------------------
there's no vestige of a beginning no prospect of an end
(hutton)
if you came to conquer, you'll be king for a day, but you too will deteriorate and quickly fade away...
you have NO CONTROL
(bad religion)
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan 
Last seen: 2 hours, 6 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: DeQuincy]
#4345816 - 06/28/05 03:42 AM (5 years, 2 months ago) |
|
|
ok let me see if i got this right, like would it work.
, you puree frozen, seedless, dry pods in ice old water,
then let sit for hours in the fridge, disolving morphine,
then you decant the liquid out, and allow the liquid to freze.
then remove ie rystals with a seive, and repeat a few times untill muh water has been sooped away.
then you put the remaining alkaloid rich liquid into a tray, and then reduce at about 70c untill all that is left is dry residue.
and bingo thats good stong-ass opium?
is that it in a nuthell, or am i missing something obvious/
--------------------
|
JaguarWarrior101
ShamanicAlchemist InTraining
Registered: 03/24/05
Posts: 184
Loc: State of Euphoria
Last seen: 4 years, 1 month
|
Re: Poppies - from Poppyseed to Opium [Re: Mitchnast]
#4346655 - 06/28/05 02:14 PM (5 years, 2 months ago) |
|
|
What do you guys think of the following? I find it very interesting, but am curious why they suggest a grain based alcohol.
Laudanum, a tincture of opium, was very popular in high social circles around the turn of the century.
It was used by practically every English author at that time, as well as statesmen, diplomats, and anyone else who had a liking for it. Opium was legal in most western nations until the early twentieth century, and Laudanum could be purchased at any drug or general store.
To prepare Laudanum, simply dissolve as much opium as possible in a jug of pure grain alcohol.
Everclear works great. Do not use denatured, wood, or isopropyl (rubbing) alcohol. Purchase your alcohol only from a liquor store or from a reputable moonshiner. Laudanum tastes absolutely terrible, but some things are worth forcing down. The main advantage of Laudanum is that the alcohol acts as a preservative, and helps to maintain that "just picked" freshness in your opium. The alcohol also pre-dissolves the opium so that it enters your body more efficiently.
~ http://www.erowid.org/plants/poppy/opium_poppy_cultivation/opium_poppy_cultivation5.shtml
--------------------
The above post is purely hypothetical, and should not be considered the true thoughts, opinions, or actions of a real life person.
We perceive. This is hard fact. But what we perceive is not a fact of the same kind, because we learn what to perceive.
~Carlos Castaneda
|
Wiccan_Seeker
INFJcounselor-idealist
Registered: 02/06/02
Posts: 23,156
Loc: Virgo Supercluster (or b...
Last seen: 5 hours, 23 minutes
|
|
Wood alcohol is poison, rubbing alcohol isnt good either and potato alcohol often tastes foul.
Hence the grain alcohol. They mean high proof spirits specifically sold for human consumption.
|
DeQuincy
Paddo hunter
Registered: 03/16/01
Posts: 68
Loc: The Netherlands
Last seen: 2 years, 7 months
|
Re: Poppies - from Poppyseed to Opium [Re: Mitchnast]
#4349451 - 06/29/05 04:29 AM (5 years, 2 months ago) |
|
|
Mitchnast, here's another write-up on the same method. This one was created by Shaganos of the porg after Ab's method.
I cannot post the link due to specific forum rules, pm me if you like to have the link (discussion etc)
1. Take pods, dried or fresh, and freeze them
2. Add 4 parts water for each 1 part pod material into a blender and grind it up good
3. Pour it over in a mug or similar, stirr it well for some minutes, then let it sit for about 1 hour in room temp.
4. Strain it to discard the biggest chunks, use a strainer with fairly big holes.
5. Fill the upper brown and most clear layer over into a bottle, let the rest stay in the mug
6. Extract the goo and particles left in the mug with more water, like was done with the pods in step 2 and 3.
7. Strain and pour this solution also over into the bottle
8. Shake bottle and put in a freezer (Dont cap the bottle, could explode if pressure expands it while freezing)
9. When half the solution in the bottle has frozen filtrate it with a cloth (t-shirts work fine) and discard the ice.
10. Put the solution back into bottle, shake it well, freeze it down again like in step 8 and 9.
11. Take this second filtrated solution and evaporate it in a pot placed in a larger pot with cooking water (warm bath)
12. The brown substance left in the smaller pot when evaporated, sometimes a bit like mexican tar, can be smoked.
Good luck
--------------------
there's no vestige of a beginning no prospect of an end
(hutton)
if you came to conquer, you'll be king for a day, but you too will deteriorate and quickly fade away...
you have NO CONTROL
(bad religion)
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: DeQuincy]
#4351855 - 06/29/05 07:56 PM (5 years, 2 months ago) |
|
|
  
  
  
 
i found alot of plants, some of which i never expected to come up, like whole patches of tiny poppies around parking lots.
many of the poppies growing on the dyke are waist-high, and have many tillers.
still my favorite one is the one that popped up in my front yard. here it is.
  
--------------------
Edited by Mitchnast (07/01/05 02:49 PM)
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: Mitchnast]
#4351863 - 06/29/05 07:58 PM (5 years, 2 months ago) |
|
|
the white one is actually purple just much lighter purple
the tiny one are darker purple.
i think it look like they are lighter when larger.
these are bulk seed from bulk barn.
--------------------
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Mitchnast]
#4352240 - 06/29/05 09:33 PM (5 years, 2 months ago) |
|
|
So how about an Everclear extraction on the "bulk material" or plant puddy?
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: Poppies - from Poppyseed to Opium *DELETED* [Re: namaste]
#4353389 - 06/30/05 12:58 AM (5 years, 2 months ago) |
|
|
Post deleted by MitchnastReason for deletion: h5
--------------------
|
Iamthewalrus
every evening Idied and everynight I wasreborn
Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 10 months
|
Re: Poppies - from Poppyseed to Opium [Re: Mitchnast]
#4353580 - 06/30/05 01:33 AM (5 years, 2 months ago) |
|
|
I know of that stinging plant...we get them here...it definitely stings like a bitch(its comparable to being stung by a bee in multiple places)
|
flowstone
blustering
Registered: 01/25/05
Posts: 6,485
Loc: precious
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: flowstone]
#4356549 - 06/30/05 08:08 PM (5 years, 2 months ago) |
|
|
Quote:
flowstone said:
Here is a tek to extract morphine from pods.
Quote:
iceolated smokeables
by Ab Strak
fresh pods were freezed, then ground in a blender, with 3 volume equivalents of cold water,
and allowed to stand for 1 hour.
The resulting goo was stirred, then sifted crudely, to retain the biggest pieces.
The filtrate was allowed to stand for 1 hour at room temperature, after which the fairly clear,
light brown top layer was decanted into a bottle, which was not to be filled completely.
The filter residue was extracted again with water, fractions were combined.
The closed bottle was kept still, in a freezer at -5 centigrade until 2/3 of the solution was frozen.
The freezing solution was filtrated, after which the ice was discarded.
The filtrate was put back in the bottle, and the freezing procedure was repeated.
The resulting brown solution was allowed to evaporate on a hot water bath,
yielding a brittle brown substance which was potent and tasteful enough to smoke pleasurably.
Hypothesis of the success of the procedure:
The active ingredient, a morphine salt, is highly soluble, even in cold water.
Acid or base addition is unnecessary and unwanted because of possible decomposition of the salt,
into possibly less soluble constituents.
Heating is unnecessary and unwanted because of possible degradation of saccharides and peptides (inflicted effect explained below),
and additional dissolving other unwanted materials, like lipids.
The crystallization of water in the solution forces other molecules than water out of the matrix.
Small molecules, like morphine maleate move easily to stay in the liquid phase.
Large molecules, like (poly)saccharides and (poly)peptides can not move easily enough, and are included in the ice.
An additional effect may be that plant saccharides have a high affinity to water.
So, may be, small saccharides are included in the ice as well.
The freezing therefore accomplishes a separation between alkaloids and "nutritional" materials.
This statement is confirmed by direct evaporation of cold water extract.
It is important not to break the ice crystals during formation, because cavities will form, enclosing active ingredients.
This is experimentally confirmed.
Additional note:
The extraction can be accomplished from dried pods also, however, a third extraction step is required,
and more time to allow for dissolving.
and here is the same tek written by another person, reworded( somewhat simpler to understand0
Quote:
1. Take pods, dried or fresh, and freeze them
2. Add 4 parts water for each 1 part pod material into a blender and grind it up good
3. Pour it over in a mug or similar, stirr it well for some minutes, then let it sit for about 1 hour in room temp.
4. Strain it to discard the biggest chunks, use a strainer with fairly big holes.
5. Fill the upper brown and most clear layer over into a bottle, let the rest stay in the mug
6. Extract the goo and particles left in the mug with more water, like was done with the pods in step 2 and 3.
7. Strain and pour this solution also over into the bottle
8. Shake bottle and put in a freezer (Dont cap the bottle, could explode if pressure expands it while freezing)
9. When half the solution in the bottle has frozen filtrate it with a cloth (t-shirts work fine) and discard the ice.
10. Put the solution back into bottle, shake it well, freeze it down again like in step 8 and 9.
11. Take this second filtrated solution and evaporate it in a pot placed in a larger pot with cooking water (warm bath)
12. The brown substance left in the smaller pot when evaporated, sometimes a bit like mexican tar, can be smoked.
This type of Morphine salt extracted with this method is highly soluble in cold water
No need for any acidic chemicals in the process, no ascorbic acid, lemon juice, etc. This makes it less soluble.
The morphine stays in the water, the junk in the ice that you discard.
Hey guys, just thought I would let you know I am trying this^ tek with a small batch. I will let you know how it turns out!
--------------------
these long agonizing months without you...have been long and agonizing..
"War Doesn't Decide Who's Right... It Only Decides Who's Left."
|
rocknliam
happy willowdweller
Registered: 12/12/03
Posts: 307
Last seen: 2 months, 22 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: flowstone]
#4358179 - 07/01/05 04:01 AM (5 years, 2 months ago) |
|
|
i might try that with some pods i have from last years grow, i too shall let you know how it goes if i do it.
|
liveby
Wasted For Time
Registered: 06/15/04
Posts: 1,509
Last seen: 2 months, 9 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: rocknliam]
#4358257 - 07/01/05 04:19 AM (5 years, 2 months ago) |
|
|
interesting essay that was quite interesting :
http://www.ieo.org/opm_mass.html - monkeys addicted to opium
--------------------
http://www.bruceeisner.com/ -Creating a Sensible Culture
Edited by liveby (07/01/05 04:42 AM)
|
rocknliam
happy willowdweller
Registered: 12/12/03
Posts: 307
Last seen: 2 months, 22 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: liveby]
#4358276 - 07/01/05 04:24 AM (5 years, 2 months ago) |
|
|
John - Let's not fuck up this thread.
|
liveby
Wasted For Time
Registered: 06/15/04
Posts: 1,509
Last seen: 2 months, 9 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: rocknliam]
#4358310 - 07/01/05 04:38 AM (5 years, 2 months ago) |
|
|
Quote:
rocknliam said:
John - Let's not fuck up this thread.
--------------------
http://www.bruceeisner.com/ -Creating a Sensible Culture
|
eve69
--=..Did Adam and ...?=--
Registered: 04/30/03
Posts: 2,524
|
 Re: Poppies -- from Poppyseed to Cooked Opium [Re: liveby]
#4358822 - 07/01/05 10:56 AM (5 years, 2 months ago) |
|
|
I just wanted to say, (though I don't want to destroy the high nature of the thread) I am a poppy addict, and I have been so on and off for five years, and the addiction is as strong or worse than heroin, and so poppies aren't all that fun all the time, especially as soon as one has reached their tolerance and the high fades and it becomes a bad tasting drudgery of just keeping the withdrawls away.
I just wanted people reading this to also consider this so that they have some balanced viewpoint.
A good thread idea would be methods you have used to quit. I could write a book having quit at least twenty times.
--------------------
 
|
rocknliam
happy willowdweller
Registered: 12/12/03
Posts: 307
Last seen: 2 months, 22 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: eve69]
#4362563 - 07/02/05 10:39 AM (5 years, 2 months ago) |
|
|
So i did this extraction, though i cut alot of corners and modified the method a little. Anyway i did this on 7 small to medium dry pods that were about a year old, maybe a little less.
It does smoke, though i haven't smoked any to test potency etc. I dont know if i will even use this stuff as it seems like i might enjoy it too much, not sure though.
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
pics from today. out in the wild patch, a la jhonny poppyseed [Re: rocknliam]
#4363253 - 07/02/05 04:00 PM (5 years, 2 months ago) |
|
|
Edited by Mitchnast (07/02/05 04:10 PM)
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: pics from today. out in the wild patch, a la jhonny poppyseed [Re: Mitchnast]
#4364830 - 07/03/05 01:17 AM (5 years, 2 months ago) |
|
|
ok,now ive long been under the impresion that opium poppies are legal to grow for floral uses and seed in canada.
i just went over the books and according to the law, the plant, all preparations, andeven the seeds are schedule one.
actually growing them could carry life imprisonment.
is this right?
cause i buy the seeds at any store, for food aND in garden centers, for growing.
ive seen them in almost any respectable garden INCLUDING public civic gardens.
i could walk around town and point out dozens of old cogers guilty of an idictable offence with HUGE penalties.
ive never known ANYONE to be charged for growing and evry horticulturist ive spoken to has assured me that papaver somniferum is perfectly legal, when according to the actual written law, you cant posses the plant..
am i missing something here? or should i yank up my cabbages?
--------------------
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: pics from today. out in the wild patch, a la jhonny poppyseed [Re: Mitchnast]
#4364837 - 07/03/05 01:20 AM (5 years, 2 months ago) |
|
|
http://www.erowid.org/psychoactives/law/countries/law_canada.shtml
SCHEDULE I
(Sections 2 to 7, 29, 55 and 60)
1. Opium Poppy (Papaver somniferum), its preparations, derivatives, alkaloids and salts, including:
(1) Opium
(2) Codeine (methylmorphine)
(3) Morphine (7,8--didehydro--4,5--epoxy--17--methylmorphinan--3,6--diol)
(4) Thebaine (paramorphine)
and the salts, derivatives and salts of derivatives of the substances set out in subitems (1) to (4), including:
(5) Acetorphine (acetyletorphine)
(6) Acetyldihydrocodeine (4,5--epoxy--3--methoxy--17--methylmorphinan--6--ol acetate)
(7) Benzylmorphine (7,8--didehydro--4,5--epoxy--17 --methyl--3--(phenylmethoxy) morphinan--6--ol)
(8) Codoxime (dihydrocodeinone O--(carboxymethyl) oxime)
(9) Desomorphine (dihydrodeoxymorphine)
(10) Diacetylmorphine (heroin)
(11) Dihydrocodeine (4,5--epoxy--3--methoxy--17--methylmorphinan--6--ol)
(12) Dihydromorphine (4,5--epoxy--17--methylmorphinan--3,6--diol)
(13) Ethylmorphine (7,8--didehydro--4,5--epoxy--3--ethoxy--17--methylmorphinan--6--ol)
(14) Etorphine (tetrahydro--7?--(1--hydroxy--1--methylbutyl)--6,14--endo--ethenooripavine)
(15) Hydrocodone (dihydrocodeinone)
(16) Hydromorphinol (dihydro--14--hydroxymorphine)
(17) Hydromorphone (dihydromorphinone)
(18) Methyldesorphine (?6--deoxy--6--methylmorphine)
(19) Methyldihydromorphine (dihydro--6--methylmorphine)
(20) Metopon (dihydromethylmorphinone)
(21) Morphine--N--oxide (morphine oxide)
(22) Myrophine (benzylmorphine myristate)
(23) Nalorphine (N--allylnormorphine)
(24) Nicocodine (6--nicotinylcodeine)
(25) Nicomorphine (dinicotinylmorphine)
(26) Norcodeine (N--desmethylcodeine)
(27) Normorphine (N--desmethylmorphine)
(28) Oxycodone (dihydrohydroxycodeinone)
(29) Oxymorphone (dihydrohydroxymorphinone)
(30) Pholcodine (3--[2--(4--morpholinyl)ethyl]morphine)
(31) Thebacon (acetyldihydrocodeinone)
but not including
(32) Apomorphine (5,6,6a,7--tetrahydro--6--methyl--4H --dibenzo[de,g]quinoline--10,11--diol)
(33) Cyprenorphine (N--(cyclopropylmethyl)--6,7,8,14--tet- rahydro--7?--(1--hydroxy--1--methylethyl)--6,14--endo --ethenonororipavine)
(34) Nalmefene (17-(cyclopropylmethyl)-4,5?-epoxy-6-methylenemorphinan-3,14-diol)
(34.1) Naloxone (4,5?-epoxy-3,14-dihydroxy-17-(2- propenyl)morphinan-6-one)
(34.2) Naltrexone (17-(cyclopropylmethyl)-4,5?-epoxy-3,14- dihydroxymorphinan-6-one)
(35) Narcotine (6,7--dimethoxy--3--(5,6,7,8--tetrahydro--4- --methoxy--6--methyl--1,3--dioxolos [4,5--g]isoquinolin --5--yl)--1(3H)--isobenzofuranone)
(36) Papaverine (1--[(3,4--dimethoxyphenyl)methyl] --6,7--dimethoxyisoquinoline)
(37) Poppy seed
--------------------
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: pics from today. out in the wild patch, a la jhonny poppyseed [Re: Mitchnast]
#4364868 - 07/03/05 01:29 AM (5 years, 2 months ago) |
|
|
hmm it doesnt include plants on the inclusive list of
'its preparations, derivatives, alkaloids and salts'
perhaps that is the loophole, it also make no mention of dried matter. which is relitively useless without futher prep.
it mentions neither on the inclusions oR exceptions.
hmmm ok.
any ideas on this?
--------------------
|
DeQuincy
Paddo hunter
Registered: 03/16/01
Posts: 68
Loc: The Netherlands
Last seen: 2 years, 7 months
|
DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4365529 - 07/03/05 06:13 AM (5 years, 2 months ago) |
|
|
Inspired by Wiccan S's article about "DUTCH COMMERCIAL POPPY CULTIVATION" me and few friends headed off to the Dutch province of Zeeland last week.
We live in the Netherlands and get around quite a bit for work. But none of us had ever seen a commercial poppy field. That said we all live in the middle and west of the country and Zeeland is in the extreme south west. About 200 km from our home town.
Anyway we booked a night in a youth hostel near the old town of Domburg. It happened to be an old castle, loved the place:
The first day we hit jackpot, not to far from our hostel we found these fields of joy. Poppies and more poppies as far as you can see:
Look, all these delicious ripening pods.
Poppies waving in the wind. Zeeland, being surrounded by the sea (zee=sea) is windy to say the least.
We left all the pods where they are, them being someone lively hood. Except a few for seeds of course.
Anyway we have positive prove that Zeeland is the (smaller)Dutch equivalent of Tasmania. I must say it felt really good to wander through such a big poppy plot. Even my wife, who isn't into opiates, was stunned by their beauty. And she recognized the sweet aroma of poppies, even before we were able to see them.
Love, DeQuincy
--------------------
there's no vestige of a beginning no prospect of an end
(hutton)
if you came to conquer, you'll be king for a day, but you too will deteriorate and quickly fade away...
you have NO CONTROL
(bad religion)
|
rocknliam
happy willowdweller
Registered: 12/12/03
Posts: 307
Last seen: 2 months, 22 days
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: DeQuincy]
#4365654 - 07/03/05 08:10 AM (5 years, 2 months ago) |
|
|
Wow you were able to get that close, that is quite amazing. Beautiful pictures.
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: rocknliam]
#4366192 - 07/03/05 01:23 PM (5 years, 2 months ago) |
|
|
umm woot
seriously.
left to dry in the feild, that would make for some fine floral arrangements.
you know they will be harvested with a combine tho.
--------------------
|
JaguarWarrior101
ShamanicAlchemist InTraining
Registered: 03/24/05
Posts: 184
Loc: State of Euphoria
Last seen: 4 years, 1 month
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#4367731 - 07/04/05 12:32 AM (5 years, 2 months ago) |
|
|
Quote:
Wiccan_Seeker said:
Wood alcohol is poison, rubbing alcohol isnt good either and potato alcohol often tastes foul.
Hence the grain alcohol. They mean high proof spirits specifically sold for human consumption.
What about rum? What does rum come from, and would it make a good choice?
--------------------
The above post is purely hypothetical, and should not be considered the true thoughts, opinions, or actions of a real life person.
We perceive. This is hard fact. But what we perceive is not a fact of the same kind, because we learn what to perceive.
~Carlos Castaneda
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
|
morphine is more soluable in cold water than any volitile you would want to try.
problem is it dries so damn slow. but at least you can always drink it
|
flowstone
blustering
Registered: 01/25/05
Posts: 6,485
Loc: precious
|
|
Rum is made from sugar cane.
--------------------
these long agonizing months without you...have been long and agonizing..
"War Doesn't Decide Who's Right... It Only Decides Who's Left."
|
Iamthewalrus
every evening Idied and everynight I wasreborn
Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 10 months
|
Re: Poppies - from Poppyseed to Opium [Re: flowstone]
#4371669 - 07/05/05 11:00 AM (5 years, 2 months ago) |
|
|
this a great fucking thread...my poppies are still growing very slow(and I lost all of the ones in the smaller containers) my guess is lack of water + unusally hot summer...I'm thinking of putting down mulched straw in the flower pot till I transplant since it will help hold moisture + keep the roots cool(and add nitrogen to the soil)
Edited by Iamthewalrus (07/05/05 11:03 AM)
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: Iamthewalrus]
#4372509 - 07/05/05 04:40 PM (5 years, 2 months ago) |
|
|
  
  
  
 
lots of pod development today, i will be releived when the showy petals stop happening. lastthing i need i some little girl picking a bouquet for her mommy.
--------------------
|
rocknliam
happy willowdweller
Registered: 12/12/03
Posts: 307
Last seen: 2 months, 22 days
|
Re: Poppies - from Poppyseed to Opium [Re: Mitchnast]
#4375019 - 07/06/05 09:59 AM (5 years, 2 months ago) |
|
|
Mitchncast, what are you doing with these, pod harvest, lancing, or just letting them enjoy their life till they die. Or should i say, what is your cat planning on doing with these?
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: rocknliam]
#4376430 - 07/06/05 06:04 PM (5 years, 2 months ago) |
|
|
i make lovely floral arrangements,
--------------------
|
Iamthewalrus
every evening Idied and everynight I wasreborn
Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 10 months
|
Re: Poppies - from Poppyseed to Opium [Re: Mitchnast]
#4377379 - 07/06/05 09:46 PM (5 years, 2 months ago) |
|
|
heres a closeup of my only surviving tassies(this is my first time growing plants this year of any kind so I'm cutting myself a lil slack) I just put shredded straw around the poppies to help hold moisture and hopefully keep the roots cooler since its been so fuckin hot this year so far(our normal summer would be perfect for poppys but this summer is hot as hell...anyways a close up of what I got so far...I'm prolly gonna try some more...correct me if I'm wrong but if you start late u will still get a harvest just smaller plants and less opium?
I'm considering also starting persian whites at a different location(I don't want cross breeding...I want to keep these strains pure and get seed)
also planning to try an indoor poppy grow in the future
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: Iamthewalrus]
#4378378 - 07/07/05 02:47 AM (5 years, 2 months ago) |
|
|
first off, poppies like the dry.
not too dry when young.
but you dont want to be watering at all in flower.
they also like cool nigts and hot days.
long days stimulate flowering. some jump right to flower, especially thoe cultivated for yeild. long growing isnt good when your buissness needs seed or opium. so general nigrum and album flower early.
about 2 weeks earlyier than ornamentals in the same conditions.
basic disturbed soil, full sun, and the right nutrients are all keys to size and potency. if thats what you're into.
but arguably whatever your purpose. large flowers and pods are best.
strains ith natutally larger pods werent nesisarily bred for opium, so if youre groing giganthemums youve got a pod whose flesh and even latex, are low in morphine and codine compaired to strains grown for that purpose.
luckily for those with monkeys, the commonly available bulk seed are strong in bananas.
ornamental varieties are mid-range.
probably cultivated for appearance from opium- harvest stocck plants in the old days.
this is merely the oppinion of my humble dancing feces.
personally i like to grow the weak giganthemums, sine i don't need the opium, i just want the flowers for my legal activities. you know, decorating the dried arrangement in my wicker basket shaped like broad topped a chair while i burn patchouli and read romance novels immagining that im fabio.
mmmm, im faaaabio. see how i eat figs and ooze machismo.
look at my pouty lips, my pouty manhood.
saying "come to me" i'm fabio.
nothing weird like consuming opium, just good legal vanity and self-delusion.
that said, hopefully none too "sarcobviously",
late plants have smaller flowers. if very late plants after the days grow short, do not flower at all, but rather grow and cabbage into massive heads, branching into bushes withought stretching into stalks.
(Conditions pending) untill the winter freeze.
supposEDLY that survive the winter frozen beneith the snow.
im gonna try it after flowering this year, so if anyone notices all the plants in my garden dissappear after they are all mature pods. im not doing opium, im just being fabio. making room for next years early start. kiss me.
also i diddn't grow weed this year. and i certainly don't mess around with those mushroom things.
guess ill just have to stick to legal highs like datura and nutmeg. mmmm, insipid fatuousness.
--------------------
|
Iamthewalrus
every evening Idied and everynight I wasreborn
Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 10 months
|
Re: Poppies - from Poppyseed to Opium [Re: Mitchnast]
#4379072 - 07/07/05 10:01 AM (5 years, 1 month ago) |
|
|
I get the feeling you think I"m growing ornamental(or maybe that wasn't directed at me) anyways these are single red tasmanian(supposedly big pods AND potent opium)...I've tried both wet and dry...and when I upped watering on these few poppies I got they started to look more healthy and grow a lil faster...I'm not saying yoru wrong tho...could be strain could be the fact that this is the early stages(you mentioned dry is best wtih flowering) anyways...I'm hoping for at least a few plants that go mature...I'll be happy with that (I'd like to spred this seed around too since I've heard the dealers have a low supply and high demand) thats why I'm growing...for the seed :P
|
liveby
Wasted For Time
Registered: 06/15/04
Posts: 1,509
Last seen: 2 months, 9 days
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: DeQuincy]
#4398965 - 07/13/05 09:05 AM (5 years, 1 month ago) |
|
|
I wet my pants , nice pictures
--------------------
http://www.bruceeisner.com/ -Creating a Sensible Culture
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: liveby]
#4403521 - 07/14/05 02:34 PM (5 years, 1 month ago) |
|
|
my garden poppies are doing great cept for SHITWADS of aphids.
evry plant has them, and they are growing and spreading like cancer.
my nigrums finished and the pods are huge for such small plants, and aphids are starting to get at pods and buds.
so evry other day ive been wetting foliage and sprinkling juvenile ladybugs that i got at the garden center into the foliage.
ive already noiced adults and larvae present, but my aphid problem requires MORE!!
some of my gigs are 4 ft tall and will be an easy 6 by the time they finish. ive got some massive cabbage stretching too. ive also got some signs of nute deficiency (new leaves forming white and twisted) but only in a few and probably due to crowding. plus we have had an overcast rainy week.
they really needsome sun.
i haven checked my wild pach in days, im hoping the pods will dry on he plants nbecaue the ones i tried to dry shriveled up.
i just hope in he meantime nobody fucks them up.
i also hope he ladybugs work.
--------------------
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4404053 - 07/14/05 04:17 PM (5 years, 1 month ago) |
|
|
  
  
and some ladybugs doing the work
some datura and morning glory
|
JaguarWarrior101
ShamanicAlchemist InTraining
Registered: 03/24/05
Posts: 184
Loc: State of Euphoria
Last seen: 4 years, 1 month
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4405556 - 07/14/05 10:24 PM (5 years, 1 month ago) |
|
|
I just found out aphids have live young, and they are actually born pregnant!
--------------------
The above post is purely hypothetical, and should not be considered the true thoughts, opinions, or actions of a real life person.
We perceive. This is hard fact. But what we perceive is not a fact of the same kind, because we learn what to perceive.
~Carlos Castaneda
Edited by JaguarWarrior101 (07/14/05 10:25 PM)
|
rocknliam
happy willowdweller
Registered: 12/12/03
Posts: 307
Last seen: 2 months, 22 days
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: JaguarWarrior101]
#4406057 - 07/15/05 12:39 AM (5 years, 1 month ago) |
|
|
JaguarWarrior101 - Hah, that is pretty crazy.
And Mitchncast - Nice beds man, very even, i can't wait till they bloom
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: rocknliam]
#4408945 - 07/15/05 08:08 PM (5 years, 1 month ago) |
|
|
they are starting o bloom now.
in other news.
heres some in the wild note how dispite their great opium potential, i do not lance them.
i wish them to dry on the plant for botanical decor.
  
Edited by Mitchnast (07/18/05 12:20 AM)
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4416307 - 07/17/05 09:39 PM (5 years, 1 month ago) |
|
|
tip for those scraping up opium resudie.
cooked opium is sticky gooey crap. if youre not careful you will lose half of it into the cleanup.
wetting your fingertip slightly will allow you to handle it withought it becomming a smeary mess, a tiny bit will disolve,
but nothing compaired to the mess caused by getting hunks smeared accross the fingertips, knives, and work surfaces.
by wetting a fingertip you can actually push the tar off the knife into the final container. no more knife-to knife nonsense.
you can always lick the film off your finger if you want a taste anyway. this meathod should produce a very bitter-sweet substance.
oh, and by the way. i saw the ice-o-lation process done. and it works very well, best way ive ever seen. you don't have to use a warm bath, you can use a pan in the oven, just keep he temp at a minimum. most ovens are in farenheight, set it to 150f and you wont destroy the secondary potentiators and still dry the product quickly, which are destroyed at about 167f or 75 c. the cold water extracion part also works well. you don't need much water, opium disolves INCREDIBLY willingly. it will even dissolve into slightly wet opium, so he saturaion point of opium into water is quite high.
a low dry heat beats a warm bath when reducing to final product. and its much faster.
use a very flat surface, if you get dry spots, just push goo over the dry patch and the dry crusty stuff will redissolve into the goo. contunue drying
if you cant get all the opium scraped up, (it is sticky and soft) re-use the same pan next time, that way it will dissolve back ino the next generation.
the final product of the ice-o-lationmeathod is straightup black tar opium. nothing putty about it.
you do get some parcipitate if you cut corners, (sugars and fats) but nothing compaired to puty techniques.
sugars and fats fall out of soluion before opium, you can use a coffee filter at near-completion to be rid of them entirely, youll be able to see them as a brownish fluffy sediment suspended in the fluid.
FOAF tried this and wanted you all to know the things above for informative reference. he also said be careful and be safe. i concurr
he likes the forum.
--------------------
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4416867 - 07/18/05 12:18 AM (5 years, 1 month ago) |
|
|
heres a pic of 16 grams of cold-cooked opium
arguably it should be substantially more potent than the heat-cooked variety.
FOAF hasnt tried it yet. i will update when he does.
he grows the same type of poppy as me.he wants to use my poppies, even offered me twice the floral value. but i told him sorry, i don't wanna get mixed up with production of a schedule 1 narcotic.
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4417006 - 07/18/05 12:52 AM (5 years, 1 month ago) |
|
|
foaf has another tip for geting all the opium back,
if you cant scrape it all up out of the pan, pour a bit of water in the pan and rub it back into solution. pour it ino a glass and voila, poppy tea. you can also wash your razor, any foil you used for drying or storing, and the opium container when its all gone. Not one little bit need be wasted. as long as you have a little water, you can always reclaim it from even the most complicated of media.
it disolves better than sugar.
so no more messing around for those of you who make mesess
the cleanup water is some potent tea. your reward for a job well done.
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4418589 - 07/18/05 12:51 PM (5 years, 1 month ago) |
|
|
  
  
  
notice how the plants in the shady part of the garden are all toppled over, direct sun is imporant.
--------------------
|
justb
Stranger
Registered: 07/19/05
Posts: 3
Last seen: 5 years, 1 month
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: liveby]
#4422532 - 07/19/05 09:35 AM (5 years, 1 month ago) |
|
|
Quote:
As last note I would like to add, that, when observing frozen bottles of iceolateonic, which lied in the freezer for too long, I see dendrites of concentrate.
Upon melting, these "veins" liquify firstly, hence giving rise to probably an easier, quicker and more reproducable procedure for iceolating.
This is a passage from Ab Strak regarding this tek. I'm wondering if any here have experimented with this tek in this regard?
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: justb]
#4423513 - 07/19/05 02:35 PM (5 years, 1 month ago) |
|
|
  
  
 
couple pics from the gartden today,
got some nice danish flags out a few peoniflorum bastard crosses. tons of garnet red poppies. and the gigs are in full swing. still waiting for my venus, and black peonys.
if i dont get them im taking pics of what came up in their place and demanding my 6.99 back
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4423519 - 07/19/05 02:39 PM (5 years, 1 month ago) |
|
|
oh yes notice the second last pic, the tiki in the background, i found washed up on the beach 2 years ago in halls harbour. it was completely covered wih seaweeds and sponges. i thought it was a log of driftwood untill i picked it up.
the neighbors joke that its why my garden grows so well.
....or why im plagued with aphids.
--------------------
|
Wiccan_Seeker
INFJcounselor-idealist
Registered: 02/06/02
Posts: 23,156
Loc: Virgo Supercluster (or b...
Last seen: 5 hours, 23 minutes
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4424634 - 07/19/05 07:31 PM (5 years, 1 month ago) |
|
|
I just got to say.. this thread is turning out so beautifully, with the TEKs and the photoshoots.. Wow.
Let's keep it coming!
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Wiccan_Seeker]
#4427939 - 07/20/05 01:21 PM (5 years, 1 month ago) |
|
|
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4428621 - 07/20/05 03:50 PM (5 years, 1 month ago) |
|
|
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4438365 - 07/22/05 04:06 PM (5 years, 1 month ago) |
|
|
floral arrangement
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4441215 - 07/23/05 03:39 AM (5 years, 1 month ago) |
|
|
friend tried the opium,
smoked, waste of product, barely threshold
however, two knifetips ingested resulted in intense waves of gushing analgesia and euphoria for hours.
certainly a strong substance, not to be taken lightly
fast acting, powerful, and to the point.
in about 15 minute he was gushing, after an hour and a half he reported he experience still intensifying.
he talked and talked about anything he was thinking about, normally hes rather quiet. tried to initiate contact with passing strangers, when normally he has a hard time breaking the ice. claimed to have little control of his mind.
sounded like fun. i cant do it tho. better half sees it as too risky.
i think i would use it for pain tho.
realistically. when do i get in any real pain?
oh well. just thought i would let you all know i know a guy who did it and he was obvously having a great time for only a small bit. probably a half gram. one max.
he said he could really see the addiction potential. compared it to 4 "T4"s
never tried those myself. so i doesn't help me get the idea but i immagine alot of folks here know what that's like.
i smoked some weed tho. i found evrything he was saying brilliantly hilarious.
he was making pictures in his mind clear as day, he said he saw a huge spacecraft moving slowly by. i mentioned things like someone through a porthole or an astronaught sparkwelding on the hull and he would see it.
o then i said "immaging a turtle, with a confused look on his face"
and bam he saw it.
by this time he forgot the game and he cut the next description short to hurry me allong to the punchline. thinking that i was building up some long-winded joke.
he was also singing some song on the radio, and slipped in ideas beween the words, the only thing he could think of tho was "im a retard" and he was grinning powefully the whole time. he also bought a slice of pizza and tore it into many small squares and left it on the bench.
alo at ome point he tried to fight, but ended up in the bushes hunched over a public steel ashtray.
then he wanted to try hitting me with a stick, i let him but expressed concern that it would look bad. so he started hitting a bench and then realized it was making alot of noise, then away we went.
later we were pretending to be aliens and i was whining on and on about the drugery of anal probes and mind wipes. and he was advocating the masters superiority. somehow this got inot a discussion about making really good virtual reality with polarized contact lenses with fiber optic imaging.
and how it could be used to change the world. like kidnap the preident tie him to a bed and force a false reality of an aliean autopsy directly into his eyes. then showing a brain transfer, and implant with boot up screen so he would think his brain was stolen and put into a puppet body..
it was alot of fun. i was having almost as much fun just hanging with him
i never thought it as a social drug before, guess for some it is.
--------------------
|
NomadicHand
Stranger
Registered: 07/23/05
Posts: 1
Last seen: 5 years, 1 month
|
|
My one surviving poppy! This was the first day he bloomed.
Bloom
A bit over 2 feet tall
Unfortunately I had to kill it. Apparently my mother is familiar with poppies.
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: justb]
#4443597 - 07/23/05 05:35 PM (5 years, 1 month ago) |
|
|
Quote:
As last note I would like to add, that, when observing frozen bottles of iceolateonic, which lied in the freezer for too long, I see dendrites of concentrate.
Upon melting, these "veins" liquify firstly, hence giving rise to probably an easier, quicker and more reproducable procedure for iceolating.
oh hmm, so one could use many containers and combine a final inensified product for low-heat reduction, producing a very thick and substantial film. wouldnt multi-stage freezing and seiving be slightly more efficient at retaining solution,
i just think perhaps over freezing would trap desired dissolved particles in pockets of ice. and therefore lose more final product
then again. you can always save the meltwater and use it for another extraction with another bunch of material.
logistically speaking you dont have to lose anything, because evrything disolves in cold water.
you just get a ladder of refinement going, and the final unobtainable ammount (bottom of the ladder when you run out of pods) could just be swallowed up in the form of tea.
hmm. too easy.
vERY too easy. this technique, if it became used in any semblence of mainstream would lead to a SERIOUS crackdown on poppy cultivation.
floral enthusiasts like me would suffer. i cannott stress enough caution. if youre making this stuff and getting addicted, YIKES, youre on a fast road to trouble
it would be so easy to support your habit and also make money pushing opium to the general drug-class.
the gold would go through their veins, like a thousand railroad trains...
god i hope nobody opens that pandoras box. this stuff started wars. can you immagine if a perfect drug like cold-extract opium became popular?
i find the idea scary, the more i find about about papaver somnniferum, the more i feel near a curse. it scares me,
its like i was burried and forgotten. and here us kids of a new generation withought the understanding of the socio-cultural impact of a easily obtained powerful narcotic, have dug up the old ways.
its too eay for a moron to do this.
i almost feel bad that were discusing it. because where creating knowlage that could and almost certainly WOULD be abused.
scary.
can you immagine people justifying their usage, and not realizing how much they need it.
*shudder*
--------------------
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4444289 - 07/23/05 09:13 PM (5 years, 1 month ago) |
|
|
if anyone here is at poppies.org and knows of any way i could join that community (on appeal or petition) i would LOVE to post there, i read it all the time
--------------------
|
DeQuincy
Paddo hunter
Registered: 03/16/01
Posts: 68
Loc: The Netherlands
Last seen: 2 years, 7 months
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4445751 - 07/24/05 04:36 AM (5 years, 1 month ago) |
|
|
Quite a few of the newest members at poppies.org, including myself although under an other sceen name, were noticed at the little brother site of the PORG: Clubopium. Either you are invited or you ask really politly at:
http://adh.2.forumer.com/index.php?s=f9c7a384798591259018739d34f41918&showforum=4
You can can join or post anonymious (sp?). If joined you can pm the mods who are also mods at the porg.
I think you make a good chance.
See you at the porg!
--------------------
there's no vestige of a beginning no prospect of an end
(hutton)
if you came to conquer, you'll be king for a day, but you too will deteriorate and quickly fade away...
you have NO CONTROL
(bad religion)
|
justb
Stranger
Registered: 07/19/05
Posts: 3
Last seen: 5 years, 1 month
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: DeQuincy]
#4446802 - 07/24/05 03:00 PM (5 years, 1 month ago) |
|
|
I certainly understand and share many of your same concerns... But this doesn't really curb my interest and I highly doubt there'll be any type of sudden surge in the commercial production of o. I think making these concerns known is the best thing one can do.
So smoking was a waste, but ingestion wasn't. Interesting... How many times did you freeze/filter? What was the consistency?
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: justb]
#4446862 - 07/24/05 03:24 PM (5 years, 1 month ago) |
|
|
foaf, man foaf.
he ice filtered it 3 times.
the consitancy at reduction was a dark brown tonic. slightly syruppy
the last reduction was in a pan in the oven at 150f
scraped up the product was a shiny black homologous semi-solid tar. quite sticky
theres a picture of it posted earlier in the thread.
the firend that tried it isnt the same person as the guy who made it BTW. the one who tried it is the second "f" in foaF
anywho, it bubbled and burned in the pipe.
friend says in retrospect after having ingested a dosage, he can see how smoking it had an effect, now that he knows what the effects are. but just smoking it it was too weak to notice.
i was surprised, seriously, he only ate two knifetip thats like, one cc altogether
--------------------
|
justb
Stranger
Registered: 07/19/05
Posts: 3
Last seen: 5 years, 1 month
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4446896 - 07/24/05 03:39 PM (5 years, 1 month ago) |
|
|
My bad, my bad... 
SWIM's gonna experiment with this tek later this week and will post results. He's gonna experiment with multiple freezing as well as complete freezing and dethawing in the fridge.
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: justb]
#4448067 - 07/24/05 09:19 PM (5 years, 1 month ago) |
|
|
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4478958 - 08/01/05 12:26 AM (5 years, 1 month ago) |
|
|
heres several varieties in pod. notice some are squat shaped like pumpkin gourds while others are round and some are tall.
  
most of my gigs are lying down, im holding a couple up here to show the size.
|
muidumees
Stranger
Registered: 08/03/05
Posts: 6
Last seen: 5 years, 16 days
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4489188 - 08/03/05 12:06 PM (5 years, 1 month ago) |
|
|
can someone determine a poppy species, if I post a picture here?
thanks.
|
Rah
Stranger
Registered: 09/07/02
Posts: 4,194
Loc: Canadas Field
Last seen: 27 days, 20 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: Mitchnast]
#4489837 - 08/03/05 02:54 PM (5 years, 1 month ago) |
|
|
Quote:
Mitchnast said:
ok let me see if i got this right, like would it work.
, you puree frozen, seedless, dry pods in ice old water,
then let sit for hours in the fridge, disolving morphine,
then you decant the liquid out, and allow the liquid to freze.
then remove ie rystals with a seive, and repeat a few times untill muh water has been sooped away.
then you put the remaining alkaloid rich liquid into a tray, and then reduce at about 70c untill all that is left is dry residue.
and bingo thats good stong-ass opium?
is that it in a nuthell, or am i missing something obvious/
Yea that seems to be it in a nutshell. I did some research after reading about this and it seems to be the best way to get a very pure poppy tea. But what I couldnt find were any "smoke" reports. I dont personaly like the whole day(or 2) getting thrown away drinking poppy tea. But a nice small smoke shure is nice on a friday afternoon. Anyone have experiance smoking "opium" that was Not gathered by cutting the pods? Either acid base extraction or the meathod meantioned?
--------------------
Reflux the Government.
Trade List!
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Rah]
#4494874 - 08/04/05 02:06 PM (5 years, 1 month ago) |
|
|
an old post from shaganoz for smokables, the naphta is useless, follow second recipe
I took 5 dried pods, grinded them up to powder
Put the powder in a pot
Added 2 cups of water
added 1/2 cup vinegar
Heatet it until it started to boil, turned down heat so it simmered for 10 minutes, stirred alot the whole time
Turned off the oven and let the solution steep for 20 minutes
Strained the solution with a strainer into a mug to get rid of plant rests (squeeze all juice out of the plant rests inside a t-short or some cloth)
Filtered the solution through a fine grade filter (something like coffe filter) to get rid of more plant materials/sludge
Added ammonia to the solution until you see a precipitate form in the clear filtered solution, add until it doesnt get cloudier anymore.
Filter through a VERY fine filter, i used one from a "Bubble Bag" set.
The crystalized alkaloids (morphine etc) will be left in the filter as a sludge, pour some clean water over it while in the filter to wash it and get rid of ammonia etc.
Then I poured some naphta over it to convert it into hcl salt (smokeable) and let it dry for a while, scraped off the stuff with a credit card and dried it a bit more before I smoked it.
After you add the ammonia you may heat the solution to boiling point and turn off heat and the alkaloid crystals will coagulate a bit and settle down on bottom. Makes it a bit easier to filter and get rid of liquid and keep the alkaloid crystal sludge.
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#4498098 - 08/05/05 02:35 AM (5 years, 1 month ago) |
|
|
seems harder and requireing of more additives than simply steeping in cold water, pressing, filtering, then re seeping mush, pressing and filtering again, adding filtrates together,
half-freezing and removing ice 3 or 4 times,
and then reducing syrup in the oven on a tray at 150f
ive now seen that meathod repeatiadly turn out a consistantly powerful black tar when FOAF did it.
the first bulk water, after filtering/combining and before freezing, is an opaque brown tonic.
best results seem to be with 3-4 parts water to 1 part pod flour. this swells up to a semi-liquid paste, about 3 and a half parts of the water can be pressed out, by logic, an additional steep will aquire 7 8ths of what was missed in the first extract. this makes for a more diluted first tonic, but the water is all removable by freezng/seiving and drying anyway.
so basically as long as you have a big enough container, dont worry about using alot of water.
freeze and seive as many times as it takes to get the liquid to fit in your pan.
if somebody has alot of spare pods to grind try this, i can gaurentee they wont regret it.
also im totally starting to frown upon usage of boiling.
all that heat is totally killing off a good chunk of the morphine. not to mention disoving fats and sugars.
foaf has used hot water (shy of boiling) instead of cold, and heat reduction instead of ice-o-lateing.
this results in a far lighter more putty-like and notably weaker product than that from the meathod above.
if people are afraid to take a chance on cold water, try it and keep the grind. If you dont think you're getting your goodies out withought the heat, you can always put heat to the grinds and try a separate extraction after you did the cold one.
it is really as simple as ive said in the top paragraph.
--------------------
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: Mitchnast]
#4498178 - 08/05/05 02:48 AM (5 years, 1 month ago) |
|
|
  
these are the giganthemums some are racketball size but most are stunted from being over crowded or in the shade. i put the ornamentals in the good spots, the gigs pretty much all toppled over.
|
stvip
Strange stranger
Registered: 03/21/05
Posts: 195
Loc: Israel
Last seen: 3 years, 7 months
|
Re: Poppies - from Poppyseed to Opium [Re: Mitchnast]
#4498742 - 08/05/05 04:36 AM (5 years, 1 month ago) |
|
|
So, as a proponent of the iceolation method and as the proprietor of an ungodly goodly amount of poppy plants, what are you going to do with all that foliage (or what do you cautiously speculate distant acquaintances might do)? I've been waiting for quite a while for someone to try salvaging leaf opium (it is opium indeed, because the alkaloid mix is the same as the latex, in contrast to roots).
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: stvip]
#4499360 - 08/05/05 12:12 PM (5 years, 1 month ago) |
|
|
i like to think the ammount is QUITE godly
cant contribute to the production of schedule 1 narcotics tho.
heads that dry well are added to floral arrangements, left over foliage and matter is compost.
in fact i just dumped out a bucketfull of poppy matter into the compost yesterday.
--------------------
|
muidumees
Stranger
Registered: 08/03/05
Posts: 6
Last seen: 5 years, 16 days
|
|
Can someone tell me if this is somf. and if it should contain any active components:
Thanks a lot. (sorry if I piced the wrong thread)
|
DeQuincy
Paddo hunter
Registered: 03/16/01
Posts: 68
Loc: The Netherlands
Last seen: 2 years, 7 months
|
|
Those are nice pics of Somniferums. So yes, they are the right kind.
As to active components, no one can tell from a photo. But i would be surprised if it is devoid of activity.
It is like the English say:
The proof of pod is in the eating...
But that would be very dangerous of cause, with all those highly addictive alkaloids. Take care.
--------------------
there's no vestige of a beginning no prospect of an end
(hutton)
if you came to conquer, you'll be king for a day, but you too will deteriorate and quickly fade away...
you have NO CONTROL
(bad religion)
|
muidumees
Stranger
Registered: 08/03/05
Posts: 6
Last seen: 5 years, 16 days
|
Re: poppy pics [Re: DeQuincy]
#4503194 - 08/06/05 06:17 AM (5 years, 1 month ago) |
|
|
ok, what is wrong then ... ? for two years I have been experiencing with them with zero effects.
last year I collected opium and smoked it - nothing. this year I was smarter, collected the pods and made tea. tried first with 5 big ones. nothing. then crushed all 20 (smaller ones) into one tea, nothing.
how is it possible that the potency is that low if this is real somniferum. I have been taking tramadol for a year but hardly my opiat tolerance is that high.
You wouldnt suprise if it is devoid of activity? Why? How to improve this situation for the next year?
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
|
you say you "crush' into tea?
did you mean to say 'grind'?
because you pretty much gotta grind them to dust.
i also find tea to be rather weak as is concentration helps.
--------------------
|
muidumees
Stranger
Registered: 08/03/05
Posts: 6
Last seen: 5 years, 16 days
|
|
yes, grind of course. tried even evaporating the water after making the tea and I was left with a spoonful of sticky stuff.
smoked it and all I got was irritated lungs.
can the growing enviroment (a normal garden) be so hostile that no morphine content is developed? how to improve it? what else to try instead of simple tea? although I am quite sure that there is no alkloid content in them and I was sure that it must have been something else than somniferum.
|
DeQuincy
Paddo hunter
Registered: 03/16/01
Posts: 68
Loc: The Netherlands
Last seen: 2 years, 7 months
|
|
Muid, this is strange.
Maybe you boiled you tea. At high temps, above 85 centigrade, morphine starts to be destroyed. A quick boil should be no problem.
You might have a Tasmanian Thebaine strain, which doesn't contain M. But these T-strains are relative rare and are only grown in Tasmania.
Do you know the origin of the seeds?
Growing conditions are important for M-production. Pods grown in the shade for example are less potent. Rain after the they have bloomed is bad.
You might want to try making a "slush poppy". That way nothing of your pods is lost.
All needed is a blender and some tasty ingredients. My neighbor uses 3 to 5 fresh pods (she has a small habit), a banana, some milk, two ice cubes and lemonade syrup.
Cut the pods open and shake out the immature seeds. Best to have no seeds in the slush. If your have a industrial type of blender, you can leave the crowns and knobs in the mix, but my neighbors isn't strong enough for this so she leaves them out.
Make to taste with some sugar and enjoy.
Success.
--------------------
there's no vestige of a beginning no prospect of an end
(hutton)
if you came to conquer, you'll be king for a day, but you too will deteriorate and quickly fade away...
you have NO CONTROL
(bad religion)
|
muidumees
Stranger
Registered: 08/03/05
Posts: 6
Last seen: 5 years, 16 days
|
Re: poppy pics [Re: DeQuincy]
#4506255 - 08/07/05 07:33 AM (5 years, 30 days ago) |
|
|
this is strange indeed. (taking into count my severe opioid craving = chronic pain syndrome) are you sure they are somniferum?
I have no idea about the origin. my parents bought the house two years ago and the poppies were just there.
I did not boil the tea at all. I put the grinded stuff (used a regular kitchin combine blender) into a cup and poured boiled water on top of it, letting it stir for 15 minutes.
I have tried everything. first collected the milky stuff, out of the pod, eating it, then making tea out of the same pods, drinking it, carfully also rinsing the blender, as it had some milky stuff stuck on the walls. drank this wash-out-water.
the growing conditions should be quite regular. there are other flowers, strawberries and different vegetables growing well in the garden. the climate conditions are similar to england.
would it make more sense to see that the environment is better or plant new seed for next year? (strange enough, my mom has accepted to do that, if I get the seeds)
Can it be me? High doses of codeine dont give me any buzz at all (240mg) while the first time I took tramadol, it was vow. and I have had an obsession with opiates ever since. I have been on tramadol for a year now, averaging 200mg daily. the only thing I can think off, is that the potency is so low that my tolerance from tramadol makes up for it.
I did get a "feeling" out of it once out of the 5 tries, when I made tea from 3 pods,(but i had had a glass of shamphange as well). it sort of made me close my eyes and find the most comfortable position on the couch, but it passed within 15 minutes.
I will, (if there are any pods left ) try eating the whole pod as well.
|
stvip
Strange stranger
Registered: 03/21/05
Posts: 195
Loc: Israel
Last seen: 3 years, 7 months
|
|
Tramadol blocks MOR (it, or metabolites, is probably an agonist-antagonist; there's a warning in the packae insert of Tramadex, a generic, against using while dependent on opioids as it can precipitate withdrawal symptoms, though I haven't encountered this piece information elsewhere). Hence the lack of effects.
I don't think it's good to post a personal question in a general thread, especially a stickied one. This is what makes the Shroomery much more of a chit-chat board than a discussion forum.
Edited by stvip (08/07/05 09:17 AM)
|
muidumees
Stranger
Registered: 08/03/05
Posts: 6
Last seen: 5 years, 16 days
|
Re: poppy pics [Re: stvip]
#4506395 - 08/07/05 10:29 AM (5 years, 30 days ago) |
|
|
>I don't think it's good to post a personal question in a general >thread, especially a stickied one. This is what makes the Shroomery >much more of a chit-chat board than a discussion forum.
Sorry, I never really read through the forum but found the thread on a google search.
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
|
heres what 54 grams of ice-o-late opium looks like
|
flowstone
blustering
Registered: 01/25/05
Posts: 6,485
Loc: precious
|
|
What do you mean " Ice-O-late"
is that the process where you freeze the liquid pod extract half way to separate the morphine salts from the other stuff and then discard the ice?
--------------------
these long agonizing months without you...have been long and agonizing..
"War Doesn't Decide Who's Right... It Only Decides Who's Left."
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
|
thats the one
--------------------
|
psilotatsic
useless
Registered: 04/21/05
Posts: 331
Loc: Here
|
|
Damn i bet thats alot of salts too 54 grams.. yummy
--------------------
"Those whoe truely get high never come back"
|
Rah
Stranger
Registered: 09/07/02
Posts: 4,194
Loc: Canadas Field
Last seen: 27 days, 20 minutes
|
|
I made that with by letting pods sit in the fridge with water for 12 hours, then filtered(Could have filtered again) Then froze the liquid twice, removing ice and throwing it away both times. Im guessing 1.5-2g of goo
--------------------
Reflux the Government.
Trade List!
|
JaguarWarrior101
ShamanicAlchemist InTraining
Registered: 03/24/05
Posts: 184
Loc: State of Euphoria
Last seen: 4 years, 1 month
|
Re: poppy pics [Re: Rah]
#4523828 - 08/11/05 10:17 PM (5 years, 26 days ago) |
|
|
How many pods is that from?
--------------------
The above post is purely hypothetical, and should not be considered the true thoughts, opinions, or actions of a real life person.
We perceive. This is hard fact. But what we perceive is not a fact of the same kind, because we learn what to perceive.
~Carlos Castaneda
|
Rah
Stranger
Registered: 09/07/02
Posts: 4,194
Loc: Canadas Field
Last seen: 27 days, 20 minutes
|
|
10 or so pods, and the roots
--------------------
Reflux the Government.
Trade List!
|
9005
Stranger
Registered: 08/11/05
Posts: 2
Loc: Southern U.S.
Last seen: 4 years, 8 months
|
 Red Rock [Re: Rah]
#4544763 - 08/17/05 01:53 AM (5 years, 21 days ago) |
|
|
Hi everyone, I gotta say this is the most informative forum I've ever visited. Thanks for all the enlightened info, kudos!!! The question that I have is this; How does one make "red rock","white rock" and "dragons blood incense"? I've searched all over this site and have found no mention of these products. Years ago a "foaf" had some red rock and said the experience was pheonominal. Are these real products or is my "foaf" "fos"(full of shit)??? 
--------------------
Gen 1:11 And God said, Let the earth bring forth grass, the herb yielding seed, [and] the fruit tree yielding fruit after his kind, whose seed [is] in itself, upon the earth: and it was so. Gen 1:12 And the earth brought forth grass, [and] herb yielding seed after his kind, and the tree yielding fruit, whose seed [was] in itself, after his kind: and God saw that [it was] good.
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG
Registered: 01/07/04
Posts: 7,751
|
Re: Red Rock [Re: 9005]
#4544892 - 08/17/05 02:16 AM (5 years, 21 days ago) |
|
|
Heh.. red rock or dragons blood incense is...
incense! it's the biggest scam in the book. Not sure why its a scam as it resembles opium in no way, but all across the country, if not world, the scam exists. and there will always be the people who swear what they're getting is real (i love the.. "you can tell it's real because it smells like flowers")
You generally won't find real opium for sale. 99% of anything sold will be this fake crap. If its real.. you or someone nearby should know the very pods it came from. Thats not to say there aren't exceptions. Just always assume, if you're offered opium, that it's fake until proven otherwise. If you know what to look for, you probably won't be proven otherwise.
--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
stvip
Strange stranger
Registered: 03/21/05
Posts: 195
Loc: Israel
Last seen: 3 years, 7 months
|
Re: poppy pics [Re: Rah]
#4545772 - 08/17/05 07:59 AM (5 years, 20 days ago) |
|
|
Quote:
10 or so pods, and the roots
Leaves contain opium. Roots contain undesirable alkaloids, with negligible amounts of morphine.
|
Rah
Stranger
Registered: 09/07/02
Posts: 4,194
Loc: Canadas Field
Last seen: 27 days, 20 minutes
|
Re: poppy pics [Re: stvip]
#4549569 - 08/18/05 01:19 AM (5 years, 20 days ago) |
|
|
You sure about that??
--------------------
Reflux the Government.
Trade List!
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: poppy pics [Re: Rah]
#4549704 - 08/18/05 01:53 AM (5 years, 20 days ago) |
|
|
i know for sure that the roots are pretty much bunk.
YES they CONTAIN morphine, but they also are exposed to water frequenly and morphine washes away faster than sugar.
--------------------
|
Rah
Stranger
Registered: 09/07/02
Posts: 4,194
Loc: Canadas Field
Last seen: 27 days, 20 minutes
|
|
Yea thats a good point, I dont even like opiots. It was just an experiment to see if it realy worked. My friend said the same as your friend, didnt like smokin it, but was amazed by the power of eating a small amount.
Why do you think smoking it didnt work well? Im guessing purity, but due to the dosage of eating it id think its preaty dam pure. A buddy of mine is doing another test batch to see what he can come up with.
--------------------
Reflux the Government.
Trade List!
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: poppy pics [Re: Rah]
#4554779 - 08/19/05 10:51 AM (5 years, 18 days ago) |
|
|
most likely because smoking it only managed to singe the outermost layer, subequently trapping the majority of the morphine inside the mass and heat-damaging much of that which burned. direct flame is damaging. vaporizing works better, but still, the mass must be extremely dry (or youre smoking water vapor) and in powdery form (or youre trapping the good stuff in the mass.
if its not dry the water vaporizes first, in the time it takes to vaporize the water, youve heat-killed the chemicals.
so theoretically you can produce a smokable O his way, but you must have it cracker dry, and you must use a hookah or vaporizer. (i sugget not using tinfoil)
--------------------
|
DeQuincy
Paddo hunter
Registered: 03/16/01
Posts: 68
Loc: The Netherlands
Last seen: 2 years, 7 months
|
|
A note on smoking poppy extracts:
Not so long ago I read a report about caffeine being mixed with opiates (heroin nr 3). The conclusion was that hardcore addicts preferred a 70/30 heroin/caffeine mix over a pure h-product. The reason for this was that the temperature at which opiates vaporises is very close to the temperature where it will decompose. Caffeine on the other hand vaporises at a much lower temp. And while it is vaporising, the heroin will, sort of, tag along. Making much more h available to the user. For the chemists: it is like a steam distillation of a non polar.
So my point: if you have some caffeine lying around (and doesn't everybody?) you might want to try a mix a little to your extract.
Just a thought...
--------------------
there's no vestige of a beginning no prospect of an end
(hutton)
if you came to conquer, you'll be king for a day, but you too will deteriorate and quickly fade away...
you have NO CONTROL
(bad religion)
|
9005
Stranger
Registered: 08/11/05
Posts: 2
Loc: Southern U.S.
Last seen: 4 years, 8 months
|
Whoa is me....but not really [Re: DeQuincy]
#4599325 - 08/30/05 04:40 PM (5 years, 7 days ago) |
|
|
Today as I looked out my window to see a cloudy sky after the remnants of hurricane Katrina passed through, I shuddered to think of my rookie crop of "Tazzies" were doing. So I jumped on the 4-wheeler to trek off to see how they were doing and my worst fears were confirmed. Two acres of tazzies were gone, along with @200 fem Durban Poisons! My first instinct was too pull my hair out or kick something, but then I thought about those poor unfortunate folks along the gulf coast who lost their lives or their homes. My heart immediately went out to them and it made my own problems seem so trivial. This is more proof that mother nature is a beautiful bitch mistress!!! Guess I'll have to wait until next year to try my first smoke of O. Having said all of that I do have one question. I have seen on Ebay that someone is selling pods, 400 for @$250. Is this a decent price and can tea/laudanum be made from these pods??? Thanks, and pm me if anyone would like to send any "O" donations to the less fortunate...lol... 
--------------------
Gen 1:11 And God said, Let the earth bring forth grass, the herb yielding seed, [and] the fruit tree yielding fruit after his kind, whose seed [is] in itself, upon the earth: and it was so. Gen 1:12 And the earth brought forth grass, [and] herb yielding seed after his kind, and the tree yielding fruit, whose seed [was] in itself, after his kind: and God saw that [it was] good.
|
Vertigo6911
Entheobotanist
Registered: 12/04/04
Posts: 1,834
Loc: Netherlands
Last seen: 3 years, 9 months
|
Re: Whoa is me....but not really [Re: 9005]
#4600684 - 08/30/05 10:10 PM (5 years, 7 days ago) |
|
|
hey just because al that incence bein sold is crap doesent mean we shouldent be able to make our won 'real opium' incence does it?
doesent any1 know a recepie?
--------------------
-Know ye not that ye are gods?-
My homepage
|
Wysefool
I AM SKELETON JELLY
Registered: 12/26/02
Posts: 6,447
Loc: BC
Last seen: 3 days, 19 minutes
|
Re: Whoa is me....but not really [Re: Vertigo6911]
#4601525 - 08/31/05 12:38 AM (5 years, 7 days ago) |
|
|
You could take some poppy leaves and roll them up into tubes and then tie them with a string and get them nice and dry. I imagine sticks of dry leaf like this would burn like incense and smell just like the real deal (because it is  )
|
campinman
Fun-Guy
Registered: 09/01/05
Posts: 398
Loc: SoOn
Last seen: 1 month, 27 days
|
Re: Whoa is me....but not really [Re: Wysefool]
#4715009 - 09/26/05 05:08 PM (4 years, 11 months ago) |
|
|
so ive got china white seeds, purple tazzies, and another type, got em at an organic seed show, anyone know which will give me the more milky pods?
the china whites or the tazzies?
--------------------
No statements made in any post or message by myself should be construed to mean that I am now, or have ever been, participating in or considering participation in any activities in violation of any local, state, or federal laws. All posts are works of fiction.
"I wish my lawn was emo, so it would cut itself."
|
Wiccan_Seeker
INFJcounselor-idealist
Registered: 02/06/02
Posts: 23,156
Loc: Virgo Supercluster (or b...
Last seen: 5 hours, 23 minutes
|
Re: Whoa is me....but not really [Re: campinman]
#4744463 - 10/02/05 08:57 AM (4 years, 10 months ago) |
|
|
I think you mean Persian White
Persian White is the historic "Opium" poppy and its claim to fame is that it can produce *very* much opium per capsule.
Tasmanians are a modern, intensively improved poppy. They are grown for seed primarily so they likely will give more and bigger pods.
If you decide to take on the huge risk and responsibility of poppies I'd say go for Tazmanians and make tea of the dried heads.
|
BobJizze
That
Registered: 08/26/04
Posts: 97
Loc: Further
Last seen: 3 years, 10 months
|
|
My first impression of dried poppy pods: Very pleasant, not exactly what I expected. Figured it would be like codeine or hydrocodone but it really has its own kinda feel. Waves of pleasantness, uplifting, social, heightened music appreciation, itchy, long lasting, VERY VERY ADDICTIVE. I noticed that I was craving it after the first time, and after a week of straight use I had to stop myself. No physical WD symptoms at all, but def mental symptoms.
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
|
My impression was very similar (60 grams split five ways). Nice laid-back feel to it. The next morning I had the most intense meditation session of my life; it was ELECTRIC and felt like I had directly plugged in to the collective-consciousness, like I was pulling in all these really great vibes and sending back out even better ones. However, both my wife and I suffered severve constipation for the next five days.
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
BobJizze
That
Registered: 08/26/04
Posts: 97
Loc: Further
Last seen: 3 years, 10 months
|
Re: woot [Re: namaste]
#4952635 - 11/18/05 07:21 PM (4 years, 9 months ago) |
|
|
Quote:
severve constipation for the next five days.
Serious, that stuff really clogs up the system, hehe
|
Tippinthru
contented
Registered: 04/07/05
Posts: 1,131
Loc: "The Garden"...
|
 Re: Poppies -- from Poppyseed to Cooked Opium [Re: BobJizze]
#4997641 - 11/30/05 10:19 AM (4 years, 9 months ago) |
|
|
Wow! great, informative, descriptive and let's not leave out the great pics of the growing stages of the poppy!
You guys have put some time in this, and it has paid off. Well done!
--------------------
Perfection is attained by slow degrees; it requires the hand of time...
[
|
Lawrence
member
Registered: 08/24/03
Posts: 321
Loc: Canada, Qc
Last seen: 10 days, 8 hours
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Tippinthru]
#5013332 - 12/04/05 12:31 PM (4 years, 8 months ago) |
|
|
nice reading thread
|
MrMolotov
Ganja Patrol
Registered: 06/12/05
Posts: 640
Loc: SoCal
Last seen: 8 months, 10 days
|
Re: Poppies - from Poppyseed to Opium [Re: MeneerCactus]
#5024571 - 12/06/05 06:57 PM (4 years, 8 months ago) |
|
|
Quote:
MeneerCactus said:
High,
On your special request here the copy and paste from topic http://www.shroomery.org/forums/showflat.php/Cat/0/Number/4319765/an/0/page/1/gonew/1#UNREAD
High All,
It is time for a new post. It is entheo garden related and I think this is the right forum to place my pictures.
Papaver Somniferum is a very easy and beautifull plant to grow. Just through the seeds in your garden in spring or fall and nature does the rest. After a few years your garden is cased with poppie seed and it will act like weed.
Many rivers to cross and a few steps to have a nice smoke.
Here we go...
All that is needed.
Yesterdays fresh harvest.
The harvest is put into some water.
The water is heated (30 minutes) "Au Bain Marie" poppie water does not boil.
I used aquariumfilter synthetic cotton (polyfill alike) to filter the O-water.
Filtered the O-water twice this way.
Placed the juice in a petries under a lamp (warm not hot).
14 hrs later it was dried and ready to scratch.
A nice result and transformation of yesterdays harvest.
And a kind of close up.
Thats all fooks, I hope you enjoyed the show!
I am curious after you have scraped the finish products into that fine of a powder I wonder would snoring it be a good way to injest it? I have a good patch sown and am still waiting for the seeds to sprout. the seeds werew store bought from a spice islands container oif poppy seeds. i Have seeds that are ment to be planted but i wanted to see how the store seeds work. any info would be helpful.
--------------------
OI OI OI
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: MrMolotov]
#5025779 - 12/06/05 10:57 PM (4 years, 8 months ago) |
|
|
dont snort that stuff.
it disolves into an intensely salty/syruppy goo, like molasses when it is exposed to moisture.
it is also extremely bitter and sickeningly sweet.
not the kind of thing you want in your nose.
when ive seen simmilar experiments that were scraped up while still "gooey" the odor comming off them is intense, triggers my gag reflex just having it open in the room.
personally i have to encapsulate the substance to imbibe/injest it withought gagging.
but it wasn't always that way. i used to be able to spoon it in or lick it off a utencil.
now i just find it too intense.
i figure if you got it down to a powder, you might as well vaporize it.
the main thing i suppose is reduce at about 150f on GLASS ONLY. as on aluminum pans its hard to scrape effectively.
make sure the pan is level so it all dries at the same rate.
if it dries in thick patches, it wont dry all the way.
and dont scrape into piles untill its COMPLETELY dry, or youll not have all the moisture out. it really seems to dry best spread out flat and thinly. if you have humps and pits it will form a crust and contain the moisture.
--------------------
|
Jaeger
Dreamer
Registered: 10/01/05
Posts: 960
|
Re: Poppies - from Poppyseed to Opium [Re: Mitchnast]
#5025829 - 12/06/05 11:07 PM (4 years, 8 months ago) |
|
|
I have read that rectally is a great way for ingestion. Second only to IV in efficiency and no bad tastes lol
|
MrMolotov
Ganja Patrol
Registered: 06/12/05
Posts: 640
Loc: SoCal
Last seen: 8 months, 10 days
|
Re: Poppies - from Poppyseed to Opium [Re: Jaeger]
#5026123 - 12/06/05 11:58 PM (4 years, 8 months ago) |
|
|
Ok thanks for the info. i am pretty excited as I am supposed to be getting 10 hits of acid for 30 bucks from a close friend tomorrow
--------------------
OI OI OI
|
jackflash
Stranger
Registered: 08/12/05
Posts: 25
Loc: new jersey
Last seen: 11 months, 6 days
|
Re: Poppies - from Poppyseed to Opium [Re: MrMolotov]
#5065609 - 12/15/05 04:09 AM (4 years, 8 months ago) |
|
|
Thank you for the great info. I would have used my usual extraction solvent in my iso 2 extracter. The photographs were worth your effort.Thanks again. Peace and happiness,jack080247 
|
Erickson
Resident
Registered: 12/30/05
Posts: 123
Last seen: 3 years, 9 months
|
Re: Poppies - from Poppyseed to Opium [Re: jackflash]
#5126069 - 12/31/05 03:20 PM (4 years, 8 months ago) |
|
|
This is a lot of information for one post and answered every quistion i could think of thinking of... I just wanted to thank Wiccan_seeker for the effort and for this article that has helped me learn so much.
--------------------
Fortune Favors The Bold.
|
Wiccan_Seeker
INFJcounselor-idealist
Registered: 02/06/02
Posts: 23,156
Loc: Virgo Supercluster (or b...
Last seen: 5 hours, 23 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: Erickson]
#5126110 - 12/31/05 03:35 PM (4 years, 8 months ago) |
|
|
Hey we're all doing it together! This community is a treasure trove of information!
|
barto
Stranger
Registered: 11/25/05
Posts: 360
Last seen: 3 years, 10 months
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#5235435 - 01/28/06 04:08 PM (4 years, 7 months ago) |
|
|
does anyone know where the link to the grown poppy heads store is. i saw it on here a while ago. did it get deleted? its a source but it was already in houe. thats why i ask
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG
Registered: 01/07/04
Posts: 7,751
|
Re: Poppies - from Poppyseed to Opium [Re: barto]
#5235498 - 01/28/06 04:33 PM (4 years, 7 months ago) |
|
|
Probably got delted, as it should have.
--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
Wiccan_Seeker
INFJcounselor-idealist
Registered: 02/06/02
Posts: 23,156
Loc: Virgo Supercluster (or b...
Last seen: 5 hours, 23 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: Koala Koolio]
#5237681 - 01/29/06 09:05 AM (4 years, 7 months ago) |
|
|
Indeed, this is not a hookup site. And why should it be? One teaspoon of spicerack seeds plus an afternoon of gardening work in the forest in spring can yield you at harvest time an easy kilo of poppyhead powder, containing 15-50gr strong opium, equalling some 250 good doses.
Or, ofcourse, you could spend $1.000 to spare you the "trouble".
Grow your own. This is the Ethnobotanical Garden so grow your own. We love poppies and their effects too.
I was digging through my papers when I found another factoid I don't know I have included yet.
If you have small to medium poppyheads the seeds to heads ratio is roughly 1.75 : 1 which means that a yield of 100gr poppyseed per square meter would imply a harvest of ~57gr poppyheads can be made if the heads are smallish. Also, in cold climates the content of strong opium (this beingh opium with 10% morphine) averages 2%.
So, to spew out another formula (I love those!)
This scenario is pretty conservative and intended for cold climates:
0.1gr seed = 60 plants = 1 sq. meter = 60gr poppyheads = 1.2gr strong opium = 10 potent doses
It needs be pointed out though that a fullblown addict would need 100gr of these poppyheads just to keep withdrawal in check.
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#5242290 - 01/30/06 04:22 PM (4 years, 7 months ago) |
|
|
250 good doses? maybe.... if you are injecting it.
--------------------
|
Wiccan_Seeker
INFJcounselor-idealist
Registered: 02/06/02
Posts: 23,156
Loc: Virgo Supercluster (or b...
Last seen: 5 hours, 23 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: Mitchnast]
#5242465 - 01/30/06 04:58 PM (4 years, 7 months ago) |
|
|
250 good doses.. for someone without a tolerance ^_^
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#5247891 - 01/31/06 07:50 PM (4 years, 7 months ago) |
|
|
No, I gaurentee after 2-3 they will have to start double dosing, by the time 10 times "dosed is gone, they are doing 5 singular doses.
Nobody has zero tolerance through 250 doses.
I would be surprised if 250 made it to 50.
by that time they are probably fucked.
--------------------
|
Wiccan_Seeker
INFJcounselor-idealist
Registered: 02/06/02
Posts: 23,156
Loc: Virgo Supercluster (or b...
Last seen: 5 hours, 23 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: Mitchnast]
#5249955 - 02/01/06 03:55 AM (4 years, 7 months ago) |
|
|
I meant initial, tolerance free doses, not something a single person could do. Four grams still works for me, but I use once every year.
It's a dangerous hobby, so tolerance should be met with prolonged intervals rather than double dosing.
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#5257902 - 02/03/06 02:22 AM (4 years, 6 months ago) |
|
|
indeed, just thought it should be mentioned. a newbie might slip down the slope thinking they have 250 doses.
which is a very liberal estimate IMO
--------------------
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG
Registered: 01/07/04
Posts: 7,751
|
Re: Poppies - from Poppyseed to Opium [Re: Mitchnast]
#5258020 - 02/03/06 02:53 AM (4 years, 6 months ago) |
|
|
So, 250 theoretical first time doses, agreed?
250 opiate newbies could be given a dose a piece.
Now... who shall compile the list?
--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Koala Koolio]
#5258440 - 02/03/06 09:40 AM (4 years, 6 months ago) |
|
|
hehe, I like the way you think
Looks like its almost planting season again here in the midwest ~ zone 5
This year I'm going completely ornamental, Hens 'n Chicks and White Cloud Peonies... last year we had rain during the bloom and it took 10-15 grams of Gigs to get a good high. Hopefully this year brings something smokable.
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
NewAgeDiciple
Follower of One
Registered: 02/23/05
Posts: 153
Last seen: 1 year, 9 months
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#5263486 - 02/04/06 07:38 PM (4 years, 6 months ago) |
|
|
Sorry, I promise I read it all..but what are Gigs?
And to make absolutely sure, if a friend wanted to cut the pods, this is well after the flower stage, correct? The initial flower is holding the pod to be cut, correct?
Thanks for any help.
--------------------
Smile, for everyone you meet is fighting a great battle -philo of Alexandria
|
Wiccan_Seeker
INFJcounselor-idealist
Registered: 02/06/02
Posts: 23,156
Loc: Virgo Supercluster (or b...
Last seen: 5 hours, 23 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: NewAgeDiciple]
#5265305 - 02/05/06 06:00 AM (4 years, 6 months ago) |
|
|
There is no escape.
You have to read the thread.
|
Burke Dennings
tron as fuck
Registered: 11/29/04
Posts: 27,603
Loc: vacaville
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#5281828 - 02/09/06 03:28 PM (4 years, 6 months ago) |
|
|
.`.
--------------------
I can break it down, like, O SHIT.
Edited by PLUR, LOL (02/28/06 11:29 AM)
|
Wiccan_Seeker
INFJcounselor-idealist
Registered: 02/06/02
Posts: 23,156
Loc: Virgo Supercluster (or b...
Last seen: 5 hours, 23 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: Burke Dennings]
#5284574 - 02/10/06 05:49 AM (4 years, 6 months ago) |
|
|
Thanks man
|
Phoshaman
L.A, L.A., BigCity of Dreams.
Registered: 06/02/99
Posts: 1,521
Loc: Downtown L.A.
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#5318383 - 02/20/06 02:18 AM (4 years, 6 months ago) |
|
|
this thread is amazing.
thank you to everybody involved.
--------------------
|
Wiccan_Seeker
INFJcounselor-idealist
Registered: 02/06/02
Posts: 23,156
Loc: Virgo Supercluster (or b...
Last seen: 5 hours, 23 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: Phoshaman]
#5327320 - 02/22/06 09:45 AM (4 years, 6 months ago) |
|
|
Quote:
this thread is amazing.
It will become even MORE amazing right now
One of our members found a *great* article at The Nook which basically is a Cut & Paste production of several gov't publications on the ins and outs of opium growing and specifically the lancing of the pods and actual harvesting. It was originally posted as a large tombstone without paragraphing so I took the liberty of rendering it readable with some hard Enters.
You definately want to read this one, it has an information density and wealth comparable to the best articles in this thread. So being a good leafcutter ant I cut the piece out of its habitat and dragged it to the nest ^_^
Enjoy!
---------------------------------------------------------------------
I noticed a lot of you guys had question about poppy cultivation. I have a friend who studies horticulture and he gave me a compilation of material taken from various issues of the United Nations Bulletin on Narcotics. I thought it was pretty good and maybe some of you might find it interesting. In no way am I encouraging you to propagate poppies where they are illegal. This information is presented only for it's botanical and scientific value.
by: Nanook
-----
Papaver Somniferum The opium poppy, Papaver somniferum, is an annual plant. From a very small round seed, it grows, flowers, and bears fruit (seed pods) only once. The entire growth cycle for most varieties of this plant takes about 120 days.
The seeds of P. somniferum can be distinguished from other species by the appearance of a fine secondary fishnet reticulation within the spaces of the coarse reticulation found all over their surface. When compared with other Papaver species, P. somniferum plants will have their leaves arranged along the stem of the plant, rather than basal leaves, and the leaves and stem will be 'glabrous' (hairless).
Opium is the name for the latex produced within the seed pods of the opium poppy, Papaver somniferum. Cultivation Prior to and during sowing apply a high phosphorus 'P' soil amendment, the use of superphosphate or other phosphate fertilizers has an extremely favorable effect on opium yield. Experience has shown that the addition of superphosphate when sowing increases the crop of opium by 15-20%.
Small amounts of additional potash 'K' are okay to add at this point. However, high nitrogen 'N' levels need be avoided until the later stages of development, otherwise yield and alkaloid content will suffer. The plant can tolerate a wide range of pH although 6.75 - 7.5 is said to be ideal. Avoid adjusting the pH with 'dolomite' since elevated magnesium 'Mg' will adversely effect alkaloid content.
In open soil, winter frosts are harmful to autumn-sown poppies, and this means that the crop must be sown in spring. However autumn sowings invariably give opium with a higher morphine content. The conclusion is that wherever the danger of the crop's freezing is small, because of the presence of snow cover or of the absence of low temperatures as a rule during the winter, it is always better to sow during the autumn.
Once poppies have survived the winter, they are unharmed by late spring frosts. Given successful wintering, autumn sowing always ensures a very high opium yield, in comparison with spring sowing. If, however, spring sowing is practiced, the earlier it is done, the better the harvest. Seeds should be sown to a depth of 1- 2cm. The poppy requires a temperature of at least 3 to 4?C in order to germinate; the optimum temperature for germination is 10 to 11?C and the germination time will take from 14 to 21 days.
The young plants prefer a temperature of 4 to 7?C. The young seedlings can not tolerate harsh rain or severe frost therefore, it may prove beneficial to lightly cover the area with straw or hay as a protective measure. In less than six weeks the young plant will grow four large leaves and resembles a small cabbage in appearance. The lobed, dentate leaves are glaucous green with a dull gray or blue tint.
After the first four leaves have developed the plants should be thinned to 20 x 20cm apart or approximately 15 plants per sq. meter. Provide supplemental nitrogen during the growth, rosette & budding stages. In general apply 2-3wks after thinning re-apply in 3-4wks then after another 3wks a double strength dose should be applied for the final application. The level of potassium is insignificant and elevated levels will result in decreased alkaloid content.
Furthermore, additional phosphorus feeding should be avoided. Despite the potential beneficial effect on vegetative growth and bud size, it decreases the overall alkaloid content. A large quantity of water is also particularly necessary from the first stages of the plant's growth until flowering begins. Water as needed (when the soil moisture content falls below 65-70 % saturation) for the first 17wks but not thereafter unless extremely arid conditions exist.
After flowering is over, a dry soil is required for the cultivation of the poppy for opium. Under these circumstances, high-quality crude opium is obtained, with a high morphine content. Within sixty days, the plant will grow from one to two feet in height, with one primary, long, smooth stem. The upper portion of this stem is without leaves and is the 'peduncle'. One or more secondary stems, called 'tillers', may grow from the main stem of the plant.
As the plant grows tall, the main stem and each tiller terminates in a flower bud. During the development of the bud, the peduncle portion of the stem elongates and forms a distinctive 'hook' which causes the bud to be turned upside down.
As the flower develops, the peduncle straightens and the buds point upward. A day or two after the buds first point upward, the two outer segments of the bud, called 'sepals,' fall away, exposing the flower petals. Fewer large capsules are easier to manage and give better yields than multiple small ones. Therefore, the plants should be pruned of excess tillers leaving only 3 to 4 capsules per plant to mature. Poppies generally flower after about ninety days of growth and continue to flower for two to three weeks.
The exposed flower blossom is at first crushed and crinkled, but the petals soon expand and become smooth in the sun. Poppy flowers have four petals. The petals may be single or double and may be white, pink, reddish purple, crimson red, or variegated. The petals last for two to four days and then drop to reveal a small, round, green fruit which continues to develop. These fruits or pods also called 'capsules' are either oblate, elongated, or globular and mature to about the size of a chicken egg.
Harvesting
The latex is harvested after the capsules have flowered and the petals have dropped from the plant. The exact time of harvest varies from 14-25 days depending on the sub-species of poppy and geographical growing region. In general the capsules are observed for physical changes to determine ripeness. Ripening capsules usually swell, darken in color, develop a colored ring at the base of the pod and are covered with light chaff. Capsules are incised only once to yield opium high in morphine content or multiple times for a larger quantity of opium with a lower morphine content.
Harvesting details from several different geographical locations: Harvesting raw opium in Southeast Asia: Traditionally, most highland and upland farmers in Southeast Asia begin scoring of the pods about two weeks after the flower petals fall from the pods. The farmer examines the pod and the tiny crown portion on the top of the pod very carefully before scoring.
The grayish-green pod will become a dark green color as it matures and it will swell in size. If the points of the pod's crown are standing straight out or are curved upward, the pod is ready to be scored. If the crown's points turn downward, the pod is not yet fully matured. Not all the plants will be ready for scoring at the same time and each pod can be tapped more than once.
A set of three or four small blades of iron, glass, or glass splinters bound tightly together on a wooden handle is used to score two or three sides of the pod in a vertical direction. If the blades cut too deep into the wall of the pod, the latex will flow too quickly and will drip to the ground. If the incisions are too shallow, the flow will be too slow and the latex will harden in the pods.
A depth of about one millimeter is desired for the incision. Using a blade-tool designed to cut to that depth, scoring ideally starts in late afternoon so the white raw opium latex can ooze out and slowly coagulate on the surface of the pod overnight. If the scoring begins too early in the afternoon, the sun will cause the opium to coagulate over the incision and block the flow. Raw opium oxidizes, darkens and thickens in the cool night air.
Early the next morning, the opium gum is scraped from the surface of the pods with a short-handled, flat, iron blade three to four inches wide. The opium yield from a single pod varies greatly, ranging from 10 to 100 milligrams of opium per pod. The average yield per pod is about 80 milligrams.
Harvesting raw opium in Bulgaria: In Bulgaria, the poppy capsules are incised only once, usually with a single-bladed knife, but in most other opium-producing countries the capsules are incised repeatedly, often four or five times on different days, until they will yield no more latex. It is worthy to note that the quantity of latex falls off rapidly with later incisions, and so does the morphine content.
The collection of the opium is done in Bulgaria by incising the poppy-heads during the period of what is known as industrial maturity. The poppy capsules themselves undergo visible changes during the days around June 26, and these changes make it possible to determine the most favorable moment for making the incision.
The poppy capsules acquire a gray color with a bronze luster, and the "sides" of the capsule become stronger, showing a very characteristic whitish-coffee-colored ring under the capsule itself. This occurs about twenty-five days after the flowering of the greater part of the plant is over, at the beginning of June in the plains of Southern Bulgaria, and at the end of that month in the more northern and higher parts of the country.
When the plant reaches industrial maturity, the poppy capsules gradually change their greenish color for one with steely-blue tints, and become covered with a light down. With light pressure the inner sides can be felt, while in the uppermost part of the spathe under the pericarp itself, a light coffee-colored ring appears.
On incision of the pericarp, when only the epidermis and the milky ducts are touched, droplets of milky juice separate out on the surface of the walls. The incision is almost invariably made with a special sharp-edged knife, which penetrates 1 to 2 mm deep. About three-quarters of the capsule is incised horizontally, and the operation stops a little below the broadest part of the capsule.
In calm weather, the droplets of milky juice form a string of beads like a pearl necklace. Strong winds, and especially rains, prevent normal collection of the opium.
The incision is usually begun after midday, and finished before sunset. Early on the following day, immediately after the dew has evaporated, a milky juice exuding from above the capsule has already collected, dried, and from being white (occasionally pink) has become coffee-colored and hard.
Making the incision during the period of industrial maturity ensures the maximum opium yield and the minimum reduction in seed yield, as compared with later incision. Making the incision either before or after industrial maturity leads to a noticeable reduction in the opium yield. Premature incision causes a 25% reduction in opium yield, while if the incision is made after industrial maturity, the yield is reduced by 12.5% if four days have elapsed, and by 50% if eight days have elapsed.
A certain increase in the quantity of opium is observed when the incision of the poppy is made during the hottest hours of the day (the optimum quantity is obtained at 2 p.m.), and a certain diminution when it is made during the earlier and later hours of the day. The quantity is lowest when the incision is made early in the day.
The time of day at which the incision is made also affects the percentage of morphine content in the opium. During the early hours of the day (8 a.m. to 10 a.m.), the opium obtained has a low percentage content in morphine, while the quantity increases during the hotter hours (noon to 4 p.m.).
Harvesting raw opium in the USSR: The gathering of opium begins during the technical ripeness period of the capsules, which sets in 16-18 days after mass flowering (July-August). Technically-ripe capsules are elastic to the touch and have a light gray-blue waxy coating. During this period the seed is in the stage of milky ripeness. Incisions are made first in the capsules on the main stem and later in those on lateral stems.
In the USSR ? unlike India ? the capsules are incised horizontally, ensuring abundant exudation of milky latex. On an average three incisions are made in every technically-ripe capsule at intervals of one or two days. Capsules are incised by day, from 12 - 1 till 5 - 6 p.m., and the milky latex which drips out of them, already in the form of congealed opium, is removed from them with scrapers on the morning of the following day from 5 to 10 a.m. Two days' delay in starting to incise technically-ripe capsules results in a loss of 7 %, and six days' delay of 30 %, of the latex. In cloudy, rainy weather the capsules are incised and the opium is collected on the same day, with an interval of 4-5 hours.
The first incision is made towards the top of the capsules on the south side; the second (somewhat lower) on the north side; and the third (still lower) again on the south side. The capsules are incised with a special three-bladed knife with limited depth of cut (figure 1). The distance between the blades of the knife should not exceed 3-4 mm. Experiments have shown that a large number of blades on the knife does not increase the exudation of milky latex or the amount of opium collected.
Position of hands & Position of incisions for incising capsule on capsule When removing the raw opium from the capsules, the collectors take care not to scrape epidermis off them as well, since that would lower the opium's commercial quality. Experience has shown that with three incisions practically the whole possible yield of opium is collected, and that to expend much labor on a fourth incision, let alone a fifth, is uneconomic.
Harvesting raw opium in Turkey: 1.The right time. Opium is collected by cutting slashes on the poppy capsules before the seeds are ripe. The latex comes out in little drops. After it coagulates this latex constitutes raw opium. The incision period varies according to climatic conditions. Normally it occurs towards the second half of June or the first fortnight of July.
In extreme conditions incision may begin as early as May (in the valleys of Aydin) or it may be deferred until the beginning of August in higher areas. A rainy, cool summer prolongs the period of growth, whereas a warm, dry summer curtails it. The right times for incising winter- and spring-grown poppies are only about a week apart.
The best time for collecting opium is about a fortnight after the petals have fallen. The upper part of the stalk then begins to darken, the capsules grow hard, and the lower leaves begin to turn yellow.
The capsules change in color from a light to a brownish green and become covered with a kind of film of moisture. In the case of some varieties of poppy, however, such as those grown in the Isparta area, the capsules do not change color but remain light green and are not covered with a film of moisture, so that it is difficult in that region to determine the right time for making the incision. Capsules that are still soft are not ripe.
The duration of the right time for harvesting depends on the climate. In hot, dry years it is from four to seven days, and in normal years from seven to ten days. After that the capsules begin to get soft again. They lose their bloom, turn yellow and finally dry up.
2. The latex. When properly incised the stalks and leaves also provide latex, but incision of the capsule draws the juice upwards. The latex is between the epicarp and the mesocarp. The juice channels go from below, upwards. In order to gather as much juice as possible a great many channels must be cut.
If incisions are made too deeply, however, the wall of the capsule will be cut right through and some of the juice will run down inside and be lost. The latex accumulated on the outside of the capsules is white and liquid, but the moisture begins to evaporate immediately and the latex becomes more and more solid and its color more and more brown.
On warm, humid, calm nights, the latex emits such a strong odor that it is quite impossible to remain near a poppy field without contracting a headache or dizziness. The peasants who live near the fields often have to remain confined in their houses, even when it is excessively hot.
3. Incision. The incision of the poppy capsule is a very delicate and expert operation. Incisions which are too deep or too shallow or which are made too early or too late give bad results. The cut must be a shallow one but it must also be deep enough to allow the drops of latex to flow down outside. Incisions made in the middle of the day when the sun is shining give bad results and there will be hardly any flow of juice.
It is therefore preferable to make the incisions either in the morning or in the evening. When the incision is made in the morning, the opium is gathered in the evening. In such cases the opium is clear-colored and its qualities are regarded as superior by drug addicts who attach great importance to clear-colored opium.
On the other hand, incisions made in the morning give a smaller yield. It is, therefore, now considered preferable in Turkey to make incisions in the evening, since color is of little importance in the case of opium intended for medical purposes. In such cases the opium is gathered the following morning.
For this purpose, it is necessary to wait until the morning dew has disappeared. If the capsules are incised in the evening, the yield will be more abundant. The latex takes from eight to fourteen hours, according to atmospheric conditions, before it solidifies and is ready for collection. In case prolonged bad weather makes it impossible to observe these conditions, the grower will take advantage of a fine interval to incise the capsules and gather the latex in its liquid form.
The incisions are usually made with knives of various shapes, but there are also special instruments which are now increasingly employed. The best known of them is the so-called "Amasya" type. It has a broad end terminating in four to six lancet points, which have the advantage of not penetrating deeply and not piercing the capsule.
The cuts made in the middle of the capsule produce most latex. In a pamphlet published and distributed free by the Turkish Soil Products Office, the following advice is given to growers with regard to the incision:
1. The capsule must never be cut all round. Spaces should be left unslashed between the extremities of the cuts in order that the capsule may continue to grow and the seeds ripen normally;
2. In order to obtain more latex, it is advisable to make several incisions (each covering a third or quarter of the capsule) at intervals of one day;
3. Incisions made on clear, sunny, calm days give the best results. In warm districts it is preferable to make the incision in the evening, and in cool districts in the morning. It should be borne in mind that rain washes away the juice and that wind makes it fall to the ground;
4. Care must be taken to incise only the ripe capsules. This is why the farmer must go to the fields every day to select them. Harvesting raw opium in Yugoslavia: The incisions are made before the capsules are quite ripe, ten to fifteen days after the flowers fall off, at the end of May or the beginning of June.
The best time for making the incisions is determined by the color and hardness of the capsules and by the appearance of a blue-brown ring at the bottom of the capsule. The period during which the capsules can be incised and the latex successfully collected does not exceed four to six days. If the right moment is missed, the capsules take on a yellowish shade and give less latex, finally yielding nothing at all.
Cutting is usually done between 11 a.m. and 5 p.m., with a horizontal incision which covers about three-quarters of the capsule. A quarter of the capsule is always left uncut, to allow a further circulation of nutritious substances at the top of the capsule. Small drops of white, milky juice then begin to flow from the incision, and exposed to the air solidify and grow darker. The incision must be neither too shallow nor too deep. If it is too shallow, the number of latex vessels affected may be too small and too little juice will drip out; if the incision is too deep, so that the capsule is entirely cut through, the latex will flow into the capsule and the whole yield will be lost.
The incisions are made with special knives or with special tools, consisting of wooden handles fitted with sharp pieces of iron (often razor blades). The size of the blade automatically regulates the depth of the incision. Tools with two or more blades are also used, to allow two or three cuts with a single motion.
As soon as the incision is made, the latex begins to drip. In order to avoid brushing against the capsules, the harvesters making incisions must walk backwards. Unlike the procedure in certain Far Eastern countries the incisions are never repeated. It has been proved that two, three or more incisions yield more opium, but each subsequent incision produces opium with a lower morphine content. In countries which used to supply the opium smoking market, manifold incisions of the capsules were profitable, since more opium could thus be obtained.
This opium is at the same time more suitable for smoking because of its lower morphine content. Yugoslav opium has an unpleasant taste and a high morphine content and has therefore never been in demand on the smokers' market nor exported for this purpose. It is intended only for the Western market, where morphine content is in demand. Accordingly, manifold incision of capsules is not profitable.
The fact that the capsules are cut only once accounts for the considerably greater output of opium per hectare in Far Eastern countries than in Yugoslavia.
Source: http://www.thenook.org/archives/3049.html
---------------------------------------------------------------------
|
InjectTruth
Wasting my Time,Waiting for theEnd
Registered: 10/05/03
Posts: 778
Loc: New Jerusalem
Last seen: 1 year, 8 months
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#5336200 - 02/24/06 11:44 PM (4 years, 6 months ago) |
|
|
Can someone explain the advantage of making pod puddy with water, as opposed to isopropyl or ethyl alcohol?
You can make iso oil with weed and its consumable, and alcohol dries faster than water, so whats the point of using the water?
--------------------
On a personal level, Freaking Out is a process whereby an
individual casts off outmoded and restricting standars of
thinking, dress, and social etiquette in order to express
CREATIVELY his relationship to his immediate environment and
the social structure as a whole.
http://www.OrganicPharming.com - Ethno Shopping Portal
|
MrMolotov
Ganja Patrol
Registered: 06/12/05
Posts: 640
Loc: SoCal
Last seen: 8 months, 10 days
|
Re: Poppies - from Poppyseed to Opium [Re: InjectTruth]
#5354064 - 03/01/06 06:16 PM (4 years, 6 months ago) |
|
|
my seeds i tossed in the pot and thought died finally sprouted!
sweet i planted a bout a 25 by 75 patch in a secluded area just before a rain storm hit yes!
--------------------
OI OI OI
|
MrMolotov
Ganja Patrol
Registered: 06/12/05
Posts: 640
Loc: SoCal
Last seen: 8 months, 10 days
|
Re: Poppies - from Poppyseed to Opium [Re: InjectTruth]
#5354104 - 03/01/06 06:26 PM (4 years, 6 months ago) |
|
|
Quote:
InjectTruth said:
Can someone explain the advantage of making pod puddy with water, as opposed to isopropyl or ethyl alcohol?
You can make iso oil with weed and its consumable, and alcohol dries faster than water, so whats the point of using the water?
ugh sorry for double post but the alks are more soluable in water if i am correct.
--------------------
OI OI OI
|
shriek
*********
Registered: 12/13/03
Posts: 3,274
|
Re: Poppies - from Poppyseed to Opium [Re: MrMolotov]
#5354114 - 03/01/06 06:28 PM (4 years, 6 months ago) |
|
|
yes that is correct, you can use water with reduced pH for even better results i belive.
|
Tinkal
Green Thumb
Registered: 06/01/05
Posts: 231
Last seen: 7 months, 29 days
|
Re: Poppies - from Poppyseed to Opium [Re: shriek]
#5355764 - 03/02/06 01:27 AM (4 years, 6 months ago) |
|
|
I am studying some other poppys.
Eschscholzia californica,
Papaver rhaeticum - Rhaetian Poppy,
Papaver lateritium - Armenian Poppy,
Papaver bracteatum - Beauty of Livermere
Meconopsis betonicifolia
Any info about these. I am interested in alkaloidal content?
|
Tinkal
Green Thumb
Registered: 06/01/05
Posts: 231
Last seen: 7 months, 29 days
|
Re: Poppies - from Poppyseed to Opium [Re: Tinkal]
#5356003 - 03/02/06 02:33 AM (4 years, 6 months ago) |
|
|
Alcaloidal content for Meconopsis spp.
1)norsanguinarine
2)O-methylflavinantine
3)6-methoxy-17-methyl-2, 3-[methylenebis (oxy)]-morphin-5-en-7-one (meconoquintupline)
4)(+)-roemerine
5)(+)-corytuberine
6)(-)-N-methylmecambridinium
7)MC 2
8)(-)-mecambrine
9)(-)-mecambridine
10)(-)-flavinantine
11)(+)-magnoflorine
12)(+)-mecambroline
13)protopine
14)allocryptopine
15)roemeroline
16)papaverrubine D and C
17)berberine
18)coptisine
19)corysamine
20)palmatine
21)(-)-amurensinine
22)MRO 1
23)MRO 2
24)cryptopine
25)rhoeadine
26)6-methoxy-2-methyl-1,2,3,4-tetrahydro-b-carboline
27)MR 1
28)magnoflorine
29)corytuberine
30)N-methylamurensininium salt
|
Wiccan_Seeker
INFJcounselor-idealist
Registered: 02/06/02
Posts: 23,156
Loc: Virgo Supercluster (or b...
Last seen: 5 hours, 23 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: Tinkal]
#5356407 - 03/02/06 07:42 AM (4 years, 6 months ago) |
|
|
Because it adds to the body of knowledge that is this thread, here's a n extract from a post I made in a thread in ODD:
------------------------------------
But ok, here goes.
Quote:
First, you will need to define what opium's character is. Or at least give me some citation in an acceptable/respectable medical or scientific journal that defines opium's "character."
The "character" of opium is a metaphor for the combined pharmacological effect of all its constituents. The character is different for smoked than for eaten opium.
Opium eaters historically drank their Opium. This means an aquatic solution of Opium, and this is a constituent of the liquid one gets when using poppyhead tea.
The alcohol in laudanum is of small volume, and since the average human liver metabolizes alcohol to the extent of about 10gr/hour, the alcohol will be mostly metabolized when the plateau of the laudanum's Opium takes hold, generally 1-2 hours into it.
Because use of Opium and laudanum is obsolete you have to dig into books, old books, to get your information. There be dragons, including talk of the humours and other obsolete medical theories. Nontheless these theories existed to explain reality, and the ability to observe was as good in the 18th century as it is now in the 21th century.
A wealth of information becomes available if you do not discard the books of old but rather separate the observations from the theories, which have since gone out of fashion.
You should also remember the bulk of human knowledge isnt available online.
So hey ho, into Old Books away we go!
The Pharmacotherapeutisch Vademecum, 11th print of 1951 (original print 1911) is a source you have no access to because it's in Dutch and lies here beside me. I hope you trust it is there and that I quote it truthfully. It is higher knowledge we both seek, scholar's honor.
This book is written by a pharmacologist and a galenic pharmacy professor and describes the Dutch pharmacopeia of its time.
Allow me to quote & translate some excerpts:
"The effects of Opium (...) are determined by the presence and concentrations in which they occur; in Opium part of the effects are dominated by a peculiar acid (Acidum Meconicum) which is contained in it." [508, entry for Opium]
Please note: Opium effects = many alkaloids + meconic acid, and not just morphine and codeine. A further expanation you see here:
"One also makes use of (..) mutually potentiating combinations. (Synergism) In this fashion morphine meconate works 25% stronger than an identical amount of morphine base, in the form of it's hydrochloride." [191, entry for Corrigentia]
Say what? The humours aside thats a pretty stiff observation. It then is important to retain that Meconic acid, but the Merck Index says:
"(Meconic Acid) Decomposes with evolution of CO2 when heated to 120'C or when boiled with water." [5605, Merck Index 10]
Oook, back to the former book for more information:
"W. Stroub found that, when Narcotine (Noscapine) is added to Morphine the narcotic effect becomes stronger than the sum of its content of Morphine and Narcotine alone, but that the influence on the respiratory center is smaller than with the corresponding amount of Morphine. These observations led to development of a double salt of Morphine and Narcotine with Meconic acid. (Narcophine) The effects of Narcotine are slower to develop but last longer." [191, entry for Corrigentia]
Well, that's pretty clear! So basically it would mean that Opium, containing large amounts of Narcotine and Meconic acid, would act STRONGER than it's corresponding amount of Morphine.
Did you note the emphasis of beneficial respiratory effects? This is especially important when you consider that respiratory depression is the #1 causde of death in opiate OD.
Time to switch from Dutch to German and get out the modern phytotherapeutic handbook called "Gift- und heilpflanzen Mitteleuropas" where this is detailed:
"Narcotine increases to a high extent (potentiates) the central-narcotic effects of Morphine on the Greater Brain. (GroBhirn, telencephalon) This potentiating synergism between Narcotin and Morphine (used in the preparation "Narcophin" which is Morphine-Narcotine Meconate) is valuable moreover because not just the amount of Morphine can be reduced, but also, because Narcotin has a respiratory stimulating effect, the respiratory depression caused by Morphine is antagonistically influenced. The effects of Codeine are also increased." [48, GUHME]
So all in all the morphine in Opium is made less toxic and its effects are potentiated by opium-components often dismissed as trivial.
Let's stick with this book for a while, shall we? Opium dreams are not rarely erotically flavored. The Opium alkaloid Papaverine is to this day used to inject into the penis to facilitate erections in case of impotence. But would it be active in any way in opium?
"In Opium the modifying synergism between Papaverin and Morphine consists of Papaverine reversing the stimulating, spasm-inducing effects of Morphine on smooth muscled organs to the degree of eliminating the spastic component altogether and fortifying the spasmolytic effects on the bowels of Morphine." [48, GUHME]
So, it's a tradeoff. Opium is less likely to cause cramping than Morphine (which can be horrendous) but it also slows digestion more. Since the oral use of Opium through papaverine effects those changes, and papaverine is a physiologically effective aphrodisiac, it definitely helps to have it around should erotic Opium dreams drift by, and perhaps, hypothetically ofcourse, the effect on the male organ promotes erotic fantasies, which would make Opium more "sexy" than morphine.
Enough German, back to Dutch!
This combined effect of the alkaloids led to creation of a lot of specific preparations:
NARCOPHINE - Morphine Narcotine Meconate
OPIALUM - combined opium alkaloids
PANTOPON - combination of all opium alkaloids
LAUDANON - combined opium alkaloids
Is it rational to do this when there are no benefits? Currently the medical profession is focussed (obsessed) with Monotherapy, meaning one medicine for one disease, which were the demise of the combination preparations. Only recently, in fighting AIDS, the medical profession has re-discovered the ways of old were not so bad as they seemed.
OK from Dutch and German back to English:
"Opium Powdered (..) Opium dried at a temperature not above 70'C" [6731, Merck Index 10]
Even now Opium should not be heated above 70'C in preparation of pharmaceutical products. Why not? Because then its nature changes.
For one, the proteins in Opium congeal and this may be detrimental to immediate alkaloid availability, turning it into a kind of "time release pill" because of polymerisation.
Back to the Dutch pharmacopeia:
"Sirupus Papaveris (poppyhead syrup) is prepared by mixing 38 parts of a ten percent steeping of poppyheads which is prepared in the cold with 64 parts of sugar to yield 100 parts of syrup." [286, Pharm.Vadem.]
Again, but now over 50 years earlier, the recommendation to NOT subject opium/poppyhead extracts to heat.
Now compare this:
"Officinal pharmaca and dosing:
Opium Titratum (9.8-10.2% Morphine) 10-50mg, maximum 150!mg thrice daily.
Morphinum HCl 5-20mg, maximum 30!mg thrice daily."
[52, GUHME]
With this:
Opium - maximum dosage 150!mg (500!mg in 24 hours)
Hydrochloras Morphini - 3-30!mg (100!mg in 24 hours)
[Pharm.Vadem.]
In both instances morphine itself is prescribed in twice the dosage as HCl compared to extent to which it occurs in Opium. This is in tune with the observation that opium is a far stronger narcotic than it's content of morphine accounts for.
-----
According to the Dutch pharmacopeia of old and contemporary german phytotherapy I was right in my statement that the character of Opium is way more complex than its content of morphine and codeine.
I've proven that Meconic acid and Narcotine, which you dismissed, indeed play a vital role and that Papaverine is involved too. It does not end there, but I do. Translating and referencing is boring.
Opium indeed is to Morphine what a fine wine is to grain alcohol. Different Opiums have differing combined effects which makes that a "vintage" opium is not just morphine content but also the combination of specific components and whether or not it has been subjected to heat.
This makes Opium a connaisseur's poison and Morphine one to merely get messed up with. Smoking a fine ganja or evapping pure Delta-1-THC, what a difference in flavor and shades of effect!
I've spent a LOT of time to make this post, a lot more than I would've spent saying the same thing without finding the books, recalling and looking up the articles and translating between three languages.
All this not to toot my own horn (because I was right after all ) but to further your knowledge and that of interested others.
So I hope you've come away with a better understanding of our mysterious companion, and that we can now finally put the suspecting, almost accusing part of our discussion to rest and reunite in our quest to learn more
Edited by Wiccan_Seeker (03/02/06 07:44 AM)
|
MrMolotov
Ganja Patrol
Registered: 06/12/05
Posts: 640
Loc: SoCal
Last seen: 8 months, 10 days
|
Re: Poppies - from Poppyseed to Opium [Re: shriek]
#5359012 - 03/02/06 09:11 PM (4 years, 6 months ago) |
|
|
Quote:
shriek said:
yes that is correct, you can use water with reduced pH for even better results i believe.
HM know any amounts of say PH down for hydroponics per gallon of water or what the PH of the water should be for better alkaloid leeching?
--------------------
OI OI OI
|
logancircle
Stranger
Registered: 03/03/06
Posts: 13
Last seen: 2 years, 2 months
|
alcohol extraction [Re: MrMolotov]
#5362597 - 03/03/06 08:50 PM (4 years, 6 months ago) |
|
|
Let's say you started an alcohol extraction today, having ground up about a hundred small dried Tasmanian poppy pods and mixed that with 190-proof grain alcohol. After a moment of being mixed in suspension, everything settles to the bottom. Is this extraction going to work if 95% of the plant matter is on the bottom of the container?
|
Wiccan_Seeker
INFJcounselor-idealist
Registered: 02/06/02
Posts: 23,156
Loc: Virgo Supercluster (or b...
Last seen: 5 hours, 23 minutes
|
|
The trick with extraction is to leave most of the inactive material behind
If you steep it in a dark closet for 3 days, then filter it, the liquid will hold most of the alkaloids. You can however re-soak the crud with more alcohol for a day, to get more alkaloids out (displacement of the more concentrated tincture) If you do this a third time you will have almost completely extracted a material.
1..Soak for 3 days in the dark
2..Filter, resoak
3..Filter, resoak
4..Filter, combine liquids
5..Welcome to the Shroomery
It is that simple
|
logancircle
Stranger
Registered: 03/03/06
Posts: 13
Last seen: 2 years, 2 months
|
|
Okay, now I'm a little confused. I read a few places that I should mix the ground pods (powder) with alcohol, steep it for 2+weeks, stirring or shaking it daily. Are you saying I should only steep it for 3 days and then filter out all the sludge, then steep that sludge with clean alcohol over and over?
|
Wiccan_Seeker
INFJcounselor-idealist
Registered: 02/06/02
Posts: 23,156
Loc: Virgo Supercluster (or b...
Last seen: 5 hours, 23 minutes
|
|
Quote:
Are you saying I should only steep it for 3 days and then filter out all the sludge, then steep that sludge with clean alcohol over and over?
yup
|
logancircle
Stranger
Registered: 03/03/06
Posts: 13
Last seen: 2 years, 2 months
|
|
Thanks for the tips! One other question: When I'm done and I have a container of laudanum, can I reduce it (a cooking term)? I don't want to have to take a whole shot of grain alcohol to get a dose--does anyone know a good way to evaporate some of the alcohol and get a more potent final mixture? Thanks again.
|
Muppet69_420
Speed feeder
Registered: 03/24/05
Posts: 2,592
Last seen: 1 year, 28 days
|
|
Im a newbie here and was wondering, without completely wasting 50 Tasmanian pods would a dose for a newbie be 2-3 dried powderized pods make into poppy tea? If so how much should I drink of the tea without drinking too much. Also being with no tolerance would 2-3 dried tasmanian pods do anything at all? Im sure they will after reading this thread through n through but how much of the liquid would I need to drink for 2-3 pods.
--------------------
Quote:
I live to learn and learn to live.
forget w/e was here b4 it was meth gibberish....    ....thats as old as my account...
On that note fart in public and grin. 
Hail Shroomery!
Edited by Muppet69_420 (04/01/06 12:59 PM)
|
Turgurlas
RambledDispuzzlement
Registered: 03/30/06
Posts: 37
Loc: The M Town
Last seen: 1 year, 1 month
|
|
I never thought I would see Such Info like I have here.
I have learned so much already, and yet have more to learn.
Already sent an order for some seeds, Hope they turn out well
for this newbie.
--------------------
It's Not Whatcha Think...
Maybe It Is...
Whatever You think It Is...
It's Not What I Mean.
 
|
barto
Stranger
Registered: 11/25/05
Posts: 360
Last seen: 3 years, 10 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Turgurlas]
#5474284 - 04/03/06 01:46 PM (4 years, 5 months ago) |
|
|
how tall does the average poppy grow?
|
Dreamer987
The VerbalHerman Munster
Registered: 04/15/03
Posts: 5,326
Loc: Texas
Last seen: 2 years, 8 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: barto]
#5475193 - 04/03/06 05:47 PM (4 years, 5 months ago) |
|
|
To the clouds baby 
--------------------
|
mushpuppet
puppet
Registered: 01/21/06
Posts: 54
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#5475844 - 04/03/06 08:09 PM (4 years, 5 months ago) |
|
|
I have heard that poppy seeds need to be frozen before they will germinate, has anyone ever heard this?
|
mushpuppet
puppet
Registered: 01/21/06
Posts: 54
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: mushpuppet]
#5475859 - 04/03/06 08:14 PM (4 years, 5 months ago) |
|
|
There is a hillside near my house that had beautiful large trees. I used to love walking up there, but last year they began logging it. I was so disappointed, but after reading this thread, I saw the perfect opportunity to plant some poppies. The logging process has produced large full sun, loose dirt areas. A few days I ago sprinkled about 1/2 once of Turkish giants, and 1/2 once of Colossals up there.
We will see how it goes.
|
barto
Stranger
Registered: 11/25/05
Posts: 360
Last seen: 3 years, 10 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: mushpuppet]
#5475924 - 04/03/06 08:29 PM (4 years, 5 months ago) |
|
|
do they grow over 2 feet? just wondering. and will using special liquid fertilizer help spike poppies growth that are spaced together close? what fertilizers are good to use?
|
Wiccan_Seeker
INFJcounselor-idealist
Registered: 02/06/02
Posts: 23,156
Loc: Virgo Supercluster (or b...
Last seen: 5 hours, 23 minutes
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: barto]
#5476279 - 04/03/06 09:43 PM (4 years, 5 months ago) |
|
|
The answers you seek are in the first posts of this thread 
|
barto
Stranger
Registered: 11/25/05
Posts: 360
Last seen: 3 years, 10 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#5476585 - 04/03/06 10:49 PM (4 years, 5 months ago) |
|
|
another question i have that wasnt covered in the write-up: do poppies stand straight up during growth or do they flop over at any time?
|
MrMolotov
Ganja Patrol
Registered: 06/12/05
Posts: 640
Loc: SoCal
Last seen: 8 months, 10 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: barto]
#5487897 - 04/06/06 11:02 PM (4 years, 4 months ago) |
|
|
mm i dont feel like gettin my cam out to take some shots but i just had 3 screenfulls of opium from my bong and on my god it is awesome.
mm pure bliss
--------------------
OI OI OI
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: barto]
#5489362 - 04/07/06 11:44 AM (4 years, 4 months ago) |
|
|
Quote:
another question i have that wasnt covered in the write-up: do poppies stand straight up during growth or do they flop over at any time?
Falling over means they're not getting enough light. If you're growing indoors and it happens shortly after planting it's a lost cause. Outdoors, while flowering you should be fine.
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
barto
Stranger
Registered: 11/25/05
Posts: 360
Last seen: 3 years, 10 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: namaste]
#5490319 - 04/07/06 04:54 PM (4 years, 4 months ago) |
|
|
quick question. just acquired some Papaver Somniferum Giganteum
seeds. is there a big difference between these and regular?
|
MxIndustry
Sheep
Registered: 01/24/05
Posts: 234
Loc: GTA
Last seen: 1 year, 2 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: barto]
#5490342 - 04/07/06 05:01 PM (4 years, 4 months ago) |
|
|
Giganteum is supposed to produces larger pods. And it is normal for the head of the plant to bend over but they should straighten themselves out. Nothing to worry about if the heads seem to "droop" down.
|
barto
Stranger
Registered: 11/25/05
Posts: 360
Last seen: 3 years, 10 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: MxIndustry]
#5501456 - 04/10/06 11:12 PM (4 years, 4 months ago) |
|
|
should poppies be misted every day? the tutorial was kinda vague on watering and i cant be bothered to register to another board.
|
MxIndustry
Sheep
Registered: 01/24/05
Posts: 234
Loc: GTA
Last seen: 1 year, 2 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: barto]
#5503649 - 04/11/06 03:49 PM (4 years, 4 months ago) |
|
|
No, they grow in the middle east where drought in not rare. Mist them while they're seedlings.
|
Turgurlas
RambledDispuzzlement
Registered: 03/30/06
Posts: 37
Loc: The M Town
Last seen: 1 year, 1 month
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: MxIndustry]
#5507685 - 04/12/06 01:24 PM (4 years, 4 months ago) |
|
|
In the garden FAQ it says to put seeds in the "crisper dish"
I'm assuming "fridge" to break the dormancy cycle. I have them in
some plastic bagies, but was wondering if I should close em, or leave them open?
--------------------
It's Not Whatcha Think...
Maybe It Is...
Whatever You think It Is...
It's Not What I Mean.
|
C-Dizzle
Stranger
Registered: 01/06/06
Posts: 682
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#5520969 - 04/16/06 03:08 PM (4 years, 4 months ago) |
|
|
what your growing doesnt look liek ym persian blues at all it looks more like opium lettuce, but its okay i guess, well right now its been weeks and still all i have is seedlings comming out with a 2nd set and i dont understand whats taking it so long, is this normal or not? if you could id liek you to mail me and reply and also reply in the forum thatd be awesome great thanks
|
MrMolotov
Ganja Patrol
Registered: 06/12/05
Posts: 640
Loc: SoCal
Last seen: 8 months, 10 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: C-Dizzle]
#5618620 - 05/11/06 09:12 PM (4 years, 3 months ago) |
|
|
Well one of my pots is showing flower capsuels already and their just starting to straightenup flowers soon will get pics when they go.
theres two of my crop used foxfarm veg ferts snd flora nova flowering ferts whuich i am using as we speak.
--------------------
OI OI OI
Edited by MrMolotov (05/15/06 10:34 PM)
|
corporateart
Sneaky Stranger
Registered: 05/08/06
Posts: 23
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: namaste]
#5722813 - 06/07/06 03:08 PM (4 years, 2 months ago) |
|
|
Quote:
namaste said:
Quote:
another question i have that wasnt covered in the write-up: do poppies stand straight up during growth or do they flop over at any time?
Falling over means they're not getting enough light. If you're growing indoors and it happens shortly after planting it's a lost cause. Outdoors, while flowering you should be fine.
poppies typically 'fall over' but then after they start growing a stronger root system they easily correct for that. but, like he said, if it happens when you are growing inside, it is a lost cause, probably fungus, esp if you are using those peat pots (DONT USE THEM, they hold water too well and encourage the fungus that knocks them over). having a small fan blow gently against them (when growing inside) can help them by giving the stems something to fight against which strengthens them
|
pac_man
~
Registered: 05/01/06
Posts: 200
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: corporateart]
#5722935 - 06/07/06 03:58 PM (4 years, 2 months ago) |
|
|
.
Edited by pac_man (06/17/06 11:28 AM)
|
MrMolotov
Ganja Patrol
Registered: 06/12/05
Posts: 640
Loc: SoCal
Last seen: 8 months, 10 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: pac_man]
#5724580 - 06/07/06 11:20 PM (4 years, 2 months ago) |
|
|
well my poppies are almost completely done growing
basically its down to beginning to dry after their mature. I'm pissed off because i managed to drop half of my fucking opium harvest down inside the heater.. son of a bitch.... i still have my pods for making ICE-O-Lated opium.
--------------------
OI OI OI
|
extrajordanary
Stranger
Registered: 06/18/06
Posts: 63
Last seen: 2 days, 13 hours
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: MrMolotov]
#5762912 - 06/18/06 03:39 AM (4 years, 2 months ago) |
|
|
Here are some pictures from my current garden in the northwest....
|
extrajordanary
Stranger
Registered: 06/18/06
Posts: 63
Last seen: 2 days, 13 hours
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: extrajordanary]
#5762969 - 06/18/06 03:55 AM (4 years, 2 months ago) |
|
|
oops....here are the pics....
|
extrajordanary
Stranger
Registered: 06/18/06
Posts: 63
Last seen: 2 days, 13 hours
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: extrajordanary]
#5763249 - 06/18/06 06:16 AM (4 years, 2 months ago) |
|
|
Here are some more pictures of my garden. I have poppies growing in 4 different areas. Gigs, Danish Flags, Persian Blue, Hungarian Blue, Hens & Chicks, Black Clouds, & White Clouds. Some have just started blooming, while others (planted later) are a little behind but are showing signs of blooming soon. The pics in my previous post are the most mature of my plants right now. Some with pods are already maturing. Here are some earlier shots....
Here is my upper flower bed at about 5 weeks :
And again a couple weeks later :
Here is a Danish Flag at about 5 weeks :
And then againa couple weeks later :
Here are some Black Cloud Peony Poppies that I bought at my local grocer (Thriftway) when they were about 8" tall. The tag said "Papaver Somniferum". I couldn't beleive my eyes. I bouth all they had. When I asked when they'd be getting more, they made something up like "they're out of season". I think they later realized that they were selling illegal opium poppies. I live near the border of Canada (Seattle area). Maybe that's how they slipped through. Has anyone ever bought Somniferums from a local grocery store nursury before. And NO, I'm not talking seeds, I'm talking actuall plant starts. Anyways, here's a pic of them a few weeks in :
And then again alittle later :
And now in full bloom :
I bought these Danish Flag and White Clouds when they were 8" starts at another local nursury here in Washington State :
Here they are ready to bloom at about 4' tall :
They now stand a soaring 5 and a half feet tall in full bloom :
See above post for a close-up of one of the Danish Flags. And yes, I bought these at my local nursury here in the USA. Anyone ever been able to do that?
|
MrMolotov
Ganja Patrol
Registered: 06/12/05
Posts: 640
Loc: SoCal
Last seen: 8 months, 10 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: extrajordanary]
#5770822 - 06/20/06 02:28 AM (4 years, 2 months ago) |
|
|
lovely just lovely
--------------------
OI OI OI
|
kranked
it'smushtastic!!
Registered: 08/31/04
Posts: 106
Last seen: 3 years, 16 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: MrMolotov]
#5820886 - 07/04/06 07:55 PM (4 years, 2 months ago) |
|
|
I've been looking for info like this for forever. Awesome thread!
--------------------
"When it went off in New Mexico, that first atomic bomb, we thought of Alfred Nobel and his hope, his vain hope, that dynamite would put an end to all war"
-Robert Oppenheimer 1945
|
xk3m_indica
Seafarer
Registered: 08/17/05
Posts: 9,828
Loc: Big Blue
|
Re: Poppies - from Poppyseed to Opium [Re: kranked]
#5885642 - 07/21/06 10:17 PM (4 years, 1 month ago) |
|
|
i live in tasmania and was wondering when the best time to score the pods would be. we have thousands of hactares of poppies all around and I live 2 mins up the road from a paddock full of poppies so I have easy access. was also wondering when to get seeds from them?
--------------------
RIP
Dr. Albert Hofmann
|
geko127
Demolition Man
Registered: 11/05/01
Posts: 346
Loc: Wonderland
Last seen: 1 year, 3 months
|
Re: Poppies - from Poppyseed to Opium [Re: xk3m_indica]
#5896857 - 07/25/06 03:45 AM (4 years, 1 month ago) |
|
|
get the pods ffs, And then dry them and there will be seeds inside.
--------------------
LIFE IS A BITCH, AND THEN YOU MARRY ONE.
BUT SUCH IS LIFE !
|
Wiccan_Seeker
INFJcounselor-idealist
Registered: 02/06/02
Posts: 23,156
Loc: Virgo Supercluster (or b...
Last seen: 5 hours, 23 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#5904531 - 07/27/06 09:19 AM (4 years, 1 month ago) |
|
|
The threadstarting post now has a PDF attached with the whole thread until now, for your offline reading pleasure!
|
Wiccan_Seeker
INFJcounselor-idealist
Registered: 02/06/02
Posts: 23,156
Loc: Virgo Supercluster (or b...
Last seen: 5 hours, 23 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#5943644 - 08/08/06 12:39 PM (4 years, 29 days ago) |
|
|
This thread is NOT about discussing anything beyond Opium, but since some people are curious as to what happens next in the illicit opiates trade, here's a pictorial, and let the last word be said about this.
|
Konnrade
↑↑↓↓<--><-->BA
Registered: 09/13/05
Posts: 13,820
Loc: LA Suburbs
Last seen: 27 days, 6 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#6113170 - 09/28/06 11:06 PM (3 years, 11 months ago) |
|
|
I've had a lot of trouble germinating poppies. they either take a long time (around a month) to sprout, or never do at all.
I'll be doing some experimenting on my own (such as putting well-watered peat pots that have been sown with seeds into the fridge), but can anyone post a good list of the conditions needed to germinate the seeds?
I've tried looking in this thread... but honestly, it's so massive that searching it is pretty intimidating.
If what I request has allready been posted, perhaps someone can link the post number? 
--------------------
I find your lack of faith disturbing
|
shroom_me
Stranger
Registered: 10/06/06
Posts: 506
Loc: Usa
Last seen: 1 year, 4 months
|
Re: Poppies - from Poppyseed to Opium [Re: Konnrade]
#6148242 - 10/08/06 11:51 PM (3 years, 10 months ago) |
|
|
Hi, I have heard that you can just buy the poppy seeds and make a tea from those to feel some effects. Is this true(everything I've read says yes) I read that poppy seeds DO have trace amounts of morphine and codeine so you'd only need to take like a gram of seeds or more in tea for a high. This would be better than growing due to illegality I would think. Any links or info??
|
Psilocybeingzz
Square'r of Circles...
Registered: 12/15/02
Posts: 14,403
Loc: International waters
Last seen: 1 month, 10 days
|
Re: Poppies - from Poppyseed to Opium [Re: Konnrade]
#6151713 - 10/09/06 10:33 PM (3 years, 10 months ago) |
|
|
Peat pots work great, poppies dont mind the acidic medium, they do just fine.
Start em in peat pots, and then transfer, thats what I do.
Edited by Psilocybeingzz (10/09/06 10:34 PM)
|
shroom_me
Stranger
Registered: 10/06/06
Posts: 506
Loc: Usa
Last seen: 1 year, 4 months
|
Re: Poppies - from Poppyseed to Opium [Re: Psilocybeingzz]
#6152944 - 10/10/06 04:23 AM (3 years, 10 months ago) |
|
|
please explain i am a newbie. what are peat pods please give more detailed description
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: shroom_me]
#6153213 - 10/10/06 08:48 AM (3 years, 10 months ago) |
|
|
Quote:
shroom_me said: please explain i am a newbie. what are peat pods please give more detailed description
Peat pots are empty containers used for starting plants from seed, the response was intended for the person above you, as you can notice by the [Reply to] feature.
As for your question, no. Poppy seeds are an unrealistic means of obtaining an opiate for consumption. The seeds may contain trace amounts of actives coating them, but they in themselves do not contain opium. I understand this is why eating a Poppy seed muffin will give a false/positive on a drug test. I've heard estimates that around 450gm seeds brewed as a tea may give effects, others may debate this but the important thing is that the seeds also contain heavy metals and should not be consumed in large quantities if at all.
Oh yeah, it's potentially deadly too: http://poppyseedtea.com/
I hope that wasn't too offensive of an explanation
Happy Growing!
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
Edited by namaste (02/08/07 03:28 AM)
|
shroom_me
Stranger
Registered: 10/06/06
Posts: 506
Loc: Usa
Last seen: 1 year, 4 months
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#6154826 - 10/10/06 05:48 PM (3 years, 10 months ago) |
|
|
Oh i fell stupid now sorry.. yeah I keep hearing that seeds have alot of cadium in them. guess Ill just cultivate eventually..
|
Peteahsaurus
Stranger
Registered: 11/25/03
Posts: 10
Last seen: 3 months, 25 days
|
Re: Poppies - from Poppyseed to Opium [Re: shroom_me]
#6234859 - 11/01/06 02:10 PM (3 years, 9 months ago) |
|
|
I live in the U.S. and i want a good source for poppy seads so i can make tea. is their a website or something for cheap seeds to purchase in large quantities. Is lemon juice necessary?I want enough seeds to give me about ten doses of fairly strong tea. how many seeds to i need to use per cup?
Advice is greatly appreciated
thankyou
--------------------
A wise man once said...
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Peteahsaurus]
#6235198 - 11/01/06 03:57 PM (3 years, 9 months ago) |
|
|
Mmmmmm, cadmium 
http://poppyseedtea.com/
Q: I read all of these stories about people obtaining opiate-like highs from some sort of preparation of poppy seeds. Is such a thing really possible? I knew about the false positive the seeds can give on drug tests, but are they actually psychoactive?
A: Yes, many poppy seeds that are sold in grocery stores are the seeds of P. somniferum, the opium poppy. These seeds contain small quantities of psychoactive opiates, primarily morphine. Some people make tea out of relatively large quantities of poppy seeds in order to get the effects of the morphine. Following are details about a poppy seed tea related death which provide more information about the quantities of opiates present in poppy seeds and the related potential dangers associated with the ingestion of such tea.
In November 2005, we were contacted by a woman who reported that her son died in 2003 after consuming poppy seed tea. She and her family created a web site (poppyseedtea.com or Erowid cache) with details about the death including the coroner's report, which identified the amount of morphine found in her son's blood and urine during autopsy, as well as lab analysis results of a similar batch of poppy seed tea. The coroner's report found 210 ng/mL morphine in her son's blood and 1880 ng/mL in urine.
In this case, the seeds were purchased in bulk at a natural foods grocery store. Between 2.5 and 3 pounds of seeds were soaked in warm water with the juice of three lemons, for an hour. It was then mixed with honey to make it drinkable. Two liters of tea were consumed, leading to death (we don't know how much total water was used with the 2.5-3 lbs of seeds).
Following his death, a similar batch of tea was made, following the same recipe. This batch was submitted for testing by the coroner. Lab testing results found that this tea contained 259 ug/ml morphine. Codeine and hydrocodone were also detected. According to these numbers, assuming the tea he ingested had the same morphine concentration as the tested batch, the 2 liters he consumed would have contained around 519 mg of morphine. This is a very high dose. Pharmaceutical morphine (hydrochloride salt) comes in tablets ranging from 10 to 60 mg.
The autopsy also found therapeutic levels (those associated with the ingestion of normal therapeutic doses) of a number of other chemicals including: desmethylsertraline, diphenhydramine, and alprazolam...as well as low levels of bupropion and delta-9-carboxy-THC. While none of these appear to be significantly related to his death, it can't be ruled out that they could have contributed in some way to it.
http://www.erowid.org/ask/ask.cgi?ID=3107
Edited by namaste (02/08/07 03:27 AM)
|
mushroomcult
Stranger
Registered: 09/15/06
Posts: 120
Loc: nsw
Last seen: 2 years, 6 months
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#6252199 - 11/06/06 02:57 AM (3 years, 9 months ago) |
|
|
so thoes little black u get on bread u can grow an opium poppy from them
Edited by mushroomcult (11/06/06 03:10 AM)
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: mushroomcult]
#6252352 - 11/06/06 04:37 AM (3 years, 9 months ago) |
|
|
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
shane
Stranger
Registered: 01/09/06
Posts: 297
Last seen: 17 days, 3 hours
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#6267459 - 11/10/06 12:49 AM (3 years, 9 months ago) |
|
|
im about to plant a bunch of seeds in my backyard. the soil is clay and very hard, so im either gonna make a sort of raised bed, or im going to cover the ground with a layer of new soil. im gonna buy some bagged soil from the nursery. are there specific things that would be good to add to it or that i should look for when im buying the soil?
--------------------
Statements concerning my personal actions and habits, and life in general are not to be taken seriously
go to familyradio.com
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: shane]
#6267534 - 11/10/06 01:44 AM (3 years, 9 months ago) |
|
|
Peat moss and manure incorporated into the ground every year will turn your clay to soil eventually. I'd suggest that over the beds as they have deep tap roots and like it loamy. I'd add some lime as well after doing a soil pH test. I do a high phos nute for cabbage production and high nitrogen for flowering, superthrive is good too. Chicken wire a few inches under the ground deters moles. It's heartbreaking but you'll need to thin the plants to 12" apart.
Make sure they're getting full-sun.
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
shane
Stranger
Registered: 01/09/06
Posts: 297
Last seen: 17 days, 3 hours
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#6267658 - 11/10/06 03:06 AM (3 years, 9 months ago) |
|
|
thanks. so the roots wont go deeper than a few inches? also, i dont know if people know this or not, but everyone says you should germinate your poppies in the fridge for a week. ive found that if you just soak them in a half inch of water, theyll germinate within two days.
--------------------
Statements concerning my personal actions and habits, and life in general are not to be taken seriously
go to familyradio.com
Edited by shane (11/10/06 03:17 AM)
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: shane]
#6267735 - 11/10/06 04:23 AM (3 years, 9 months ago) |
|
|
No, they have very long roots. I just broadcast out a few handfulls mixed with sand, then sprinkle cayenne pepper, blood meal and pee on them to distract birds, ants, rabbits, etc.
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
Konnrade
↑↑↓↓<--><-->BA
Registered: 09/13/05
Posts: 13,820
Loc: LA Suburbs
Last seen: 27 days, 6 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Konnrade]
#6267973 - 11/10/06 08:04 AM (3 years, 9 months ago) |
|
|
yeesh... of everything I've planted, I can't get anything to germinate.
I'm beginning to think that either I'm germinating them wrong, or my seeds are dead
--------------------
I find your lack of faith disturbing
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Konnrade]
#6268082 - 11/10/06 09:11 AM (3 years, 9 months ago) |
|
|
I was going to ask how yours have been doing, are they the same seeds you were using for outdoors earlier?
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
Konnrade
↑↑↓↓<--><-->BA
Registered: 09/13/05
Posts: 13,820
Loc: LA Suburbs
Last seen: 27 days, 6 hours
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#6268126 - 11/10/06 09:43 AM (3 years, 9 months ago) |
|
|
my successfull outdoor grow was from a different bunch of seeds.
I sowed some in a pot outside and kept it moist... but the seedlings don't look like poppies.
They start off looking like poppies, with two long tendril-like leaves... but then they develop spade-shaped leaves that definitely don't resemble a poppy. The seeds in that pot were persian blue.
The peat pots never did germinate.
I think I'll cook the soil to sterilize everything and then sow more seeds in them... this time I'll use more seeds per pot. Something has got to germinate. There have to be a few good seeds.
Here in california, the weather is cool. Nights are in the 50's (fahrenheit), yet there's enough sun available for growth. I keep the soil moist, but not drenched... as far as I know, that's the best I can do to stimulate germination.
--------------------
I find your lack of faith disturbing
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Konnrade]
#6268576 - 11/10/06 12:50 PM (3 years, 9 months ago) |
|
|
Even with less than ideal growing conditions, (warmer, less sun) they should still sprout. I haven't heard much of non-viable seeds, but I definately suggest a different source, most have germination rates close to 100%. At least where I am I've only got one chance a year to do it right.
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
Konnrade
↑↑↓↓<--><-->BA
Registered: 09/13/05
Posts: 13,820
Loc: LA Suburbs
Last seen: 27 days, 6 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Konnrade]
#6268619 - 11/10/06 01:12 PM (3 years, 9 months ago) |
|
|
actually, now that I picked through the sprouts, I noticed that the spade-leafed ones weren't all that was growing. Those were just weeds, there do seem to be some familiar seedlings sprouting as well. Oblong leaves are visible, with some hints of serrated edges.
Looks like I'll have at least one or two nice sized persian blues this season.
It's a shame it's a wide, squatty pot, though... not much vertical room for taproots to grow.
--------------------
I find your lack of faith disturbing
|
shane
Stranger
Registered: 01/09/06
Posts: 297
Last seen: 17 days, 3 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Konnrade]
#6269437 - 11/10/06 05:58 PM (3 years, 9 months ago) |
|
|
a friend of mine sent me that photo. do they look weak or is that what normal sprouts looks like? this person said they were about a month old.
--------------------
Statements concerning my personal actions and habits, and life in general are not to be taken seriously
go to familyradio.com
Edited by shane (12/05/06 09:03 PM)
|
shane
Stranger
Registered: 01/09/06
Posts: 297
Last seen: 17 days, 3 hours
|
Re: Poppies - from Poppyseed to Opium [Re: shane]
#6304759 - 11/21/06 03:00 AM (3 years, 9 months ago) |
|
|
i found seeds at OSH called "hungarian breadseed poppies". it even had a drawing of a dried pod on the front, which is what caught my attention. its funny to see such a taboo like that. anyway, a friend wants to sow a big tub filled with soil, because theres a lower risk of weed invasion and neighborhood cats trampling the sprouts. should the soil be pasteurized?
--------------------
Statements concerning my personal actions and habits, and life in general are not to be taken seriously
go to familyradio.com
|
Psilocybeingzz
Square'r of Circles...
Registered: 12/15/02
Posts: 14,403
Loc: International waters
Last seen: 1 month, 10 days
|
Re: Poppies - from Poppyseed to Opium [Re: shane]
#6304784 - 11/21/06 03:10 AM (3 years, 9 months ago) |
|
|
No, but thin those sprouts out quick
--------------------
  
Religion ends and philosophy begins, just as alchemy ends and chemistry begins and astrology ends, and astronomy begins.- Hitchens
|
shane
Stranger
Registered: 01/09/06
Posts: 297
Last seen: 17 days, 3 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Psilocybeingzz]
#6306616 - 11/28/06 02:34 AM (3 years, 9 months ago) |
|
|
i have an update on my strategy for germinating seeds. i tried germinating with just water in a shallow sauce-type bowl, and the seeds didnt sprout (at least not yet). then i added a little bit of peat from a leftover peat pellet, and they were sprouting by the next morning. also, its kinda cold at night here; it gets down to about 60, so you might try putting your dish in the fridge if its warmer, but every time ive tried so far, theyve started sprouting in less than 3 days. then you can just toss em into your garden or pots. a highly uneducated theory: i think that the water soaks up the nutes and the seeds in turn soak up the nute-filled water, so it all penetrates faster than if they are lightly watered.
--------------------
Statements concerning my personal actions and habits, and life in general are not to be taken seriously
go to familyradio.com
|
Konnrade
↑↑↓↓<--><-->BA
Registered: 09/13/05
Posts: 13,820
Loc: LA Suburbs
Last seen: 27 days, 6 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Konnrade]
#6306717 - 11/28/06 03:43 AM (3 years, 9 months ago) |
|
|
I had a brugmansia cutting in some moist soil in a pot that I previously had a tazzie in...
the brug starts to rot... but I notice there's a dozen poppy sprouts growing around it, so I rip out the brug and let the poppies do their thing.
And here I was thinking I won't have any poppies 
--------------------
I find your lack of faith disturbing
|
shane
Stranger
Registered: 01/09/06
Posts: 297
Last seen: 17 days, 3 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Konnrade]
#6335159 - 12/05/06 03:29 AM (3 years, 8 months ago) |
|
|
two more questions from me. is the ice-o-late method not suggested anymore for reducing the tea? ive heard something about the frozen waste containing half the alkaloids, so your wasting half the product. and my second question. how can the cultivation of P. Somn be illegal and yet there are two varieties of seeds im seeing on seedracks at the nursery?
--------------------
Statements concerning my personal actions and habits, and life in general are not to be taken seriously
go to familyradio.com
|
Konnrade
↑↑↓↓<--><-->BA
Registered: 09/13/05
Posts: 13,820
Loc: LA Suburbs
Last seen: 27 days, 6 hours
|
Re: Poppies - from Poppyseed to Opium [Re: shane]
#6335192 - 12/05/06 03:46 AM (3 years, 8 months ago) |
|
|
cultivation is technically illegal, but there are many situations where the law just winds up not being enforced.
Such examples can be seen in gardens and nurseries where the uneventful and harmless sale and cultivation of poppies carries on peacefully and doesn't attract attention to itself.
--------------------
I find your lack of faith disturbing
|
shane
Stranger
Registered: 01/09/06
Posts: 297
Last seen: 17 days, 3 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Konnrade]
#6336458 - 12/05/06 03:19 PM (3 years, 8 months ago) |
|
|
weird. what about the ice-o-late method. do people still use that?
--------------------
Statements concerning my personal actions and habits, and life in general are not to be taken seriously
go to familyradio.com
|
Konnrade
↑↑↓↓<--><-->BA
Registered: 09/13/05
Posts: 13,820
Loc: LA Suburbs
Last seen: 27 days, 6 hours
|
Re: Poppies - from Poppyseed to Opium [Re: shane]
#6337369 - 12/05/06 07:25 PM (3 years, 8 months ago) |
|
|
I'm not sure, but someone else is bound to know.
--------------------
I find your lack of faith disturbing
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Konnrade]
#6337706 - 12/05/06 08:38 PM (3 years, 8 months ago) |
|
|
I never could get any yields from it. Try asking Mitchnast, I think he either invented it or perfected it. He also had a boatload of the stuff to work with too.
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
shane
Stranger
Registered: 01/09/06
Posts: 297
Last seen: 17 days, 3 hours
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#6337888 - 12/05/06 09:20 PM (3 years, 8 months ago) |
|
|
I'm wondering if indoor growing would be worth the trouble. from what I've read people seem to think its not. what are the main problems with it? and how short of a period can you get a harvest with decent alkaloid yeilds? could one just take the plants outside once they've grown too big to keep in the growing space?
--------------------
Statements concerning my personal actions and habits, and life in general are not to be taken seriously
go to familyradio.com
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: shane]
#6340357 - 12/06/06 01:46 PM (3 years, 8 months ago) |
|
|
I don't think any frequent members of this forum have those answers, best to read up over at poppies.org I'd say the main problems are that we can't match the sunlight or the amount of space indoors; they generally take three months from germination to harvest. If you (are able to) start them indoors, then taking them outside should be fine, but a plant that starts outdoors and in the ground will grow much larger.
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
shane
Stranger
Registered: 01/09/06
Posts: 297
Last seen: 17 days, 3 hours
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#6340439 - 12/06/06 02:18 PM (3 years, 8 months ago) |
|
|
well a friend of mine was already threw his seeds all over the place outside, but his damn house is blocking the sun, so no location gets more than around 6 hours of light. thats why hes interested in indoor growing.
--------------------
Statements concerning my personal actions and habits, and life in general are not to be taken seriously
go to familyradio.com
|
Konnrade
↑↑↓↓<--><-->BA
Registered: 09/13/05
Posts: 13,820
Loc: LA Suburbs
Last seen: 27 days, 6 hours
|
Re: Poppies - from Poppyseed to Opium [Re: shane]
#6340954 - 12/06/06 05:07 PM (3 years, 8 months ago) |
|
|
I've grown healthy poppies with less than 6 hours of direct sunlight. They didn't grow to be huge, but they were reasonably big and healthy.
The lack of sun does make them grow slowly when young, though. They tend to reach a little too hard for the sun and flop over.
--------------------
I find your lack of faith disturbing
|
Lawrence
member
Registered: 08/24/03
Posts: 321
Loc: Canada, Qc
Last seen: 10 days, 8 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#6350808 - 12/09/06 02:23 PM (3 years, 8 months ago) |
|
|
Thank you Wiccan, you will be very healpfull for the next summer.
I will grow puppy for the first time. I hope it'll work.
Take care all.
|
learysprotoge
Stranger
Registered: 09/12/06
Posts: 494
Last seen: 1 year, 9 months
|
Re: Poppies - from Poppyseed to Opium [Re: Lawrence]
#6488423 - 01/23/07 03:32 AM (3 years, 7 months ago) |
|
|
How much longer do you think it will be before people start planting them in there yards for aesthetics?
ITs been freakishly cold lately.
|
bukujutsu
Legion
Registered: 12/24/06
Posts: 225
Loc: The Angels
Last seen: 5 days, 2 hours
|
Re: Poppies - from Poppyseed to Opium [Re: learysprotoge]
#6490223 - 01/23/07 08:00 PM (3 years, 7 months ago) |
|
|
Does anyone know anything about the China White opium poppy?
|
Psilocybeingzz
Square'r of Circles...
Registered: 12/15/02
Posts: 14,403
Loc: International waters
Last seen: 1 month, 10 days
|
Re: Poppies - from Poppyseed to Opium [Re: bukujutsu]
#6490254 - 01/23/07 08:21 PM (3 years, 7 months ago) |
|
|
Its an excellent strain of poppies with white flowers. Small in stature, but often quite rich in alkaloids, especially if you give them lots of love.
Treat them well and when you score the pods the fresh opium will be pink!
Always a good sign.
HAVE FUN!!!
http://www.shroomery.org/forums/files/07-002/883408063-poppys4.jpg
MMMMMMMM ^^^^^^^^^^^^^^^^^^^^ MMMMMMMMMMM
Edited by Psilocybeingzz (01/23/07 08:27 PM)
|
Drewwyann
Slayer of ticks
Registered: 10/30/06
Posts: 4,001
Loc: Atlantis
Last seen: 9 days, 7 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Psilocybeingzz]
#6530010 - 02/04/07 03:28 PM (3 years, 6 months ago) |
|
|
what kinda poppies do the poppy seeds from the grocery store grow? are the seeds even viable?
--------------------
   
Love powerfully 
|
Drewwyann
Slayer of ticks
Registered: 10/30/06
Posts: 4,001
Loc: Atlantis
Last seen: 9 days, 7 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Drewwyann]
#6530011 - 02/04/07 03:29 PM (3 years, 6 months ago) |
|
|
i mean i would love to grow poppies even without the opium part just cause they're nice looking and smell pretty nice
--------------------
Love powerfully
|
MrHorse
A gentleman...of sorts
Registered: 02/05/07
Posts: 5
Last seen: 3 years, 3 months
|
Re: Poppies - from Poppyseed to Opium [Re: Drewwyann]
#6533956 - 02/05/07 06:41 PM (3 years, 6 months ago) |
|
|
Hey guys I'm just curious, I've recently started growing poppies for the first time from some seeds i bought in the grocery store (seems as its impossible to get good seeds in my country) and i was wondering when is the best time to harvest pods for tea, should they be cut off the plant when they reach maturity (crowns up) and dried separate or should they be left on the plant to dry? This maybe a stupid question but I've read through the entire thread and am yet to find an answer. Thanks for any help.
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: MrHorse]
#6534578 - 02/05/07 09:39 PM (3 years, 6 months ago) |
|
|
About two weeks after the crowns flip and they're getting the dusty blue look is said to be the most potent. You'll want to cut them off the stem, otherwise the goodies get washed away when it rains. Use a food dehydrator to avoid mold while drying.
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
MrHorse
A gentleman...of sorts
Registered: 02/05/07
Posts: 5
Last seen: 3 years, 3 months
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#6534729 - 02/05/07 10:19 PM (3 years, 6 months ago) |
|
|
Thanks man, really appreciate it, i've been reading up on everything about poppies for about a month now, and nothing's been more valuable than this thread, my house mate thinks i'm insane, but i'm sure he'll change his mind when harvest time comes... Cheers.
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: MrHorse]
#6534880 - 02/05/07 11:04 PM (3 years, 6 months ago) |
|
|
No problem, you can experiment with letting a few go longer as they will double, even triple in size.
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
MrHorse
A gentleman...of sorts
Registered: 02/05/07
Posts: 5
Last seen: 3 years, 3 months
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#6538894 - 02/07/07 02:26 AM (3 years, 6 months ago) |
|
|
Another thing, have any of you guys attempted growing indoors before? And if so how did it go? I live in an apartment and have no backyard, even if i did the plants are highly illegal here, you can't even buy p.somniferum seeds in this country, apart from the bread seed variety. My seedlings get about 7 hrs sunlight a day, do you think that's adequate?
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: MrHorse]
#6539767 - 02/07/07 12:01 PM (3 years, 6 months ago) |
|
|
Bread seed variety is good, but they're going to need more light. Here's a recent thread on indoor growing from another member, scroll down to the bottom:
http://www.shroomery.org/forums/showflat.php/Cat/0/Number/6531060/an/0/page/1
Otherwise read up over at poppies.org
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
MrHorse
A gentleman...of sorts
Registered: 02/05/07
Posts: 5
Last seen: 3 years, 3 months
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#6542753 - 02/08/07 01:34 AM (3 years, 6 months ago) |
|
|
Thanks, for the advice,Quote:
Hanky said: You could be mod of the homosexual fat teens forum!
your not having a shot at my fine gentlemanly mustachio are you?
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: MrHorse]
#6542815 - 02/08/07 01:51 AM (3 years, 6 months ago) |
|
|
Nope, I dig your stash
That's actually a message left in my ratings from Uncle Hanky, (another member here) I was so touched by his kind words that I thought I'd put it in my signature to share with the rest of the community. I also feel that it complements the yin and yang that flows through us all.
You're new here, eh?
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
MrHorse
A gentleman...of sorts
Registered: 02/05/07
Posts: 5
Last seen: 3 years, 3 months
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#6542843 - 02/08/07 02:01 AM (3 years, 6 months ago) |
|
|
yeah I'm new, from Australia, been stalking this thread for about a month though, gleaning whatever information i can, shame about the whole sunlight thing guess I'll have to invest in a hydroponics setup, either that or move somewhere with a backyard, both of which would cost a lot... ah nuts my grand dreams of opium have failed before they even began... I'll still give these seedlings a go (while i save up the money for a decent hydroponics setup) maybe I'll get something from them.
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: MrHorse]
#6542861 - 02/08/07 02:09 AM (3 years, 6 months ago) |
|
|
Welcome to the Garden!
Less light just idicates smaller plants with less pods, still good O, problably not more than a couple cups of tea though.
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
bukujutsu
Legion
Registered: 12/24/06
Posts: 225
Loc: The Angels
Last seen: 5 days, 2 hours
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#6559890 - 02/12/07 09:16 PM (3 years, 6 months ago) |
|
|
Does harvesting opium from a plant reduce the quality of its seeds? Let's say one of my plants grows really well, should I just leave it alone until it dries to make sure the seeds aren't damaged?
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: bukujutsu]
#6561905 - 02/13/07 08:00 AM (3 years, 6 months ago) |
|
|
I've never lanced any myself, but I hear that it has no affect on the quality or viability of the seeds. Got for it!
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
brshroomer
Lazy Wanderer
Registered: 12/10/06
Posts: 619
Last seen: 2 hours, 52 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#6562033 - 02/13/07 09:51 AM (3 years, 6 months ago) |
|
|
it has no effect...because the seeds are inside the pod...the opium is on the pod 'walls'...
--------------------
Brewmaster said:
How the fuck do you split a microdot?
|
Nalim
Hello Kitty
Registered: 01/13/06
Posts: 13,471
Last seen: 30 days, 14 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#6606185 - 02/24/07 06:54 PM (3 years, 6 months ago) |
|
|
OK
I have a pretty large balcony and thought I would grow some ethnos out there. Poppies would be fun. Do you ppl think I could get any reasonable amount of pods this way? Thought I'd put them in six 10" square pots..
|
UncleLuke
Crack andlasers.
Registered: 04/28/05
Posts: 3,167
Loc: North Florida
Last seen: 3 years, 1 month
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#6606218 - 02/24/07 07:11 PM (3 years, 6 months ago) |
|
|
Quote:
namaste said:
Nope, I dig your stash
That's actually a message left in my ratings from Uncle Hanky, (another member here) I was so touched by his kind words that I thought I'd put it in my signature to share with the rest of the community. I also feel that it complements the yin and yang that flows through us all.
You're new here, eh?
Are you speaking of me, or Hanky?
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: UncleLuke]
#6607115 - 02/25/07 01:08 AM (3 years, 6 months ago) |
|
|
Wasn't you Luke.
Quote:
Nast said:
I have a pretty large balcony and thought I would grow some ethnos out there. Poppies would be fun. Do you ppl think I could get any reasonable amount of pods this way? Thought I'd put them in six 10" square pots..
Ask Konnrade, I'm pretty sure he grows in pots.
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
Nalim
Hello Kitty
Registered: 01/13/06
Posts: 13,471
Last seen: 30 days, 14 hours
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#6607680 - 02/25/07 04:57 AM (3 years, 6 months ago) |
|
|
Will do!
|
agar
old hand
Registered: 11/21/04
Posts: 9,056
Loc: Somewhere Else
|
Re: Poppies - from Poppyseed to Opium [Re: Nalim]
#6607764 - 02/25/07 06:42 AM (3 years, 6 months ago) |
|
|
It's great to have good buddies.
One just returned from an Afghan tour.
Turned me on to 1/4 lb of seeds.
Timing was perfect.
--------------------
|
Nalim
Hello Kitty
Registered: 01/13/06
Posts: 13,471
Last seen: 30 days, 14 hours
|
Re: Poppies - from Poppyseed to Opium [Re: agar]
#6608288 - 02/25/07 12:46 PM (3 years, 6 months ago) |
|
|
Fantastic, I bet you'll have a lovely field this summer
|
agar
old hand
Registered: 11/21/04
Posts: 9,056
Loc: Somewhere Else
|
Re: Poppies - from Poppyseed to Opium [Re: Nalim]
#6618740 - 02/28/07 01:16 AM (3 years, 6 months ago) |
|
|
Just shooting for 3.... 4ft X 50ft rows.
Last fall, rototilled in lots of compost/horse manure.
Adjusted soil Ph.
Now testing/adjusting more.
Rigged a soaker hose for each row.
On a manifold & timer set-up.
Last steps will be to:
Line row edge sides with 3/4 inch X 8 inch exterior plywood.
(used construction material)
Then, string line level the rows.
Then, add steel fence posts & 36 inch fencing.
(as our dogs tend to DIG such spots)
Once done, it's "sowing" time.
Plan to broadcast seeds on to prepped level soil.
Then, cover with a very very thin film of good loany soil/compost.
(8th inch seed cover)
Then, a light water spray/mist, to set seeds & go from there.
Whatever will be.....will be.;)
--------------------
|
Nalim
Hello Kitty
Registered: 01/13/06
Posts: 13,471
Last seen: 30 days, 14 hours
|
Re: Poppies - from Poppyseed to Opium [Re: agar]
#6619318 - 02/28/07 04:02 AM (3 years, 6 months ago) |
|
|
I bet whatever will be will be a lot of beautiful pods and hopefully a bountiful harvest. Best of luck!
I unfortunately don't have a lot of space.. but 6 or 7 10" pots will be dedicated for papaver cultivation..
|
GoomTard
ShroomTard
Registered: 03/08/07
Posts: 51
Last seen: 3 years, 5 months
|
Re: Poppies - from Poppyseed to Opium [Re: Nalim]
#6653360 - 03/09/07 05:30 PM (3 years, 5 months ago) |
|
|
does alaskan fish fert. work well with poppy seedlings?
--------------------
So?
|
Nalim
Hello Kitty
Registered: 01/13/06
Posts: 13,471
Last seen: 30 days, 14 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Nalim]
#6653431 - 03/09/07 05:58 PM (3 years, 5 months ago) |
|
|
Oh, anyone that has any clue at all: How should I sprout the seedlings? just spread the seeds in the large pots and moist them a bit? Use thoroughly moistened soil? What temps should it be outside before I sprout them?
|
GoomTard
ShroomTard
Registered: 03/08/07
Posts: 51
Last seen: 3 years, 5 months
|
Re: Poppies - from Poppyseed to Opium [Re: Nalim]
#6654376 - 03/10/07 12:13 AM (3 years, 5 months ago) |
|
|
Seriously, I have read seen detailed descriptions of how to cultivate O poppies except germinating and planting. I need to know this also.
--------------------
So?
|
Taharka
The Root of the Problem
Registered: 09/30/05
Posts: 674
|
Re: Poppies - from Poppyseed to Opium [Re: Nalim]
#6656034 - 03/10/07 05:28 PM (3 years, 5 months ago) |
|
|
Poppies don't like to be transplanted, as they have very delicate roots. They do survive the cold though, and [I've heard that] a good freeze helps them germinate. Your best bet is to spread them directly into whatever soil you want them in, any time between say October and the end of March.
|
Nalim
Hello Kitty
Registered: 01/13/06
Posts: 13,471
Last seen: 30 days, 14 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Taharka]
#6656038 - 03/10/07 05:30 PM (3 years, 5 months ago) |
|
|
Thanks Taharka! Will do!
|
GoomTard
ShroomTard
Registered: 03/08/07
Posts: 51
Last seen: 3 years, 5 months
|
Re: Poppies - from Poppyseed to Opium [Re: Nalim]
#6658186 - 03/11/07 02:39 PM (3 years, 5 months ago) |
|
|
does it matter much if the soil is kinda clay-y, or will it be fine? one of the areas where i planted my seeds is a mixture of the natural ground soil, steer manure, and chicken manure, and it ended less airy then it was before.
--------------------
So?
|
agar
old hand
Registered: 11/21/04
Posts: 9,056
Loc: Somewhere Else
|
Re: Poppies - from Poppyseed to Opium [Re: GoomTard]
#6658560 - 03/11/07 04:55 PM (3 years, 5 months ago) |
|
|
Clay like soil often leaves standing water.
(doesn't drain well)
Poppies don't germinate or start well.
With poor drainage, or clay like soil, as the roots ROT.
I have a sandy glacial till soil.
That contains very little organic matter.
I rototill-ed in LOTS of aged horse manure.
As well as lots of spent mushroom substrate casings.
(last fall)
Into the rows, I am about to sow, in the next few days.
I tested the rows, today by watering each heavily.
(garden hose)
To insure there was good drainage in each row.
(and, each row was LEVEL, with no low/high spots)
Water settled right in, without pooling.
So, I'm good to go. (I hope)
--------------------
|
GoomTard
ShroomTard
Registered: 03/08/07
Posts: 51
Last seen: 3 years, 5 months
|
Re: Poppies - from Poppyseed to Opium [Re: agar]
#6658816 - 03/11/07 06:27 PM (3 years, 5 months ago) |
|
|
where I "planted" my seeds in one area, I just spilled them out of my hand. I can still see them on the surface of the soil, is this hwo it's supposed to be, or should I cover them in soil. If so, how much soil?
--------------------
So?
|
razer7echo
Stranger
Registered: 07/12/06
Posts: 23
Last seen: 1 year, 10 months
|
Re: Poppies - from Poppyseed to Opium [Re: GoomTard]
#6693804 - 03/21/07 01:47 AM (3 years, 5 months ago) |
|
|
Can someone give me the lowdown on this? From what I understood there is one poppy plant that can be used for effects/sap drinking/ opium etc. Also I heard that some people have died from using poppy seeds and making tea because there is no way to know how much is in there with each crop since they aren't sold for that.
I probably wouldn't mind doing the old ancient thing where you just cut the bulb and drink the sap. They said that was a gift from the gods and it wasn't strong at all. But I have no idea if you can just grow a plant indoors and quickly and do that or how safe it would be.
Thanks.
|
brshroomer
Lazy Wanderer
Registered: 12/10/06
Posts: 619
Last seen: 2 hours, 52 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: razer7echo]
#6695091 - 03/21/07 01:49 PM (3 years, 5 months ago) |
|
|
1- it was strong...damn..is opium!
2- read the whole thread...you will learn a lot..
--------------------
Brewmaster said:
How the fuck do you split a microdot?
|
brshroomer
Lazy Wanderer
Registered: 12/10/06
Posts: 619
Last seen: 2 hours, 52 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: GoomTard]
#6695100 - 03/21/07 01:51 PM (3 years, 5 months ago) |
|
|
Quote:
GoomTard said:
where I "planted" my seeds in one area, I just spilled them out of my hand. I can still see them on the surface of the soil, is this hwo it's supposed to be, or should I cover them in soil. If so, how much soil?
you're fine just sowing them like that...they don't need to be covered with soil...
they also take a little to germinate..don't worry
--------------------
Brewmaster said:
How the fuck do you split a microdot?
|
resin
Ghetto Monster
Registered: 06/12/02
Posts: 2,806
Loc: Near
Last seen: 1 day, 9 hours
|
Re: Poppies - from Poppyseed to Opium [Re: brshroomer]
#6716587 - 03/27/07 03:43 PM (3 years, 5 months ago) |
|
|
Anybody know of how to make, or aquire a lancing tool?
--------------------
"Cause im better than bo
The only time I will depend
is when I’m seventy years old
thats when I can’t Hold my shit
within
so I shit on myself
Cuz I’m so sick and tired of shittin’ on everybody else"
|
brshroomer
Lazy Wanderer
Registered: 12/10/06
Posts: 619
Last seen: 2 hours, 52 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: resin]
#6716599 - 03/27/07 03:49 PM (3 years, 5 months ago) |
|
|
from what i read...traditionally they would use 3 blades put together...
so basically...get 3 razor blades, put something small between them to space them a little bit...and glue them together...or use some silver tape..or something like that...
that should work fine ;D
--------------------
Brewmaster said:
How the fuck do you split a microdot?
|
resin
Ghetto Monster
Registered: 06/12/02
Posts: 2,806
Loc: Near
Last seen: 1 day, 9 hours
|
Re: Poppies - from Poppyseed to Opium [Re: brshroomer]
#6716674 - 03/27/07 04:18 PM (3 years, 5 months ago) |
|
|
More worried obout the spacing as to not go too deep. Ive seen pictures in books of a woodhandled tool, theres gotta be somewhere to get one
--------------------
"Cause im better than bo
The only time I will depend
is when I’m seventy years old
thats when I can’t Hold my shit
within
so I shit on myself
Cuz I’m so sick and tired of shittin’ on everybody else"
|
Schwip
Never sleeps.
Registered: 06/27/05
Posts: 3,934
Last seen: 3 years, 4 months
|
Re: Poppies - from Poppyseed to Opium [Re: resin]
#6716682 - 03/27/07 04:23 PM (3 years, 5 months ago) |
|
|
The absolute best scraper is a safety pin.
You bend the very tip of the pin to the depth you want the cut to be, so then its impossible to drive it too deep into the poppy.
See what im saying?
--------------------
--------------------------------
" If the sky were to suddenly open up there would be no law. There would be no rule. There would only be you and your memories... the choices you've made, and the people you've touched. If this world were to end there would only be you and him and no-one else. "
..............
"MAN! You know there aint no such thing as left over crack!"
|
kaal-kopje
the season is upon us..
Registered: 10/21/02
Posts: 352
Loc: below sea level
|
Re: Poppies - from Poppyseed to Opium [Re: agar]
#6751899 - 04/05/07 09:16 PM (3 years, 4 months ago) |
|
|
Very nice thread! Lot of really usefull information.
I have some tazzy seed on its way and i wonder how they'll do over here this summer. Mainly growing for seed this year since my space is very limited.
Here are a few pics from a few years back you might enjoy.
I don't know which strain the red/purple poppies were (they appeared spontaniously in the garden) but they were not nearly as potent as the danish flag i mixed in.
They were looked after 24/7
|
malcom43
Stranger
Registered: 03/08/07
Posts: 95
Last seen: 3 years, 3 months
|
Re: Poppies - from Poppyseed to Opium [Re: agar]
#6752344 - 04/05/07 11:12 PM (3 years, 4 months ago) |
|
|
could any kind soul tell me how long poppies take to germinate? I'm about 3 days and wondering what is going on. They are in peet pots with no activity, I can see cuz they are sitting on top of the soil.
Also, does anyone know if they survive frost when in seed? Sowed some outside (not the ones in the peat pots) and then they got hit with a freak snow storm the next day (or couple of days depending on the seeds were talking about.) Wondering if I should consider them a loss?
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: malcom43]
#6753450 - 04/06/07 10:36 AM (3 years, 4 months ago) |
|
|
~Generally around 10 days, sometimes less or more. They will survive frost, but don't do well with drying out.
Nice pics kaal.
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
shane
Stranger
Registered: 01/09/06
Posts: 297
Last seen: 17 days, 3 hours
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#6753809 - 04/06/07 01:11 PM (3 years, 4 months ago) |
|
|
is it possible to damage the leaves with the pepper/garlic bug spray mix?
--------------------
Statements concerning my personal actions and habits, and life in general are not to be taken seriously
go to familyradio.com
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: shane]
#6753829 - 04/06/07 01:17 PM (3 years, 4 months ago) |
|
|
I see no reason for the spray, the only thing that's interested in eating them are Japanese Beetles, and that's only in the flowering stage - and even they don't do that much damage to poppies.
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
shane
Stranger
Registered: 01/09/06
Posts: 297
Last seen: 17 days, 3 hours
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#6754139 - 04/06/07 02:56 PM (3 years, 4 months ago) |
|
|
but say, if they had aphids or katydids? if i did spray the leaves, would it cause them to dry out?
--------------------
Statements concerning my personal actions and habits, and life in general are not to be taken seriously
go to familyradio.com
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: shane]
#6754211 - 04/06/07 03:17 PM (3 years, 4 months ago) |
|
|
It should be fine, drying out is more of a problem for outdoor seedlings that aren't getting enough moisture.
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
wowitch17
Growery is Better
Registered: 01/11/06
Posts: 7,698
Loc: Austin area, Texas
Last seen: 6 hours, 48 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#6757934 - 04/07/07 03:53 PM (3 years, 4 months ago) |
|
|
I have a question. I overwintered my poppies(im in texas)and they have gotten to about 1.5-2ft tall. The problem is the bottom sets of leaves are starting to turn yellow on most of the smaller poppies. Is this a problem. And also when should they floweR?
--------------------
|
g0pher
sir?
Registered: 07/18/05
Posts: 425
Loc: Uranus
Last seen: 1 year, 8 months
|
Re: Poppies - from Poppyseed to Opium [Re: wowitch17]
#6758002 - 04/07/07 04:15 PM (3 years, 4 months ago) |
|
|
will poppies flower at anytime of the year in a warm climate?
--------------------
ALL POSTS ARE FICTIONAL
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: wowitch17]
#6759008 - 04/07/07 10:03 PM (3 years, 4 months ago) |
|
|
It's normal for the bottom leaves to wither. I do suggest a vegatative fertilizer high in P and K, and then switching to one high in N for blooming.
Gopher - I'm in a colder climate so I don't have an answer for you.
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
toastandjam
Tastes Grate, Lesh Philling
Registered: 05/08/06
Posts: 746
Last seen: 8 months, 9 days
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#6800558 - 04/17/07 06:31 PM (3 years, 4 months ago) |
|
|
I've been offered what seems to be a pretty good deal on what are described as "arizonas" pods. They're fairly oblong and pale tan in color. I have no experience with these kinds of pods. Anyone with more knowledge have some commentary\advice for me?
--------------------
Q: We wanted to see if you had the ability to expand your mind and your horizons... and for one brief moment, you did.
PICARD: When I realized the paradox...
Q: Exactly. For that one fraction of a second, you were open to options you'd never considered. That's the exploration that awaits you...not mapping stars and studying nebulae... but charting the unknowable possibilities of existence.
To carry yourself forward and experience myriad things is delusion. That myriad things come forth and experience themselves is awakening. -Dogen Zenji
|
bukujutsu
Legion
Registered: 12/24/06
Posts: 225
Loc: The Angels
Last seen: 5 days, 2 hours
|
Re: Poppies - from Poppyseed to Opium [Re: toastandjam]
#6801184 - 04/17/07 09:15 PM (3 years, 4 months ago) |
|
|
Does anyone know anything about the turkish giant strain?
Also, are there any good fertilizers available at Home Depot or Lowes that are good for vegetation and blooming(seperate).
|
MycoCakeEater
Old Hand
Registered: 06/16/03
Posts: 1,548
|
Re: Poppies - from Poppyseed to Opium [Re: agar]
#6806233 - 04/18/07 10:55 PM (3 years, 4 months ago) |
|
|
I don't understand why RED CLAY gets such a bad rep in poppy gardening.
Zone 7
All red clay for germination-flowering.
NO soil amendments.
I'll let the pictures do most of the talking.
And finally a BIG, healthy root system that only others can dream of!
I have found that as flat levels of soil, red clay is just as good as in mounds. Drainage was never an issue. In fact, I had even heartier germination in the vallies than the mounds!
YUMMY!
|
wowitch17
Growery is Better
Registered: 01/11/06
Posts: 7,698
Loc: Austin area, Texas
Last seen: 6 hours, 48 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: MycoCakeEater]
#6818817 - 04/22/07 01:13 PM (3 years, 4 months ago) |
|
|
Hello here are some pics from my garden. Is it normal for the young buds to turn darker color? You can see in some of my pictures what I am talking about.
--------------------
|
bukujutsu
Legion
Registered: 12/24/06
Posts: 225
Loc: The Angels
Last seen: 5 days, 2 hours
|
Re: Poppies - from Poppyseed to Opium [Re: wowitch17]
#6842905 - 04/27/07 10:45 PM (3 years, 4 months ago) |
|
|
Hey guys, today I bought some blood meal(12-0-0) and some Bone Meal(1-11-0.
2 of my plants have grown a small pod(they're still under 2 feet tall).
Should I use either one of these yet?
It'd be pretty cool if I could get some huge pods.
Oh right, there are also a couple of plants under 5 inches.
Anything I should use on them?
|
mockeylock
head
Registered: 02/07/04
Posts: 1,046
Last seen: 1 month, 19 days
|
Re: Poppies - from Poppyseed to Opium [Re: MycoCakeEater]
#6846174 - 04/28/07 07:59 PM (3 years, 4 months ago) |
|
|
Awesome pics, Myco-dude!!!
Those are some big 'ol pods! How many weeks from seed, do you recall?
--------------------
|
shane
Stranger
Registered: 01/09/06
Posts: 297
Last seen: 17 days, 3 hours
|
Re: Poppies - from Poppyseed to Opium [Re: mockeylock]
#6864803 - 05/02/07 10:52 PM (3 years, 4 months ago) |
|
|
these flowered yesterday. they should be gigantemums (sp?), but i dont know what color that strain's flowers are. how do they look?
--------------------
Statements concerning my personal actions and habits, and life in general are not to be taken seriously
go to familyradio.com
|
MycoCakeEater
Old Hand
Registered: 06/16/03
Posts: 1,548
|
Re: Poppies - from Poppyseed to Opium [Re: shane]
#6865550 - 05/03/07 01:21 AM (3 years, 4 months ago) |
|
|
Planted early October, Harvest early May
|
shane
Stranger
Registered: 01/09/06
Posts: 297
Last seen: 17 days, 3 hours
|
Re: Poppies - from Poppyseed to Opium [Re: MycoCakeEater]
#6872024 - 05/04/07 01:56 PM (3 years, 4 months ago) |
|
|
only one flower per plant. just a problem of light i suppose?
--------------------
Statements concerning my personal actions and habits, and life in general are not to be taken seriously
go to familyradio.com
|
bukujutsu
Legion
Registered: 12/24/06
Posts: 225
Loc: The Angels
Last seen: 5 days, 2 hours
|
Re: Poppies - from Poppyseed to Opium [Re: shane]
#6873333 - 05/04/07 08:47 PM (3 years, 4 months ago) |
|
|
My china white poppies seem to be growing a pod at every base of a leaf.
They still haven't flowered yet(just extra info).
Is this normal?
Will the opium from the smaller pods be as good as the opium from the main pod?
|
wowitch17
Growery is Better
Registered: 01/11/06
Posts: 7,698
Loc: Austin area, Texas
Last seen: 6 hours, 48 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: bukujutsu]
#6898367 - 05/10/07 05:55 PM (3 years, 3 months ago) |
|
|
heres some pod porn. Hens and chicks
--------------------
|
C-Dizzle
Stranger
Registered: 01/06/06
Posts: 682
|
Re: Poppies - from Poppyseed to Opium [Re: wowitch17]
#6906695 - 05/12/07 07:47 PM (3 years, 3 months ago) |
|
|
so what is wrong with smoking opium thats been cut, scrapped, and dried over night?
|
brshroomer
Lazy Wanderer
Registered: 12/10/06
Posts: 619
Last seen: 2 hours, 52 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: C-Dizzle]
#6906780 - 05/12/07 08:27 PM (3 years, 3 months ago) |
|
|
well...not much...
but you'll be smoking undesirable plant matter, it won't be 100% latex... that's why you cook it... to remove the undesirable plant matter...
--------------------
Brewmaster said:
How the fuck do you split a microdot?
|
bukujutsu
Legion
Registered: 12/24/06
Posts: 225
Loc: The Angels
Last seen: 5 days, 2 hours
|
Re: Poppies - from Poppyseed to Opium [Re: C-Dizzle]
#6906788 - 05/12/07 08:29 PM (3 years, 3 months ago) |
|
|
There's nothing wrong with smoking opium.
Unless you mean raw opium.
Raw opium has too much junk in it.
You should process it so it'll be mostly made up of the main alkaloids.
If you were talking about the moral reasons, then I stand by my 1st sentence.
I'm pretty sure about 40-50% of cooked O is morphine.
You know, the stuff they give you in hospitals when you need significant pain relief.
Of course, if you don't have the self-control to prevent yourself from getting addicted, you shouldn't use it.
Okay, now I need someone to help me with my dilemma.
My plants are growing pods at the base of some leaves, but they already have a main pod that's about ready to be scraped.
I read that to get max opium from a poppy plant you should stop watering once it flowers, but the small pods need water, right?
What should I do?
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: bukujutsu]
#6907288 - 05/12/07 10:34 PM (3 years, 3 months ago) |
|
|
Stop watering until after you've collected from the mature pod?
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
retro_killa
Stranger
Registered: 02/23/06
Posts: 330
Loc: Nor*Cal USA
Last seen: 6 months, 4 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: namaste]
#6909476 - 05/13/07 12:54 PM (3 years, 3 months ago) |
|
|
nice write ups
|
shane
Stranger
Registered: 01/09/06
Posts: 297
Last seen: 17 days, 3 hours
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: retro_killa]
#6913588 - 05/14/07 12:48 PM (3 years, 3 months ago) |
|
|
ive got the same problem. the growth seems to be at a standstill. i wanna make sure they get to proper seeding. is it still a bad idea to be watering them, if im careful not to get any water on above ground parts of the plants?
--------------------
Statements concerning my personal actions and habits, and life in general are not to be taken seriously
go to familyradio.com
|
Phish_Dude
steppin' into yesterday
Registered: 10/16/06
Posts: 5,721
Loc: secret tweeker pad
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: shane]
#6931765 - 05/17/07 10:15 PM (3 years, 3 months ago) |
|
|
can you recommend some good fertilizers?
--------------------
|
shane
Stranger
Registered: 01/09/06
Posts: 297
Last seen: 17 days, 3 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Phish_Dude]
#6935056 - 05/18/07 05:03 PM (3 years, 3 months ago) |
|
|
does anyone know... is it okay to water the poppies a little bit? the clock is ticking and they get drier every day so i need to know whether to harvest or water em. and can i pull em at different times or do i do it all at once?
--------------------
Statements concerning my personal actions and habits, and life in general are not to be taken seriously
go to familyradio.com
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: shane]
#6935845 - 05/18/07 08:29 PM (3 years, 3 months ago) |
|
|
Only collect the mature pods.
Ferts high in P and K for lettuce and N for flowers, Superthrive is good too.
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
shane
Stranger
Registered: 01/09/06
Posts: 297
Last seen: 17 days, 3 hours
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#6935920 - 05/18/07 08:54 PM (3 years, 3 months ago) |
|
|
but can i water them a bit? the bottom leaves are all started to get brown and crackly.
--------------------
Statements concerning my personal actions and habits, and life in general are not to be taken seriously
go to familyradio.com
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: shane]
#6936471 - 05/19/07 12:18 AM (3 years, 3 months ago) |
|
|
It's ok to water them while flowering if they really need it, just don't over-do it.
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
shane
Stranger
Registered: 01/09/06
Posts: 297
Last seen: 17 days, 3 hours
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#6938772 - 05/19/07 03:21 PM (3 years, 3 months ago) |
|
|
well, theres flower buds that are drying out one of the plants, but theres already a large main pod thats ready to harvest on that main plant. (sorry, im not sure if the post-pod swelling stage would be considered flowering) should i harvest or water? and is it better to let them die, then harvest, or harvest before the upper leaves dry out aswell?
Edited by shane (05/19/07 05:22 PM)
|
purity
Registered: 06/16/02
Posts: 994
Loc:
|
Re: Poppies - from Poppyseed to Opium [Re: shane]
#6957647 - 05/23/07 07:03 PM (3 years, 3 months ago) |
|
|
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: shane]
#6960060 - 05/24/07 05:29 AM (3 years, 3 months ago) |
|
|
Two weeks after the crowns have flipped would be an ideal time to harvest.
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
shane
Stranger
Registered: 01/09/06
Posts: 297
Last seen: 17 days, 3 hours
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#6961904 - 05/24/07 04:36 PM (3 years, 3 months ago) |
|
|
okay cool. is there any point in saving leaves or lower part of the stems?
--------------------
Statements concerning my personal actions and habits, and life in general are not to be taken seriously
go to familyradio.com
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: shane]
#6963319 - 05/24/07 11:33 PM (3 years, 3 months ago) |
|
|
Five inches below the pod are said to be good. Everything else contains small amounts of actives - generally thought to be an insignificant amount and possibly contains undesirable alkaloids. I've got a few grocery bags of leaves and stems that I've been meaning to try with an alcohol extract.
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
shane
Stranger
Registered: 01/09/06
Posts: 297
Last seen: 17 days, 3 hours
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#7105449 - 06/29/07 12:43 AM (3 years, 2 months ago) |
|
|
can anyone help me with these questions?
1. should i be worried about ants eating the latex overnight?
2. why are the seeds different colors, but still the same strain?
3. has anyone had a problem with housebugs eating dried pods?
thanks,
shane
--------------------
Statements concerning my personal actions and habits, and life in general are not to be taken seriously
go to familyradio.com
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: shane]
#7106363 - 06/29/07 08:32 AM (3 years, 2 months ago) |
|
|
1. No
2. Possibly due to cross-pollination, recessive traits or immature seeds
3. No, but you should grind them up and get them in the freezer for long-term storage
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
shane
Stranger
Registered: 01/09/06
Posts: 297
Last seen: 17 days, 3 hours
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#7106391 - 06/29/07 09:04 AM (3 years, 2 months ago) |
|
|
thank you sir : )
--------------------
Statements concerning my personal actions and habits, and life in general are not to be taken seriously
go to familyradio.com
|
bukujutsu
Legion
Registered: 12/24/06
Posts: 225
Loc: The Angels
Last seen: 5 days, 2 hours
|
Re: Poppies - from Poppyseed to Opium [Re: shane]
#7107122 - 06/29/07 02:57 PM (3 years, 2 months ago) |
|
|
Can you make poppy tea with dried empty pods?
I've collected the seeds of all my pods for future grows and don't know if I can do anything with the leftovers.
|
spock
journeyman
Registered: 08/27/03
Posts: 587
|
Re: Poppies - from Poppyseed to Opium [Re: bukujutsu]
#7107162 - 06/29/07 03:07 PM (3 years, 2 months ago) |
|
|
sure can.:)
|
Nalim
Hello Kitty
Registered: 01/13/06
Posts: 13,471
Last seen: 30 days, 14 hours
|
Re: Poppies - from Poppyseed to Opium [Re: bukujutsu]
#7107183 - 06/29/07 03:14 PM (3 years, 2 months ago) |
|
|
Thats the general way of making poppy tea.
|
MYSTIQUE
Say Hi to the elves for me.
Registered: 04/28/07
Posts: 1,745
Loc: Canada
Last seen: 20 hours, 54 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: Nalim]
#7153652 - 07/09/07 11:20 PM (3 years, 1 month ago) |
|
|
just for that guy that just asked what to do with his pods and found out about tea.
I in no way endorse the use of the pod but it you really really have to try it. No more then three med. to start and not more then once a week or at least wait three days so it don't build up in your system and have to tapper off the shit. Its a hard drug to kick and it will make you fall into its spell fast just cuz its pods does not make it any less addictive. BTW if ya get caught with them ground up thats a whole new legal ball game.
--------------------
Dont know what the fuck I just said? READ THIS
http://www.shroomery.org/5122/The-Shroomery-Mushroom-Glossary
I ain't a hippy but I'm covered in dirt
Sippin lots of mushroom tea in a tye-dye shirt
Chasin' the Grateful Dead, no shoes on my feet
Beggin' in the parking lot for something to eat,
 DO NOT USE FIRE IN YOUR GLOVE BOX!!!!!!!
|
bukujutsu
Legion
Registered: 12/24/06
Posts: 225
Loc: The Angels
Last seen: 5 days, 2 hours
|
Re: Poppies - from Poppyseed to Opium [Re: MYSTIQUE]
#7157606 - 07/10/07 08:59 PM (3 years, 1 month ago) |
|
|
Ho ho ho, oh dear, I'mnot planning to use them. Sorry for that. After reading your post I immediately thought about the post about dobie(the guy that's missing). I'm proud to say that I don't use any drugs and have no desire to use them.
|
QualityHarvest
Stranger
Registered: 06/07/07
Posts: 21
Last seen: 3 years, 1 month
|
Re: Poppies - from Poppyseed to Opium [Re: bukujutsu]
#7177183 - 07/15/07 01:35 AM (3 years, 1 month ago) |
|
|
would it be ok to plant now in july, I live in Arkansas USA
I dont know what strain I have but the guy said it came from india.
|
logancircle
Stranger
Registered: 03/03/06
Posts: 13
Last seen: 2 years, 2 months
|
Re: Poppies - from Poppyseed to Opium [Re: QualityHarvest]
#7255052 - 08/03/07 01:22 PM (3 years, 1 month ago) |
|
|
Just wanted to share this experience with you all:
Mr. X made a cold extraction last night using ground pods and grapefruit soda (plus a little drizzle of lime juice for acidity). He put the ground material into a 1 liter soda bottle, then added the very cold soda till the bottle was a little less than half-full, then added the lime, then shook the hell out of it for a few minutes. Then, Mr. X put the mixture in the coldest part of the fridge and went to bed. 8 hours later the next morning he shook it again, then poured the sludge into a cup through a screen. Then he took all the non-liquid sludge from the screen, wrapped it in a piece of t-shirt and squeezed all the remaining liquid into the cup. Then he held his nose and chugged it. Then he chewed some gum and got on the subway. About an hour later it started to hit him, just like Percocet, but lasting longer. Most of you all probably know this method already, but feel free to email me if you have any questions.
cd in DC
|
shane
Stranger
Registered: 01/09/06
Posts: 297
Last seen: 17 days, 3 hours
|
Re: Poppies - from Poppyseed to Opium [Re: logancircle]
#7255362 - 08/03/07 02:50 PM (3 years, 1 month ago) |
|
|
can someone help me out this strain issue i have? i can't tell the difference between gigs and tazzies. i was sure i had gigs, but now i dont know. they're pumpkin shaped pods, if thats any indicator. also, can we get a general guide to strains or just a list of photos so they are more identifiable? and, when we see dried pods online, is there a certain strain that takes prevelence in popularity with most of the growers?
--------------------
Statements concerning my personal actions and habits, and life in general are not to be taken seriously
go to familyradio.com
|
TODAY
Battletoad
Registered: 09/25/03
Posts: 10,218
Loc: Metropolis City, USA
|
Re: Poppies - from Poppyseed to Opium [Re: shane]
#7267549 - 08/06/07 09:15 PM (3 years, 1 month ago) |
|
|
Not to derail Shane's question but I have one myself...
If a person wanted to go geurilla with a little poppy patch, should they be worried about deer or rabbits? I've heard of both being ravenous on unpenned MJ plots but poppy lettuce/pods are bitter as hell and don't seem like they'd be good eating.
--------------------
ca'rouse (k-rouz)
intr.v.
To engage in boisterous, drunken merrymaking.
|
logancircle
Stranger
Registered: 03/03/06
Posts: 13
Last seen: 2 years, 2 months
|
Re: Poppies - from Poppyseed to Opium [Re: TODAY]
#7270495 - 08/07/07 04:06 PM (3 years, 30 days ago) |
|
|
This is all hypothetical, of course . My experience is that tazzies are weaker. The gigs that I've gotten are both bigger and more potent, so the additional cost is worth it to me. I really had to work to get a buzz with the tas, whereas I have to be careful not to overdo it with the gigs.
|
joker_66599
NOOB / SMALLTIME GROWER
Registered: 07/18/05
Posts: 753
Last seen: 9 months, 18 days
|
Re: Poppies - from Poppyseed to Opium [Re: logancircle]
#7399299 - 09/12/07 03:28 AM (2 years, 11 months ago) |
|
|
i have not read all of these post but i am moving to cali and plane on having a garden i can make it big as i want i guess but something like 6X6 or maybe 10X6 just wondering. when i should plant them and if adding worms and that kinda stuff helps. it will be in souther cali coastle area.
Joker
--------------------
 ?¿
?¿
¿?
I don't really grow mushrooms I just act like it to be coo.
?¿
¿?
|
TODAY
Battletoad
Registered: 09/25/03
Posts: 10,218
Loc: Metropolis City, USA
|
Re: Poppies - from Poppyseed to Opium [Re: joker_66599]
#7409295 - 09/14/07 03:52 PM (2 years, 11 months ago) |
|
|
I'm planting in a week in N. Cali. It might be a smiz too soon but I think the devastating summer heat has passed.
--------------------
ca'rouse (k-rouz)
intr.v.
To engage in boisterous, drunken merrymaking.
|
joker_66599
NOOB / SMALLTIME GROWER
Registered: 07/18/05
Posts: 753
Last seen: 9 months, 18 days
|
Re: Poppies - from Poppyseed to Opium [Re: TODAY]
#7421020 - 09/17/07 09:16 PM (2 years, 11 months ago) |
|
|
I will be in so-cal
--------------------
?¿
?¿
¿?
I don't really grow mushrooms I just act like it to be coo.
?¿
¿?
|
learysprotoge
Stranger
Registered: 09/12/06
Posts: 494
Last seen: 1 year, 9 months
|
Re: Poppies - from Poppyseed to Opium [Re: joker_66599]
#7428729 - 09/19/07 05:33 PM (2 years, 11 months ago) |
|
|
WTF? you can grow in N cal right now?
I dunharvested everything like 3 months ago..
I was considering an experimental crop right about now, but figured itd go to rot..
Ill try it out now anyways..
Hell itll only set me back $5
|
deformedreality
Stranger
Registered: 06/16/07
Posts: 2,021
Last seen: 24 days, 7 hours
|
Re: Poppies - from Poppyseed to Opium [Re: learysprotoge]
#7434542 - 09/21/07 12:14 AM (2 years, 11 months ago) |
|
|
http://www.scienceimage.csiro.au/sio2004/index.cfm?event=site.image.detail&id=2514
CSIRO Plant Industries, in collaboration with Tasmanian Alkaloids, have isolated a small set of genes in morphine-free poppies which behave differently to those in standard morphine-producing poppies.
Norman, the morphine-free poppy produces large amounts of thebaine and oripavine, compounds preferred by the pharmaceutical industry in the production high-value pain-killers. The isolated genes are associated with blocking the production of morphine whilst enhancing the plant's ability to produce these compounds. This understanding will help in the development of poppies capable of producing larger yields of these valuable compounds.
--------------------------------------------------
here are a few random things i thought you guys would find interesting.
http://www.spiceadvice.com/brands/spice_islands/our_spices/our_spices.html
click on lemon peels to poppy seeds
then scroll to poppy seeds and on that page it says
Poppy Seeds are tiny nutty-tasting, blue-gray seeds inside capsules on Papaver somniferum, a yellowish-brown opium plant indigenous to the Mediterranean.
Geographical
Sources Poppies are native to Mediterranean regions, India, China, Turkey, and Iran. Today, Holland and Canada are the main producers of poppy seeds.
Traditional
Ethnic
Uses Poppy Seeds are used to flavor breads, cakes, rolls, and cookies in European and Middle Eastern cooking. In Turkey, they are often ground and used in desserts. In India, the seeds are ground and used to thicken sauces. The seeds are also used in noodle, fish, and vegetable dishes in Jewish, German, and Slavic cooking.
Taste and Aroma
Description Poppy Seeds have a slightly nutty aroma and taste.
History/Region of Origin Since antiquity, poppies have symbolized honor. Women in second century Crete cultivated poppy plants for opium and Hippocrates suggested opium in medicine. Islamic and Arabian countries used opium as a medicine and narcotic in the sixth century. By the 17th century, Asians used the poppy plant as an opiate. Europeans began trafficking the drug in the 19th century, culminating in the Opium Wars, in which China lost control of the industry. The Greeks used the seeds as flavoring for breads in the second century, and medieval Europeans used them as a condiment with breads.
------------------------------
So the spice island brand poppy seeds in the spice isle actually are opium poppy seeds if anyone has a doubt in their mind. Its also greatly rumored that they are tasmanian strain.
--------------------
|
Lawrence
member
Registered: 08/24/03
Posts: 321
Loc: Canada, Qc
Last seen: 10 days, 8 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#7575825 - 10/30/07 11:32 AM (2 years, 10 months ago) |
|
|
Alot of good informations. awesome . thank yous
|
logancircle
Stranger
Registered: 03/03/06
Posts: 13
Last seen: 2 years, 2 months
|
Re: Poppies - from Poppyseed to Opium [Re: Lawrence]
#7636488 - 11/14/07 07:53 PM (2 years, 9 months ago) |
|
|
Question about WITHDRAWAL. I'm on the habit of making lemon laud each weekend, but around about thursday I feel my skin crawling and sweaty, as well as stomach pains and everything that follows, which I know is withdrawal. ANother thing that I've noticed is at night I wake up and have to use the toilet. When I am back in bed I can't get comfortable--I roll around slapping my arms against the bed like a rag-doll. Anyone ever have this experience?
|
raffytaffy
Stranger
Registered: 11/22/07
Posts: 8
Last seen: 2 years, 5 months
|
Re: Poppies - from Poppyseed to Opium [Re: logancircle]
#7665533 - 11/22/07 04:01 AM (2 years, 9 months ago) |
|
|
Quote:
logancircle said:
Question about WITHDRAWAL. I'm on the habit of making lemon laud each weekend, but around about thursday I feel my skin crawling and sweaty, as well as stomach pains and everything that follows, which I know is withdrawal. ANother thing that I've noticed is at night I wake up and have to use the toilet. When I am back in bed I can't get comfortable--I roll around slapping my arms against the bed like a rag-doll. Anyone ever have this experience?
I think I can help you out here. First and foremost I know personally how annoying not begin able get comfortable can be. Whatever you do, AVOID all antihistamines during withdrawal. They seem to agitate your muscles and nervous system more. Working out a little 1-2 hour before bed can help some. I also found eating foods high in carbs bfre bed ( I know that not a good idea generally ) also helps some. Tylenol for pain and aches seems to help some. Pus make sure you are well hydrated, its ok if you get up to pee at night.
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: raffytaffy]
#7676385 - 11/25/07 01:04 AM (2 years, 9 months ago) |
|
|
Not sure if this topic was Grand-fathered in, so please direct WD questions to Other Drugs Discussion or Off-Topic Discussion.
Now, back to growing. Anyone in the Midwest or Zone 5, I'll be happy to answer any questions.
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
BoulderBoomer
Super Tramp
Registered: 04/24/03
Posts: 342
Loc: Kanchanaburi Province, Th...
Last seen: 3 days, 3 hours
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#7818307 - 12/31/07 10:13 PM (2 years, 8 months ago) |
|
|
I spy two yellow morels in with those pods. lol
--------------------
"We are the music makers, and we are the dreamers of dreams."
-Willy Wonka
Travel & Photo Journals | Whalefish Photography, LLC
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: BoulderBoomer]
#7819141 - 01/01/08 09:08 AM (2 years, 8 months ago) |
|
|
Yep, and an ear of Blue Corn. Only two and half moons til planting season.
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
hazey
Stranger
Registered: 01/20/08
Posts: 2,040
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#7918254 - 01/23/08 02:27 AM (2 years, 7 months ago) |
|
|
haha moons!
--------------------
:-)
|
Gr33nday43
Registered: 01/05/08
Posts: 399
Loc: Kentucky.
Last seen: 5 days, 3 hours
|
Re: Poppies - from Poppyseed to Opium [Re: liveby]
#7976621 - 02/04/08 08:13 AM (2 years, 6 months ago) |
|
|
Nice article wiccan!
That really cleared some things up for me!
|
TODAY
Battletoad
Registered: 09/25/03
Posts: 10,218
Loc: Metropolis City, USA
|
Re: Poppies - from Poppyseed to Opium [Re: Gr33nday43]
#8095622 - 03/03/08 12:59 AM (2 years, 6 months ago) |
|
|
Anybody have any garden pics to share? A friend and I have a little planter box at his house with some lettuce in it that has really been responding to the recent sunshine. No pics though
--------------------
ca'rouse (k-rouz)
intr.v.
To engage in boisterous, drunken merrymaking.
|
can_aroma
Legalize It
Registered: 03/14/08
Posts: 124
Last seen: 1 year, 8 months
|
Re: Poppies - from Poppyseed to Opium [Re: TODAY]
#8154567 - 03/16/08 08:54 PM (2 years, 5 months ago) |
|
|
Can anyone help me please.
I know that the poppies are called:
Papaver somniferum
But I really would like to know the particualr Kinds to look out for as I wish to grow these
|
johnm214
Stranger
Registered: 05/31/07
Posts: 10,070
Loc: Americas
|
Re: Poppies - from Poppyseed to Opium [Re: can_aroma]
#8160662 - 03/18/08 05:30 AM (2 years, 5 months ago) |
|
|
weren't you the guy that asked this somewhere else too?
read
don't worry about types if you don't want to put the legwork into it
Just buy a bunch and grow em out. The standard culinary seeds are reputed to be fine, and are much cheaper than buying special strains. If you aren't planting too much though, check out he shroomery sponsers, it shouldn't set you back too much.
--------------------
"I refuse to leave our children with a debt that they cannot repay, and that means taking responsibility right now, in this administration, for getting our spending under control." Obama Feb. 23, 2009.
Yearly Budget Deficit Tops $1 Trillion Dollars- A First Jul. 2009
|
Konnrade
↑↑↓↓<--><-->BA
Registered: 09/13/05
Posts: 13,820
Loc: LA Suburbs
Last seen: 27 days, 6 hours
|
Re: Poppies - from Poppyseed to Opium [Re: johnm214]
#8164797 - 03/19/08 01:17 AM (2 years, 5 months ago) |
|
|
From my experience though, germination rates can be nearly nil on the seeds you'd buy to use as seasoning, if not completely inviable.
--------------------
I find your lack of faith disturbing
|
h o f m a n n
I think, therefore, I am.
Registered: 05/17/08
Posts: 33
Last seen: 1 year, 7 months
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#8411733 - 05/17/08 03:57 AM (2 years, 3 months ago) |
|
|
I love my beautiful poppies. Thanks for the info.
--------------------
fuxxxorzz
|
h o f m a n n
I think, therefore, I am.
Registered: 05/17/08
Posts: 33
Last seen: 1 year, 7 months
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#8411739 - 05/17/08 04:00 AM (2 years, 3 months ago) |
|
|
I have some Persian White poppies. I don't know if that's just a confusion though.
--------------------
fuxxxorzz
|
dstark
Yes you can but you may Not!
Registered: 02/27/08
Posts: 2,969
Loc: -CamP!ng iN mY Ro.Om- 
Last seen: 2 days, 19 hours
|
Re: Poppies - from Poppyseed to Opium [Re: liveby]
#8411923 - 05/17/08 05:30 AM (2 years, 3 months ago) |
|
|
Saw it before, here! but now want to take another look and the photoes does not work! like not exist, shows icon with X inside!
--------------------
~I Feel  at Home~
.:SanPedro Preparation:.
|
Muse_Inform
Been here before
Registered: 05/19/08
Posts: 8
Loc: SW UK
Last seen: 2 years, 2 months
|
Re: Poppies - from Poppyseed to Opium [Re: dstark]
#8423136 - 05/20/08 05:26 AM (2 years, 3 months ago) |
|
|
Nice to see this thread is still going, It was defiantly the most important source of info for me when I was getting started a couple of years ago having found a remote area covered in flowers. We usually get flowers here from about June 16th, but it looks like it may be a week or so later this year, can't wait...
--------------------
Half the time I don't know what I'm talking about - the rest of the time I keep quiet.
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: Muse_Inform]
#8483870 - 06/04/08 04:50 PM (2 years, 3 months ago) |
|
|
if theres still any questions on weather or not the ice filtering works, i just want to put out there that I've tested it, and it doesn't.
the removed ice is just as potent as the "concentrate"
The best way (and also easiest) is to simply steep grinds in hot (but not boiling water, then let the mess cool in the fridge. THEN filter and press. the sugars and fats fall out of solution before the good stuff as the goop cools. therefore it tends to get filtered out with the grinds.
that cool liquid (finely filtered) is pretty strong, and reduces to a reddish crystalline substance.
One could reduce it for easy storage, or drink it as is.
frankly tho, a horse syringe and tube up the bum is probably the best way. no flavor, no biodegredation.
if one were to reduce it, do so at 65°c on a ceramic pan in the oven.
If one were to want to try smoking it, try hotknifing it in little balls. thats as good as a vape. probably better.
then please report.
--------------------
|
TODAY
Battletoad
Registered: 09/25/03
Posts: 10,218
Loc: Metropolis City, USA
|
Re: Poppies - from Poppyseed to Opium [Re: Mitchnast]
#8485135 - 06/04/08 10:08 PM (2 years, 3 months ago) |
|
|
Quote:
Mitchnast said:
frankly tho, a horse syringe and tube up the bum is probably the best way. no flavor, no biodegredation.
No taste, and most importantly, no nausea or stomach pains.
This is the only way I take poppy. I make putty and dissolve in a few ounces of water, then squirt it up the bum.
--------------------
ca'rouse (k-rouz)
intr.v.
To engage in boisterous, drunken merrymaking.
|
mr_minds_eye
Zombie King of the Fairies
Registered: 01/22/02
Posts: 1,824
Loc: Samsara
Last seen: 7 months, 4 days
|
 Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#8522144 - 06/14/08 01:56 AM (2 years, 2 months ago) |
|
|
Thought this might look nice here. Poppies 
Dr. Duke's
Phytochemical and Ethnobotanical Databases
Papaver somniferum L. - Papaveraceae
Common names: Opium Poppy -- Poppyseed Poppy
[Search the USDA Germplasm database for this species]
--------------------------------------------------------------------------------
Activities
Number of distinct activities for species = 634. [View activities]
--------------------------------------------------------------------------------
List of chemicals
Chemical Part Lo
ppm Hi
ppm Reference
(+)-LAUDANIDINE Fruit 20957
(+)-RETICULINE Fruit 20957
(+)-RETICULINE Latex Exudate 21006
(-)-ALPHA-NARCOTINE Inflorescence 21002
(-)-NARCOTOLINE Inflorescence 21002
(-)-SCOULERINE Latex Exudate 20907
(-)-SCOULERINE Plant DUKE1992A
10-HYDROXYCODEINE Latex Exudate FNF KAP
10-NONACOSANOL Latex Exudate CCO
13-OXOCRYPTOPINE Plant SAN
16-HYDROXYTHEBAINE Plant SAN
20-HYDROXY-TRICOSANYLCYCLOHEXANE Fruit 36 20933
4-HYDROXY-BENZOIC-ACID Pericarp 20901
4-METHYL-NONACOSANE Fruit 3.2 20933
5'-O-DEMETHYLNARCOTINE Plant 20884
5-HYDROXY-3,7-DIMETHOXYPHENANTHRENE Latex Exudate 20897
6-ACTEONLYDIHYDROSANGUINARINE Plant SAN
6-METHYL-CODEINE Fruit ALK
6-METHYL-CODEINE Plant FNF
ACONITASE Latex Exudate 21015
AESCULETIN Pericarp 20901
ALANINE Seed 11780 12637 USD
ALKALOIDS Latex Exudate 50000 250000 WOI
ALLOCRYPTOPINE Plant FNF
ALPHA-LINOLENIC-ACID Seed 1400 5564 USD
ALPHA-NARCOTINE Plant JBH
APOMORPHINE Plant FNF
APOREINE Fruit ALK
ARABINOSE Fruit WOI
ARACHIDIC-ACID Seed Oil 20983
ARACHIDIC-ACID Seed 1720 1920 WOI
ARGININE Seed 19950 21401 USD
ASCORBIC-ACID Fruit 1120 20927
ASCORBIC-ACID Tissue Culture 21048
ASCORBIC-ACID Seed 0 USD
ASH Seed 65450 75060 USD
ASPARTIC-ACID Seed 22020 23622 USD
BEHENIC-ACID Latex Exudate 21054
BERBERINE Plant FNF
BETA-CAROTENE Seed USD
BETA-SITOSTEROL Fruit 20933
BETA-SITOSTEROL Seed 520 550 GAS
BORON Seed 15 95 BOB
CAFFEIC-ACID Leaf JBH
CAFFEIC-ACID Pericarp 20901
CALCIUM Seed 13807 16214 USD
CAMPESTEROL Seed 200 240 GAS
CANADINE Plant SAN
CAOUTCHOUC Latex Exudate 50000 100000 WOI
CARBOHYDRATES Seed 236900 254130 USD
CATALASE Latex Exudate 21015
CERYL-PALMITATE Latex Exudate WOI
CHOLINE Plant SAN
CHROMIUM Seed 13.4 ABS 5
CITRIC-ACID Latex Exudate WOI
COBALT Seed 0.4 ABS 5
CODAMINE Fruit 20957
CODAMINE Latex Exudate 10 ALK FNF KAP
CODEINE Fruit 400 1320 ALK JBH KAP 20896 20922
CODEINE Tissue Culture 34 200 21022 21038
CODEINE Stem 100 20922
CODEINE Shoot 14 20987 20878
CODEINE Seed 0.1 440 20950 20942 20924 20929 20944
CODEINE Root 100 200 20922
CODEINE Resin, Exudate, Sap 34700 20981
CODEINE Latex Exudate 5000 40000 CCO KAP 20879 20908
CODEINE Gum 35000 20966
CODEINE Leaf 60 430 20987 20922
CODEINE Inflorescence 21002
CODEINE Hypocotyl 20971
CODEINE-N-OXIDE Fruit 50 20917
CODEINE-N-OXIDE Latex Exudate CCO
CODEINONE Plant FNF
COPPER Seed 16 23 USA WOI ABS 5
COPTISINE Leaf 19448
COPTISINE Stem 19448
COPTISINE Seed ALK FNF
COPTISINE Root 19448
COREXIMINE Plant SAN
CORYTUBERINE Plant FNF
COTARNOLINE Fruit 20957
CRYPTOPINE Fruit 20961
CRYPTOPINE Tissue Culture 21049 21035
CRYPTOPINE Gum 1000 20966 20989
CRYPTOPINE Plant ALK CCO
CRYPTOPINE Latex Exudate 21052 20978 21024
CYCLOARTENOL Latex Exudate CCO
CYCLOARTENONE Latex Exudate CCO
CYCLOLAUDENOL Latex Exudate CCO 20883
CYCLOLAUDENONE Latex Exudate CCO
CYSTINE Seed 4530 4859 USD
D-GLUCOSE Plant 20902
D-MANNOHEPTULOSE Fruit CCO
DAUCOSTEROL Fruit 20933
DESMETHYLEPIPORPHYROXINS Plant FNF
DEXTROSE Latex Exudate 27000 33000 WOI
DIASTASE Fruit HHB
DIHYDROPROTOPINE Plant SAN
DIHYDROSANGUINARINE Plant SAN
DIHYDROSANGUINARINE Tissue Culture 21035
DOPA-DECARBOXYLASE Latex Exudate 21015
DOPAMINE Latex Exudate 20973
DOPAMINE Tissue Culture 21049
EMULSIN Fruit HHB
ERYTHRITOL Fruit CCO
FAT Seed 400000 550000 HHB USD
FERULIC-ACID Pericarp 20901
FIBER Seed 58080 71818 USD
FIXED-OIL Plant 20902
FUMARASE Latex Exudate 21015
GADOLEIC-ACID Seed 400 429 USD
GLAUDINE Plant FNF 21045
GLUTAMATE-OXALOACETATE-TRANSAMINASE Latex Exudate 21015
GLUTAMATE-PYRUVATE-TRANSAMINASE Latex Exudate 21015
GLUTAMIC-ACID Seed 45410 48713 USD
GLYCINE Seed 11230 12047 USD
GLYOXYLATE-REDUCTASE Latex Exudate 21015
GNOSCOPINE Fruit ALK FNF
HISTIDINE Seed 5280 5664 USD
HYDROCOTARNINE Fruit ALK FNF
INVERTASE Latex Exudate WOI
IODINE Seed 0.006 WOI
IRON Seed 91 143 USA ABS 5
ISOBOLDINE Latex Exudate ALK HHB
ISOCITRATE-DEHYDROGENASE Latex Exudate 21015
ISOCITRATE-LYASE Latex Exudate 21015
ISOCORYPALMINE Plant HHB
ISOLEUCINE Seed 9050 9708 USD
ISOQUERCITRIN Flower 21064
ISOQUINOLINE Plant 20970
KILOCALORIES Seed 5330 5718 USD
L-DOPA-DECARBOXYLASE Latex Exudate 21012
LACTATE-DEHYDROGENASE Latex Exudate 21015
LACTIC-ACID Latex Exudate 10000 20000 WOI
LANTHOPINE Fruit ALK FNF
LAUDANIDINE Latex Exudate 30 ALK JBH KAP 21006
LAUDANINE Latex Exudate 100 ALK JBH KAP
LAUDANOSINE Fruit ALK JBH
LAUDANOSINE Latex Exudate 20906
LAUDANOSINE Gum 20989
LAURIC-ACID Seed Oil 20983 20962
LAUROLEIC-ACID Seed Oil 20983
LECITHIN Seed 28000 WOI
LEUCINE Seed 14840 15919 USD
LIGNOCERIC-ACID Latex Exudate 21054
LINOLEIC-ACID Latex Exudate 21054
LINOLEIC-ACID Seed Oil 20983 20962
LINOLEIC-ACID Seed 300335 309465 USD
LINOLENOLEIC-ACID Seed Oil 20983
LIPASE Latex Exudate HHB
LYSINE Seed 10990 11789 USD
MAGNESIUM Seed 3148 15600 USA WOI
MAGNOFLORINE Latex Exudate HHB
MALATE-DEHYDROGENASE Latex Exudate 21015
MALIC-ACID Latex Exudate WOI
MALTASE Latex Exudate WOI
MANGANESE Seed 29 68 USA WOI ABS 5
MECONIC-ACID Gum 20989
MECONIC-ACID Latex Exudate 100000 WOI
MECONIDINE Fruit ALK
MECONIN Latex Exudate WOI
MECONINE Latex Exudate 21054
MECONISIN Latex Exudate WOI
METHIONINE Seed 4700 5042 USD
MORPHINE Fruit 150 11200 20968 21031 20974 20918 KAP CCO WOI 21063 20922 21042
MORPHINE Latex Exudate 30000 250000 CCO JBH KAP 21057 21013
MORPHINE Resin, Exudate, Sap 196000 20981
MORPHINE Stem 10 300 20922 WOI
MORPHINE Shoot 39 1000 21031 20968 20987
MORPHINE Seed 0.3 390 20950 20942 20920 20929 20944
MORPHINE Root 200 3900 WOI 20922
MORPHINE Plant 900 2000 21063 20968 WOI
MORPHINE Hypocotyl 20971
MORPHINE Inflorescence 21002
MORPHINE Leaf 28 8950 20987 WOI 20922 20987
MORPHINE Gum 115000 20966
MORPHINE-N-OXIDE Fruit 60 20917 20946
MORPHINE-N-OXIDE Latex Exudate CCO
MORPHINE-N-OXIDE Stem 20946
MYO-INOSITOL Fruit CCO
MYRISTIC-ACID Seed Oil 20983 20962
MYRISTOLEIC-ACID Seed Oil 20983
N-METHYL-14-DEACETYLISOPORPHYROXINE Plant JSG
N-METHYL-14-O-DESMETHYLEPIPORPHYROXINE Plant JAD
NARCEINAMIDE Fruit 20961
NARCEINE Fruit 38 20882
NARCEINE Latex Exudate 2000 ALK JBH KAP
NARCEINE Tissue Culture 21025 21048
NARCEINE Gum 20989
NARCEINE-IMIDE Plant SAN 21005
NARCEINONE Fruit 31 20882
NARCERINE Fruit 20 CCO
NARCOTALINE Plant JSG
NARCOTINE Fruit 200 KAP 20961
NARCOTINE Seed 0.8 2300 20950
NARCOTINE Shoot 21047
NARCOTINE Resin, Exudate, Sap 60000 20981
NARCOTINE Latex Exudate 10000 125000 CCO KAP 20935
NARCOTINE Plant 14 20939
NARCOTINE Gum 62500 20966
NARCOTOLINE Fruit ALK JBH 20960
NARCOTOLINE Root 20893
NARCOTOLINE Plant 167 20939
NARCOTOLINE Latex Exudate 21020 21006
NEOPINE Fruit 21061
NEOPINE Latex Exudate 50 ALK JBH KAP
NIACIN Seed 9.2 11 USD
NICOTINIC-ACID Leaf 1000 14726
NONACOSAN-1,8-DIOL Fruit 10 20933
NONACOSAN-1-OL Fruit 20933
NORMORPHINE Plant SAN
NORNARCEINE Plant FNF
NORSANGUINARINE Tissue Culture SAN 21035
NOSCAPINE Gum 20989 20985
NOSCAPINE Resin, Exudate, Sap 20938
NOSCAPINE Plant 20970
NOSCAPINE Latex Exudate 40000 60000 KAP 20913 20941
O-METHYLSOMNIFERINE Inflorescence 20881
OCTACOSAN-1-OL Fruit 20933
OCTADECADIENOIC-ACID Seed 12639
OCTADECENOIC-ACID Seed 12639
OLEIC-ACID Latex Exudate 21054
OLEIC-ACID Seed Oil 20983 20962
OLEIC-ACID Seed 56230 71872 USD
OPIONIN Latex Exudate WOI
OPIUM Latex Exudate 20888
ORIENTALINE Plant SAN
ORIPAVINE Fruit 1000 KAP 21044
OXALIC-ACID Seed 16200 WOI
OXOSANGUINARINE Tissue Culture 21035
OXYCRYPTOPINE Plant FNF
OXYDASE Latex Exudate WOI
OXYDIMORPHINE Plant SAN
OXYMORPHINE Plant FNF
OXYNARCOTINE Fruit ALK FNF
OXYSANGUINARINE Plant SAN
P-COUMARIC-ACID Pericarp 20901
P-VINYL-PHENOL Fruit CCO
PACODINE Plant SAN
PALAUDINE Latex Exudate 21006
PALAUDINE Plant FNF
PALMITIC-ACID Latex Exudate 21054
PALMITIC-ACID Seed Oil 20983 20962
PALMITIC-ACID Seed 38630 46620 USD 12639
PALMITOLEIC-ACID Seed Oil 20983
PALMITOLEIC-ACID Seed 1300 1394 USD
PAPAVERALDINE Latex Exudate 21054
PAPAVERALDINE Plant FNF
PAPAVERAMINE Plant FNF
PAPAVERINE Fruit 20 820 CCO JBH KAP 21001
PAPAVERINE Latex Exudate 5000 10000 KAP 20955
PAPAVERINE Tissue Culture 45 21022 21048
PAPAVERINE Seed 0.2 670 20950
PAPAVERINE Root 20893
PAPAVERINE Resin, Exudate, Sap 4000 20981
PAPAVERINE Plant 20919
PAPAVERINE Gum 7500 20966 20985
PAPAVERRUBINE-C Plant 21045
PAPAVERRUBINE-D Latex Exudate 20907
PAPAVERRUBINE-D Plant 21045
PAPAVERUBINES Plant FNF
PECTIN Latex Exudate WOI
PENTACOSAN-7-ONE Fruit 28.5 20933
PENTOSANS Seed 30000 36000 WOI
PEROXIDASE Latex Exudate 21015
PHENYLALANINE Seed 8820 9461 USD
PHENYLALANINE-DECARBOXYLASE Latex Exudate 21015
PHOSPHORIC-ACID Latex Exudate WOI
PHOSPHORUS Seed 8290 9277 USD
PHYTATE Seed 21890 23290 PHY
PHYTOSTEROLS Seed 890 955 USD
PORPHYROXINE Fruit ALK
POTASSIUM Seed 5250 8179 USA WOI
PROLINE Seed 10620 11392 USD
PROTEASE Latex Exudate WOI
PROTEIN Seed 175256 198532 USD
PROTOPINE Fruit ALK JBH
PROTOPINE Tissue Culture 21035
PSEUDOMORPHINE Plant FNF
PYRROLIDINE Latex Exudate CCO
QUERCETIN-3-GENTIOBIOSIDE Flower 21064
R-RETICULINE Leaf 20987
R-RETICULINE Latex Exudate 20987
R-RETICULINE Sprout Seedling 20928
R-RETICULINE Shoot 20987
RETICULINE Fruit ALK JBH
RETICULINE Latex Exudate 20890
RHOEADINE Fruit ALK FNF
RIBOFLAVIN Seed 1.6 1.93 USD
ROEMERINE Plant FNF
S-RETICULINE Leaf 20987
S-RETICULINE Latex Exudate 20987
S-RETICULINE Shoot 20987
SALICYLATES Seed 0 JAD85:9501
SALUTARIDINE Leaf 20987
SALUTARIDINE Latex Exudate 20987 21006
SALUTARIDINE Shoot 20987
SALUTARIDINE Plant JBH
SALUTARIDINOL Plant FNF
SANGUINARINE Leaf 19448
SANGUINARINE Tissue Culture 20947 20948 20949 20972 21035
SANGUINARINE Stem 19448
SANGUINARINE Root 19448
SANGUINARINE Plant JBH
SEDOHEPTULOSE Fruit CCO
SERINE Seed 9870 10588 USD
SINAPIC-ACID Pericarp 20901
SITOSTEROL Latex Exudate WOI
SODIUM Seed 155 300 USA WOI
SOMNIFERINE Inflorescence 20881
SQUALENE Seed 59 WOI
STEARIC-ACID Latex Exudate 21054
STEARIC-ACID Seed Oil 20983 20962
STEARIC-ACID Seed 5890 8036 USD
STEPHOLIDINE Latex Exudate 20907
STEPHOLIDINE Plant SAN
STIGMASTEROL Seed 50 55 GAS
SUCCINATE-DEHYDROGENASE Latex Exudate 21015
SUCCINIC-ACID Latex Exudate WOI
SULFURIC-ACID Latex Exudate WOI
TARTARIC-ACID Latex Exudate WOI
TETRAHYDROCOLUMBAMINE Latex Exudate 21006
TETRAHYDROPALMATINE Plant 20964
TETRAHYDROPAPAVERINE Plant SAN
THEBAINE Fruit 7800 KAP 21061 21029
THEBAINE Leaf 20987
THEBAINE Inflorescence 21002
THEBAINE Tissue Culture 20 45 21038 21022
THEBAINE Stem 20946
THEBAINE Shoot 20987 21047
THEBAINE Seed 10 410 20950 21001
THEBAINE Root 20995 20893
THEBAINE Resin, Exudate, Sap 17300 20981 20938
THEBAINE Plant 20967 20919
THEBAINE Latex Exudate 1000 25000 CCO JBH KAP 20913
THEBAINE Hypocotyl 20971
THEBAINE Gum 22500 20966 20989 20985
THEBAOL Latex Exudate 21054 20898
THEBAOL Plant KAP
THIAMIN Seed 7.8 9.9 USD
THREONINE Seed 9050 9708 USD
TOCOPHEROLS Seed 200 WOI
TRYPTOPHAN Seed 2550 2735 USD
TYROSINE Seed 6810 7305 USD
TYROSINE-DECARBOXYLASE Latex Exudate 21015
UREASE Latex Exudate WOI
VALINE Seed 12870 13806 USD
VANILLIC-ACID Pericarp 20901
VIT-A Fruit 7.2 20927
VIT-B-6 Seed 4.4 4.7 USD
WATER Seed 62250 73300 USD
WAX Latex Exudate 60000 136000 WOI
XANTHALINE Fruit ALK
ZINC Seed 24 130 USA WOI ABS 5
--------------------
Our quest for discovery fuels our creativity in all fields, not just science. If we reached the end of the line, the human spirit would shrivel and die. But I don't think we will ever stand still: we shall increase in complexity, if not in depth, and shall always be the center on an expanding horizon of possibilities.
-Stephen Hawking
|
mr_minds_eye
Zombie King of the Fairies
Registered: 01/22/02
Posts: 1,824
Loc: Samsara
Last seen: 7 months, 4 days
|
Re: Poppies - from Poppyseed to Opium [Re: TODAY]
#8522157 - 06/14/08 02:02 AM (2 years, 2 months ago) |
|
|
Quote:
TODAY said:
Quote:
Mitchnast said:
frankly tho, a horse syringe and tube up the bum is probably the best way. no flavor, no biodegredation.
No taste, and most importantly, no nausea or stomach pains.
This is the only way I take poppy. I make putty and dissolve in a few ounces of water, then squirt it up the bum.
Take the poppy flour and splash a little apple cider, rice, or red wine/balsamic vinegar on it. Then about 3-5x that in water. Bring up heat on about 3. Don't boil. Then put the heat down to the bare min. Cover it and forget about it for a little while. Pour it through a collander made of mesh. Let it cool. Put a coffee filter in the collander strain and squeeze. Also try not to repeat too often.. Damn now I want some tea.
--------------------
Our quest for discovery fuels our creativity in all fields, not just science. If we reached the end of the line, the human spirit would shrivel and die. But I don't think we will ever stand still: we shall increase in complexity, if not in depth, and shall always be the center on an expanding horizon of possibilities.
-Stephen Hawking
|
someone not me
lives in a van down by the river
Registered: 10/27/07
Posts: 46
Loc: Zone 8
Last seen: 10 months, 16 days
|
Re: Poppies - from Poppyseed to Opium [Re: mr_minds_eye]
#8591263 - 07/03/08 01:31 PM (2 years, 2 months ago) |
|
|
Quote:
Quote:
Mitchnast said:
frankly tho, a horse syringe and tube up the bum is probably the best way. no flavor, no biodegredation.
No taste, and most importantly, no nausea or stomach pains.
This is the only way I take poppy. I make putty and dissolve in a few ounces of water, then squirt it up the bum.
You guys are gay!! LOL!
Seriously, does it work better?? Do you use a dose comparable to tea taken orally?
|
TODAY
Battletoad
Registered: 09/25/03
Posts: 10,218
Loc: Metropolis City, USA
|
Re: Poppies - from Poppyseed to Opium [Re: someone not me]
#8598525 - 07/05/08 10:07 PM (2 years, 2 months ago) |
|
|
I would use the same size dose as a tea dose. It works, and it works pretty quickly. Can be messy if you don't do it right ...
--------------------
ca'rouse (k-rouz)
intr.v.
To engage in boisterous, drunken merrymaking.
|
Wiccan_Seeker
INFJcounselor-idealist
Registered: 02/06/02
Posts: 23,156
Loc: Virgo Supercluster (or b...
Last seen: 5 hours, 23 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: TODAY]
#8600362 - 07/06/08 12:52 PM (2 years, 1 month ago) |
|
|
over 100.000 views and 400 posts 
|
someone not me
lives in a van down by the river
Registered: 10/27/07
Posts: 46
Loc: Zone 8
Last seen: 10 months, 16 days
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#8600398 - 07/06/08 01:03 PM (2 years, 1 month ago) |
|
|
It's a great thread!
|
dstark
Yes you can but you may Not!
Registered: 02/27/08
Posts: 2,969
Loc: -CamP!ng iN mY Ro.Om-
Last seen: 2 days, 19 hours
|
Re: Poppies - from Poppyseed to Opium [Re: someone not me]
#8611752 - 07/09/08 07:45 AM (2 years, 1 month ago) |
|
|
Yes it does^
--------------------
~I Feel at Home~
.:SanPedro Preparation:.
|
dumbfounded1600
Stranger
Registered: 07/29/07
Posts: 2,624
|
Re: Poppies - from Poppyseed to Opium [Re: dstark]
#8746215 - 08/08/08 10:39 PM (2 years, 28 days ago) |
|
|
Log in to view attachment
These Should Make You
1. India
|
dumbfounded1600
Stranger
Registered: 07/29/07
Posts: 2,624
|
|
Log in to view attachment
2. Turkey
|
dumbfounded1600
Stranger
Registered: 07/29/07
Posts: 2,624
|
|
Log in to view attachment
3. Soviet Union
All Info Posted Here is meant for information purposes only. Some parts of the world Even to possess the plant is illegal. Please contact your local law and find out if it's legal or illegal in your area. I'm not responsible for your unwillingness to follow the law.....
|
MarioTrip
since84
Registered: 10/21/07
Posts: 2,207
Loc: 69 w/ you
Last seen: 1 year, 11 months
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#8890383 - 09/07/08 12:50 PM (1 year, 11 months ago) |
|
|
Because opium is water soluble can I do the following to get the most opium to smoke:
1) Dry all the pods.
2) Grind them into fine powder.
3) Simmer the product
4) Filter
5) Evaporate the opium rich water slowly
6) Scrape, and be left with lots of opium to smoke?
This would bypass lancing the pods completely (which doesn't allow for all the opium to seep up anyway).
--------------------
I'm Livin' It, distribute it
The streets are inhibited
By cut throat niggas just like me
that out there getting dividends
|
MarioTrip
since84
Registered: 10/21/07
Posts: 2,207
Loc: 69 w/ you
Last seen: 1 year, 11 months
|
Re: Poppies - from Poppyseed to Opium [Re: MarioTrip]
#8890478 - 09/07/08 01:17 PM (1 year, 11 months ago) |
|
|
Found my answer somewhere else. I read I should lower the pH to 6.5 for maximum results before evaporation
--------------------
I'm Livin' It, distribute it
The streets are inhibited
By cut throat niggas just like me
that out there getting dividends
|
TheBandit
Infidel
Registered: 03/04/08
Posts: 1,642
Last seen: 1 day, 12 hours
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#8894364 - 09/08/08 03:21 AM (1 year, 11 months ago) |
|
|
two questions.
1) Where can I find a reliable, easy indoor tek?
2) Is there anywhere i can go to find out what time of year is best for planting outside?
i would highly appreciate if these questions could be answered, and much thanks in advance.
--------------------
[quote]RogerRabbit said:
Ah, that explains it. Typical know-it-all noob. We get a few thousand just like you register here every year. They try a few grows, fail miserably and then after a few months or one bad trip, go back to sniffing glue, never to be seen again.
We have a basic pf tek that's idiot proof enough for noobs to get fucked up with their friends.
Mycologists on the other hand grow for the love of growing. They want to experiment with various species, substrates, and fruiting environments. They'll move on to isolate strains, attempt hybridization, and in general treat cultivation as an artform, rather than a chore that must be performed as a means to an end. They'll work twice as hard for a ten percent gain, just for the love of perfection. These are the ones who will isolate strains, not the dumb fucks who treat mushrooms as a drug, or even worse, a pathogen, as if mushrooms cause disease.
RR [/quote]
|
RULARGE
Stranger
Registered: 09/15/08
Posts: 1
Last seen: 1 year, 11 months
|
Re: Poppies - from Poppyseed to Opium [Re: liveby]
#8934876 - 09/15/08 07:55 PM (1 year, 11 months ago) |
|
|
An alcohol extraction should be easy to do using the dry poppy heads.
Leave all the rubbish behind.
Have fun
|
teefizzle
Lucy<3me
Registered: 04/19/07
Posts: 10,365
Loc: Blueridge Mountains
|
Re: Poppies - from Poppyseed to Opium [Re: TODAY]
#8935013 - 09/15/08 08:18 PM (1 year, 11 months ago) |
|
|
Quote:
TODAY said:
Quote:
Mitchnast said:
frankly tho, a horse syringe and tube up the bum is probably the best way. no flavor, no biodegredation.
No taste, and most importantly, no nausea or stomach pains.
This is the only way I take poppy. I make putty and dissolve in a few ounces of water, then squirt it up the bum.
Is there any leakage? Wouldn't wanna have to walk around with a wet spot on my jeans.
Liquid has to go somewhere right?
Quote:
RULARGE said:
An alcohol extraction should be easy to do using the dry poppy heads.
Leave all the rubbish behind.
Have fun
that's rubbish
--------------------
Edited by teefizzle (09/15/08 08:20 PM)
|
sniffy
I Love Peyote
Registered: 07/10/08
Posts: 156
Loc: Wales
Last seen: 5 months, 24 days
|
Re: Poppies - from Poppyseed to Opium [Re: teefizzle]
#8948115 - 09/18/08 08:37 AM (1 year, 11 months ago) |
|
|
Are california poppys active?
--------------------
 and = 
|
rldgld
Stranger
Registered: 09/19/08
Posts: 2
Last seen: 1 year, 11 months
|
Re: Poppies - from Poppyseed to Opium [Re: sniffy]
#8953169 - 09/19/08 03:56 AM (1 year, 11 months ago) |
|
|
Hi all, just signed up after realizing what a great source of info this site is. Here's what I'm wondering: Say someone had some poppies that hadn't bloomed yet. They're close, but maybe a week or more away from blooming. If it was going to frost up and snow soon, could those poppy heads be cut out from underneath the pedals and dried? Would there be any latex in them at all, or are they latex free until awhile after they have bloomed and the pedals have fallen off? Thanks in advance for any advice.
|
teefizzle
Lucy<3me
Registered: 04/19/07
Posts: 10,365
Loc: Blueridge Mountains
|
Re: Poppies - from Poppyseed to Opium [Re: rldgld]
#8953180 - 09/19/08 04:00 AM (1 year, 11 months ago) |
|
|
i know for a fact (at least in plants that have pods) that the stems are active from making a batch of stem tea.
you could probably just cover them with a plastic sheet
--------------------
Edited by teefizzle (09/19/08 04:00 AM)
|
TODAY
Battletoad
Registered: 09/25/03
Posts: 10,218
Loc: Metropolis City, USA
|
Re: Poppies - from Poppyseed to Opium [Re: teefizzle]
#8956241 - 09/19/08 09:06 PM (1 year, 11 months ago) |
|
|
Teefizzle. You can spill while administering the dose for sure. When it's in you'll feel like you really need to shit. My advice is lay down on a couch or something where you can elevate your feet. You'll feel pretty sweet in about 20 minutes and should try to hold it in for 1-1.5 hours (until the feeling of needing to shit passes...it will pass). Also, take a dump beforehand. Oh and use warm water. Cold water can be shocking!
--------------------
ca'rouse (k-rouz)
intr.v.
To engage in boisterous, drunken merrymaking.
|
teefizzle
Lucy<3me
Registered: 04/19/07
Posts: 10,365
Loc: Blueridge Mountains
|
Re: Poppies - from Poppyseed to Opium [Re: TODAY]
#8958431 - 09/20/08 12:52 PM (1 year, 11 months ago) |
|
|
hmm, i might actually try this. Guess I'll have to wait till I have some alone time with my turkey baster
--------------------
|
TODAY
Battletoad
Registered: 09/25/03
Posts: 10,218
Loc: Metropolis City, USA
|
Re: Poppies - from Poppyseed to Opium [Re: teefizzle]
#8960001 - 09/20/08 08:09 PM (1 year, 11 months ago) |
|
|
no nausea this way...unless you take too much of course. I can't keep tea or putty in my stomach for more than an hour so I tried the plug tek. Warm water feels pretty good actually
--------------------
ca'rouse (k-rouz)
intr.v.
To engage in boisterous, drunken merrymaking.
|
tripp23
Kratom Freak
Registered: 05/22/08
Posts: 2,158
Loc: Florida, US
Last seen: 2 days, 3 hours
|
Re: Poppies - from Poppyseed to Opium [Re: TODAY]
#8960981 - 09/21/08 12:41 AM (1 year, 11 months ago) |
|
|
how long do poppy seeds take to germinate and sprout???
--------------------
 
Where does the world go when we close our eyes?
Reality is a figment of your imagination, hallucinations are the true visions from god.
|
TODAY
Battletoad
Registered: 09/25/03
Posts: 10,218
Loc: Metropolis City, USA
|
Re: Poppies - from Poppyseed to Opium [Re: tripp23]
#8963587 - 09/21/08 03:24 PM (1 year, 11 months ago) |
|
|
A week or so. Not long. Gotta keep the ground moist the whole time.
--------------------
ca'rouse (k-rouz)
intr.v.
To engage in boisterous, drunken merrymaking.
|
tripp23
Kratom Freak
Registered: 05/22/08
Posts: 2,158
Loc: Florida, US
Last seen: 2 days, 3 hours
|
Re: Poppies - from Poppyseed to Opium [Re: TODAY]
#8963742 - 09/21/08 03:59 PM (1 year, 11 months ago) |
|
|
alrite thanks!
--------------------
Where does the world go when we close our eyes?
Reality is a figment of your imagination, hallucinations are the true visions from god.
|
Mitchnast
Trial by Madness
Registered: 10/28/99
Posts: 8,365
Loc: Okanagan
Last seen: 2 hours, 6 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: teefizzle]
#8970060 - 09/22/08 10:48 PM (1 year, 11 months ago) |
|
|
Quote:
teefizzle said:
Is there any leakage? Wouldn't wanna have to walk around with a wet spot on my jeans.
Liquid has to go somewhere right?
well, don't do too much
only do as much as you can absorb WITHOUT dribbling.
your colon should be able to absorb all the liquid in a few hours, don't trust a fart (I cannot stress this enough) and DON'T go to bed until you know your farting is gas and not fluid.
ANd pace yourself. if you over do it, you'll be vomiting out both ends.
Just don't do it all the time, it's really a SOMETIMES sorta thing anyway.
Like ANY opiate usage, its a "slippery slope"
|
rldgld
Stranger
Registered: 09/19/08
Posts: 2
Last seen: 1 year, 11 months
|
Re: Poppies - from Poppyseed to Opium [Re: Mitchnast]
#8976729 - 09/24/08 03:25 AM (1 year, 11 months ago) |
|
|
Hi again. I'm wondering what you could do with a bunch of poppy leaves besides making a salad. Any advice?
|
backintheriver
Stranger
Registered: 08/21/08
Posts: 504
Last seen: 16 days, 9 hours
|
Re: Poppies - from Poppyseed to Opium [Re: liveby]
#9045806 - 10/08/08 01:47 AM (1 year, 10 months ago) |
|
|
i hear this stuff is addicting.
--------------------
I peeled the wings off a rat today
I saw myself in her as she limped away
That's what I'm afraid of these days
-fear before
|
Konnrade
↑↑↓↓<--><-->BA
Registered: 09/13/05
Posts: 13,820
Loc: LA Suburbs
Last seen: 27 days, 6 hours
|
Re: Poppies - from Poppyseed to Opium [Re: RULARGE]
#9046431 - 10/08/08 07:21 AM (1 year, 10 months ago) |
|
|
Quote:
RULARGE said:
An alcohol extraction should be easy to do using the dry poppy heads.
Leave all the rubbish behind.
Have fun
you have one post, and it's bollocks.
Alcohol dissolves even more unwanted crap than water does.
Don't do that, it's dumb.
--------------------
I find your lack of faith disturbing
|
TheBandit
Infidel
Registered: 03/04/08
Posts: 1,642
Last seen: 1 day, 12 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Konnrade]
#9048945 - 10/08/08 06:56 PM (1 year, 10 months ago) |
|
|
Request Pending: Indoor Tek.
--------------------
[quote]RogerRabbit said:
Ah, that explains it. Typical know-it-all noob. We get a few thousand just like you register here every year. They try a few grows, fail miserably and then after a few months or one bad trip, go back to sniffing glue, never to be seen again.
We have a basic pf tek that's idiot proof enough for noobs to get fucked up with their friends.
Mycologists on the other hand grow for the love of growing. They want to experiment with various species, substrates, and fruiting environments. They'll move on to isolate strains, attempt hybridization, and in general treat cultivation as an artform, rather than a chore that must be performed as a means to an end. They'll work twice as hard for a ten percent gain, just for the love of perfection. These are the ones who will isolate strains, not the dumb fucks who treat mushrooms as a drug, or even worse, a pathogen, as if mushrooms cause disease.
RR [/quote]
|
TODAY
Battletoad
Registered: 09/25/03
Posts: 10,218
Loc: Metropolis City, USA
|
Re: Poppies - from Poppyseed to Opium [Re: TheBandit]
#9060290 - 10/10/08 08:28 PM (1 year, 10 months ago) |
|
|
RE: Indoor Tek
It's SOOOOOOO not worth it, unless it is purely for the love of growing. It would cost 20x what you could buy them for and 10,000x what you could grow them for if you scatter seeds on tilled ground.
--------------------
ca'rouse (k-rouz)
intr.v.
To engage in boisterous, drunken merrymaking.
|
TheBandit
Infidel
Registered: 03/04/08
Posts: 1,642
Last seen: 1 day, 12 hours
|
Re: Poppies - from Poppyseed to Opium [Re: TODAY]
#9060313 - 10/10/08 08:33 PM (1 year, 10 months ago) |
|
|
Quote:
TODAY said:
RE: Indoor Tek
It's SOOOOOOO not worth it, unless it is purely for the love of growing. It would cost 20x what you could buy them for and 10,000x what you could grow them for if you scatter seeds on tilled ground.
and thats cool and all. but i missed my season. so id like to grow them inside. plus, there safe within my own home, whereas knowing passerby could bandit my shit.
--------------------
[quote]RogerRabbit said:
Ah, that explains it. Typical know-it-all noob. We get a few thousand just like you register here every year. They try a few grows, fail miserably and then after a few months or one bad trip, go back to sniffing glue, never to be seen again.
We have a basic pf tek that's idiot proof enough for noobs to get fucked up with their friends.
Mycologists on the other hand grow for the love of growing. They want to experiment with various species, substrates, and fruiting environments. They'll move on to isolate strains, attempt hybridization, and in general treat cultivation as an artform, rather than a chore that must be performed as a means to an end. They'll work twice as hard for a ten percent gain, just for the love of perfection. These are the ones who will isolate strains, not the dumb fucks who treat mushrooms as a drug, or even worse, a pathogen, as if mushrooms cause disease.
RR [/quote]
|
TODAY
Battletoad
Registered: 09/25/03
Posts: 10,218
Loc: Metropolis City, USA
|
Re: Poppies - from Poppyseed to Opium [Re: TheBandit]
#9063071 - 10/11/08 03:09 PM (1 year, 10 months ago) |
|
|
I hear that, but if you just wanted to get high you could do it a lot more efficiently. that's all I'm saying.
Now, to help out. I know that poppies grow in the fall and bloom in the spring. This means that they need 12/12 during the vegetative and 18/6 during the bloom. I think...
--------------------
ca'rouse (k-rouz)
intr.v.
To engage in boisterous, drunken merrymaking.
|
TheBandit
Infidel
Registered: 03/04/08
Posts: 1,642
Last seen: 1 day, 12 hours
|
Re: Poppies - from Poppyseed to Opium [Re: TODAY]
#9064880 - 10/11/08 11:15 PM (1 year, 10 months ago) |
|
|
yeah, or 24/0 in the flowering period. theyre the opposite of mj.
--------------------
[quote]RogerRabbit said:
Ah, that explains it. Typical know-it-all noob. We get a few thousand just like you register here every year. They try a few grows, fail miserably and then after a few months or one bad trip, go back to sniffing glue, never to be seen again.
We have a basic pf tek that's idiot proof enough for noobs to get fucked up with their friends.
Mycologists on the other hand grow for the love of growing. They want to experiment with various species, substrates, and fruiting environments. They'll move on to isolate strains, attempt hybridization, and in general treat cultivation as an artform, rather than a chore that must be performed as a means to an end. They'll work twice as hard for a ten percent gain, just for the love of perfection. These are the ones who will isolate strains, not the dumb fucks who treat mushrooms as a drug, or even worse, a pathogen, as if mushrooms cause disease.
RR [/quote]
|
TODAY
Battletoad
Registered: 09/25/03
Posts: 10,218
Loc: Metropolis City, USA
|
Re: Poppies - from Poppyseed to Opium [Re: TheBandit]
#9096866 - 10/18/08 06:23 PM (1 year, 10 months ago) |
|
|
get some pics if you do it. this would be a cool thing to see.
--------------------
ca'rouse (k-rouz)
intr.v.
To engage in boisterous, drunken merrymaking.
|
TheBandit
Infidel
Registered: 03/04/08
Posts: 1,642
Last seen: 1 day, 12 hours
|
Re: Poppies - from Poppyseed to Opium [Re: TODAY]
#9110265 - 10/21/08 04:53 PM (1 year, 10 months ago) |
|
|
all ima say is....i got some sprouts.
--------------------
[quote]RogerRabbit said:
Ah, that explains it. Typical know-it-all noob. We get a few thousand just like you register here every year. They try a few grows, fail miserably and then after a few months or one bad trip, go back to sniffing glue, never to be seen again.
We have a basic pf tek that's idiot proof enough for noobs to get fucked up with their friends.
Mycologists on the other hand grow for the love of growing. They want to experiment with various species, substrates, and fruiting environments. They'll move on to isolate strains, attempt hybridization, and in general treat cultivation as an artform, rather than a chore that must be performed as a means to an end. They'll work twice as hard for a ten percent gain, just for the love of perfection. These are the ones who will isolate strains, not the dumb fucks who treat mushrooms as a drug, or even worse, a pathogen, as if mushrooms cause disease.
RR [/quote]
|
TODAY
Battletoad
Registered: 09/25/03
Posts: 10,218
Loc: Metropolis City, USA
|
Re: Poppies - from Poppyseed to Opium [Re: TheBandit]
#9111278 - 10/21/08 08:00 PM (1 year, 10 months ago) |
|
|
heh heh
--------------------
ca'rouse (k-rouz)
intr.v.
To engage in boisterous, drunken merrymaking.
|
teefizzle
Lucy<3me
Registered: 04/19/07
Posts: 10,365
Loc: Blueridge Mountains
|
Re: Poppies - from Poppyseed to Opium [Re: TheBandit]
#9112232 - 10/21/08 10:18 PM (1 year, 10 months ago) |
|
|
i hate when people say they dont want sprouts, we dont fucking have sprouts
--------------------
|
khemi
Stranger
Registered: 10/28/08
Posts: 42
|
Re: Poppies - from Poppyseed to Opium [Re: liveby]
#9156395 - 10/29/08 10:53 PM (1 year, 10 months ago) |
|
|
This thread is sweet! A ton of info.. however I was hoping to get some info on how indoor hydroponics cultivation vs outdoor cultivation fairs. What is the turn around time from day one growing outdoors, vs indoors hydroponicaly? The pdf of the posts/pics was great but the time line was a little vague.
|
teefizzle
Lucy<3me
Registered: 04/19/07
Posts: 10,365
Loc: Blueridge Mountains
|
Re: Poppies - from Poppyseed to Opium [Re: khemi]
#9156544 - 10/29/08 11:21 PM (1 year, 10 months ago) |
|
|
www.poppies.org has at least one decent indoor hydroponics grow on the forums
--------------------
|
TODAY
Battletoad
Registered: 09/25/03
Posts: 10,218
Loc: Metropolis City, USA
|
Re: Poppies - from Poppyseed to Opium [Re: teefizzle]
#9158589 - 10/30/08 12:13 PM (1 year, 10 months ago) |
|
|
Attention poppy lovers!
Tis the season for planting. The rains are hitting pretty hard here this weekend for the first time since spring. I just scattered a fuckton of seeds in random places where dirt has been upturned during this past year (mostly by bulldozer/development activity). I hope I can get a decent harvest
--------------------
ca'rouse (k-rouz)
intr.v.
To engage in boisterous, drunken merrymaking.
|
Jayos The Chaos
I Bring Order
Registered: 05/05/08
Posts: 50
Last seen: 1 year, 4 months
|
Re: Poppies - from Poppyseed to Opium [Re: TODAY]
#9159061 - 10/30/08 02:23 PM (1 year, 10 months ago) |
|
|
Indoor growth will require around 20-24 hrs for flowering. Ive done it and you can get pods in about 3 months. About 5 pods per plant should be expected. Im about to start another grow once my grow room opens up.
--------------------
My hands pass through many.
|
TODAY
Battletoad
Registered: 09/25/03
Posts: 10,218
Loc: Metropolis City, USA
|
|
Interesting. What type of light do you use and how many plants? What sized containers? 1 plant per container, or other?
Not really interested in doing it myself but wondering how it works.
--------------------
ca'rouse (k-rouz)
intr.v.
To engage in boisterous, drunken merrymaking.
|
DontGivetheEnd
Health Nut
Registered: 04/26/08
Posts: 47
Loc: Vermont
Last seen: 3 months, 23 days
|
Re: Poppies - from Poppyseed to Opium [Re: TODAY]
#9163098 - 10/31/08 08:24 AM (1 year, 9 months ago) |
|
|
I just started a small patch of poppies (Hopefully) in a secret spot of mine in the forest- of course my two main concerns are that the plants wont get enough sunlight, or that stray bunnies might decide to partake in my plants!  But hopefully that wont happen haha... I planted the seeds about 3-4 days ago, and they haven't germinated yet, though luckily we got some prolonged rain the day after planting.
Anyways, has anyone had any success growing in the woods?
--------------------
"We've all been lied to and turned into slaves without even realizing it. Our forefathers warned us of all this and no one pays attention because they are focused on the bullshit they feed us through the media while they feed us poisons in our food and water, they medicate us and our children so we are complacent and brainwashed without questioning the authorities.... but I feel the time has come for change. People are starting to WAKE UP."
|
TODAY
Battletoad
Registered: 09/25/03
Posts: 10,218
Loc: Metropolis City, USA
|
Re: Poppies - from Poppyseed to Opium [Re: DontGivetheEnd]
#9163870 - 10/31/08 12:59 PM (1 year, 9 months ago) |
|
|
I had a plot I made last year to grow pot in the woods (under some tree canopy, but with scattered sunbreaks) but when I tried to collect rain, it had stopped raining for the season. Anyways, the other day I went up there and planted poppies in the four 12' rows of 1-2' deep turned soil. So, I guess I won't know if it is successful for 5-6 months.
As far as bunnies are concerned, they might eat sprouts (maybe why my plot last year had so few mature plants...not sure) but I live in a place where you can't grow pot plants unless you have an electric fence. Anyways, critters don't like how bitter poppy plants are. I found only 1 plant of mine mutilitated by a critter...I guess it learned its lesson because the rest were untouched. This was in an area where I know there to be both deer and rabbits.
--------------------
ca'rouse (k-rouz)
intr.v.
To engage in boisterous, drunken merrymaking.
|
khemi
Stranger
Registered: 10/28/08
Posts: 42
|
Re: Poppies - from Poppyseed to Opium [Re: TODAY]
#9165774 - 10/31/08 08:43 PM (1 year, 9 months ago) |
|
|
I would really like to learn more on indoor hydroponic cultivation of poppies. Is there any tricks to produce more bulbs? Will growing hydro under a vast amount of cfl's or HID speed up the process/yield larger/higher alkaloid containing pods?
I once had a shit load of them growing in a 3ft potter box till my kitten got in there and killed em all. They were only a few inches tall. That was over 10 years ago. The cat is now dead.
|
khemi
Stranger
Registered: 10/28/08
Posts: 42
|
Re: Poppies - from Poppyseed to Opium [Re: khemi]
#9165827 - 10/31/08 08:57 PM (1 year, 9 months ago) |
|
|
Can someone please hook me up with an invite to poppies. I would be most gracious and could help you with chemistry related matters. =D
|
DontGivetheEnd
Health Nut
Registered: 04/26/08
Posts: 47
Loc: Vermont
Last seen: 3 months, 23 days
|
 Re: Poppies - from Poppyseed to Opium [Re: TODAY]
#9167206 - 11/01/08 09:24 AM (1 year, 9 months ago) |
|
|
Quote:
TODAY said:
I had a plot I made last year to grow pot in the woods (under some tree canopy, but with scattered sunbreaks) but when I tried to collect rain, it had stopped raining for the season. Anyways, the other day I went up there and planted poppies in the four 12' rows of 1-2' deep turned soil. So, I guess I won't know if it is successful for 5-6 months.
As far as bunnies are concerned, they might eat sprouts (maybe why my plot last year had so few mature plants...not sure) but I live in a place where you can't grow pot plants unless you have an electric fence. Anyways, critters don't like how bitter poppy plants are. I found only 1 plant of mine mutilitated by a critter...I guess it learned its lesson because the rest were untouched. This was in an area where I know there to be both deer and rabbits.
Haha that sounds like it should turn out well! And good to hear about the critters not taking a liking to the sprouts, that's the last thing I need! Hopefully my plants will get the sun they need...
--------------------
"We've all been lied to and turned into slaves without even realizing it. Our forefathers warned us of all this and no one pays attention because they are focused on the bullshit they feed us through the media while they feed us poisons in our food and water, they medicate us and our children so we are complacent and brainwashed without questioning the authorities.... but I feel the time has come for change. People are starting to WAKE UP."
|
TODAY
Battletoad
Registered: 09/25/03
Posts: 10,218
Loc: Metropolis City, USA
|
Re: Poppies - from Poppyseed to Opium [Re: khemi]
#9168943 - 11/01/08 06:33 PM (1 year, 9 months ago) |
|
|
Sorry Khemi, I don't know anything about indoor poppies or producing more pods per plant. Maybe topping the main pod would encourage side pods to grow (like MJ) but I've never tried it.
--------------------
ca'rouse (k-rouz)
intr.v.
To engage in boisterous, drunken merrymaking.
|
Jayos The Chaos
I Bring Order
Registered: 05/05/08
Posts: 50
Last seen: 1 year, 4 months
|
Re: Poppies - from Poppyseed to Opium [Re: TODAY]
#9181933 - 11/04/08 12:26 PM (1 year, 9 months ago) |
|
|
Standard T8 flourescent lamps (4 fixtures, 8 lamps) Lamp color 6500k
Growth period of 12 hours on and 12 hours off for about 2 months. Switch to 24 hours on and soon flowers will appear. I havent tried this before but you may be able to cut the pods off and return to 12 hours for more growth and then repeat the cycle. Its worth a try.
Oh yeah, 1 plant per pot and 1-2 gallon pots.
--------------------
My hands pass through many.
|
khemi
Stranger
Registered: 10/28/08
Posts: 42
|
|
Thank you both for your responses.. I was hoping to hear, "You can grow 5 plants in a 5 gallon bubbler" or something even more efficient. 2 gallon pots per plant would take a up great deal of space for what might only be a few dose of end product. This is certainly not sounding like that great of an indoor en devour. Unless you don't mind yielding a dose or two for a few months of work.
|
khemi
Stranger
Registered: 10/28/08
Posts: 42
|
Re: Poppies - from Poppyseed to Opium [Re: khemi]
#9206968 - 11/08/08 02:11 PM (1 year, 9 months ago) |
|
|
So I was eating a poppy bagel over some peat pellets and rockwool cubes and the seeds fell off and laded on the medium. They sprouted, grew a half an inch, and seem to have stalled. They are in a humidity dome, getting a good spraying twice a day. They seem to have stalled in their growth though. Going on 10 days now and not much happening. Any ideas?
|
TODAY
Battletoad
Registered: 09/25/03
Posts: 10,218
Loc: Metropolis City, USA
|
Re: Poppies - from Poppyseed to Opium [Re: khemi]
#9207037 - 11/08/08 02:24 PM (1 year, 9 months ago) |
|
|
sounds like a made up story, but i would guess they need more root space
--------------------
ca'rouse (k-rouz)
intr.v.
To engage in boisterous, drunken merrymaking.
|
DontGivetheEnd
Health Nut
Registered: 04/26/08
Posts: 47
Loc: Vermont
Last seen: 3 months, 23 days
|
Re: Poppies - from Poppyseed to Opium [Re: TODAY]
#9228987 - 11/12/08 09:59 AM (1 year, 9 months ago) |
|
|
Ok I went and had a look at the area I planted in the forest, there are a large amount of tiny sprouts everywhere, I pulled one up and the roots were shallow and bluish-transparent, so it seems that these are germinated poppy plants. I have a question. Since I planted them in autumn, how will this turn out? Will the plants go dormant and return in spring?
--------------------
"We've all been lied to and turned into slaves without even realizing it. Our forefathers warned us of all this and no one pays attention because they are focused on the bullshit they feed us through the media while they feed us poisons in our food and water, they medicate us and our children so we are complacent and brainwashed without questioning the authorities.... but I feel the time has come for change. People are starting to WAKE UP."
|
Jayos The Chaos
I Bring Order
Registered: 05/05/08
Posts: 50
Last seen: 1 year, 4 months
|
Re: Poppies - from Poppyseed to Opium [Re: DontGivetheEnd]
#9230419 - 11/12/08 03:08 PM (1 year, 9 months ago) |
|
|
Depending on how severe your winters are. If they are severe, they will likely die. If not so bad, they will strengthen from the cold weather and have a head start against competition next spring. Flowering will take place around June-July.
--------------------
My hands pass through many.
|
learysprotoge
Stranger
Registered: 09/12/06
Posts: 494
Last seen: 1 year, 9 months
|
|
you need to till the soil and thin them out or else they wont grow big. fertilizer and compost helps them alot.
I grew them last year I and all my friends really liked them! Especially w/shroooms.
|
DontGivetheEnd
Health Nut
Registered: 04/26/08
Posts: 47
Loc: Vermont
Last seen: 3 months, 23 days
|
Re: Poppies - from Poppyseed to Opium [Re: learysprotoge]
#9237919 - 11/13/08 05:18 PM (1 year, 9 months ago) |
|
|
Hmmm alright....here the winters dont usually get below 15-20 degrees F during the winter nights....we will see how they fare.
--------------------
"We've all been lied to and turned into slaves without even realizing it. Our forefathers warned us of all this and no one pays attention because they are focused on the bullshit they feed us through the media while they feed us poisons in our food and water, they medicate us and our children so we are complacent and brainwashed without questioning the authorities.... but I feel the time has come for change. People are starting to WAKE UP."
|
Jayos The Chaos
I Bring Order
Registered: 05/05/08
Posts: 50
Last seen: 1 year, 4 months
|
Re: Poppies - from Poppyseed to Opium [Re: DontGivetheEnd]
#9264530 - 11/18/08 06:35 AM (1 year, 9 months ago) |
|
|
guluck!
--------------------
My hands pass through many.
|
DontGivetheEnd
Health Nut
Registered: 04/26/08
Posts: 47
Loc: Vermont
Last seen: 3 months, 23 days
|
|
Thanks, I just checked on them they seem the same, looks like the cold has slowed down growth. We will see come springtime.
--------------------
"We've all been lied to and turned into slaves without even realizing it. Our forefathers warned us of all this and no one pays attention because they are focused on the bullshit they feed us through the media while they feed us poisons in our food and water, they medicate us and our children so we are complacent and brainwashed without questioning the authorities.... but I feel the time has come for change. People are starting to WAKE UP."
|
thenewguy05
The Mushroom Man
Registered: 02/11/05
Posts: 2,117
Loc: My Underground Layer
Last seen: 1 month, 4 hours
|
Re: Poppies - from Poppyseed to Opium [Re: DontGivetheEnd]
#9293885 - 11/22/08 09:54 PM (1 year, 9 months ago) |
|
|
i was wondering what color the various strains bleed. i was looking into getting some seeds & i want the ones i buy to bleed red. strength is also something i'm concerned about, naturally i want the strong ones. any help would be greatly appreciated. ~TheNewGuy
|
namaste
RuNnINg OwL
Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 1 day, 15 hours
|
Re: Poppies - from Poppyseed to Opium [Re: thenewguy05]
#9321145 - 11/27/08 09:55 AM (1 year, 9 months ago) |
|
|
These guys generally bleed pink, but I can't for the life of me remember what their common name is. Peonies, maybe? This one looks like it has a little bit of Gig mixed into it.
--------------------
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
thenewguy05
The Mushroom Man
Registered: 02/11/05
Posts: 2,117
Loc: My Underground Layer
Last seen: 1 month, 4 hours
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#9347702 - 12/01/08 11:37 PM (1 year, 8 months ago) |
|
|
i have persian blue & gigantium, i have grown the persians & they bleed white. I think the gigantium bleed white also. i'm still on the hunt for reds, thanks for your input
|
dogear
Stranger
Registered: 07/14/06
Posts: 4
Last seen: 1 year, 6 months
|
Re: Poppies - from Poppyseed to Opium [Re: liveby]
#9463092 - 12/19/08 06:30 PM (1 year, 8 months ago) |
|
|
Growing poppies a no brainer. Rake your soil, scatter some seeds (sparsely), and water. 3 days or so you have sprouts which can be green to purple brown colour.
3 months later you have flowers then pods then Tea :-)
For much more info on opium poppies and the best place to get info is
www.poppies.org ; basically everything you could ever want to know about opium poppies and the dangers of using too much or too often.
Keep your use to no more often than weekends at the most. You have to allow your body to remove the alkaloids which takes about 4 days if I am not mistaken. Stick you what you can grow in your garden. It is really hard to become addicted to a small garden. But gardening can be addictive :-)
|
noobieshroomie
Cheesecake for breakfast
Registered: 07/19/08
Posts: 12,537
Loc: Not Too Sure
|
Re: Poppies - from Poppyseed to Opium [Re: dogear]
#9560315 - 01/06/09 10:37 PM (1 year, 7 months ago) |
|
|
hi guys i have read this whole thread(took like 3 days)
but anyway i had a question,i saw that you can cultivate seeds from the grocery store
and produce fruits that contain opium.
is this still true? or do they treat the seeds with something
that makes them non viable
heres a few pics of the ones i picked up
  
will these seeds still work?
any info would be greatly appreciated
thanks
-noobie-
--------------------
AMU
Best Thread Ever
CapZilla said:
not sure what GE and FAE are but i should probably get some.
Citric said:
Your signature is wrong on colonization temps!
GOOD JUDGMENT COMES FROM EXPERIENCE
EXPERIENCE COMES FROM BAD JUDGMENT
ROOM TEMP 70-75 IS BEST FOR COLONIZATION
Thank you mycochef
|
KBG1977
Solid
Registered: 08/23/08
Posts: 6,005
|
Re: Poppies - from Poppyseed to Opium [Re: noobieshroomie]
#9560352 - 01/06/09 10:42 PM (1 year, 7 months ago) |
|
|
Those are McCormick poppies man,and they will produce potent Tasmanian poppies.They have a 100 percent germination rate,and it seems every seed you plant will sprout.Anybody that has a membership to poppies.org can check out my whole McCormick grow from start to finish.My user name on that site is Br@nd.
--------------------
 
|
noobieshroomie
Cheesecake for breakfast
Registered: 07/19/08
Posts: 12,537
Loc: Not Too Sure
|
Re: Poppies - from Poppyseed to Opium [Re: KBG1977]
#9560482 - 01/06/09 10:59 PM (1 year, 7 months ago) |
|
|
really?
like i said i have read over this whole thread
and there is so much info here it can make your head spin
i read a link that lead me to McCormiks's web site
and looked at the spice section
i got super excited when i found the seeds they sell can produce opium
i will give these a try and see what happens
if it fails i have some Persian whites on stand by
thanks again
-noobie-
--------------------
AMU
Best Thread Ever
CapZilla said:
not sure what GE and FAE are but i should probably get some.
Citric said:
Your signature is wrong on colonization temps!
GOOD JUDGMENT COMES FROM EXPERIENCE
EXPERIENCE COMES FROM BAD JUDGMENT
ROOM TEMP 70-75 IS BEST FOR COLONIZATION
Thank you mycochef
|
KBG1977
Solid
Registered: 08/23/08
Posts: 6,005
|
Re: Poppies - from Poppyseed to Opium [Re: noobieshroomie]
#9562759 - 01/07/09 08:41 AM (1 year, 7 months ago) |
|
|
You won't be disappointed with McCormick's man
--------------------
|
Nonstop_Shroomin
Friend
Registered: 11/03/08
Posts: 124
Last seen: 3 months, 29 days
|
Re: Poppies - from Poppyseed to Opium [Re: liveby]
#9562776 - 01/07/09 08:50 AM (1 year, 7 months ago) |
|
|
Great Stuff. Thanks for the info!
--------------------
This just is and that's okay.
 
|
440ml
Stranger
Registered: 01/01/09
Posts: 21
Last seen: 1 year, 7 months
|
Re: Poppies - from Poppyseed to Opium [Re: KBG1977]
#9562791 - 01/07/09 08:58 AM (1 year, 7 months ago) |
|
|
the store bought seeds have just been washed to remove some of the potency, some say they have a 50% germination rate
around 500 grams of Aussie store bought seed is enough to get a high from the tea, some seed potency may vary so its best to split & consume in 2 batches waiting 1 hour or so between
Edited by 440ml (01/07/09 09:01 AM)
|
KBG1977
Solid
Registered: 08/23/08
Posts: 6,005
|
Re: Poppies - from Poppyseed to Opium [Re: 440ml]
#9562839 - 01/07/09 09:19 AM (1 year, 7 months ago) |
|
|
These are McCormick poppies,and are grown from the exact little spice container of seeds you have in your pic noobieshroomie.I've grown them for years now,and they have never changed on me,which leads me to believe that they have a permanent supplier,and never switch.I have some growing in my garden right now,as well as many other types.I grow them every single year because they are some of the best quality poppies I've ever found   
--------------------
|
noobieshroomie
Cheesecake for breakfast
Registered: 07/19/08
Posts: 12,537
Loc: Not Too Sure
|
Re: Poppies - from Poppyseed to Opium [Re: KBG1977]
#9562880 - 01/07/09 09:34 AM (1 year, 7 months ago) |
|
|
 thanks KBG
nice pics too
man i cant wait for these
-noobie-
--------------------
AMU
Best Thread Ever
CapZilla said:
not sure what GE and FAE are but i should probably get some.
Citric said:
Your signature is wrong on colonization temps!
GOOD JUDGMENT COMES FROM EXPERIENCE
EXPERIENCE COMES FROM BAD JUDGMENT
ROOM TEMP 70-75 IS BEST FOR COLONIZATION
Thank you mycochef
|
KBG1977
Solid
Registered: 08/23/08
Posts: 6,005
|
Re: Poppies - from Poppyseed to Opium [Re: noobieshroomie]
#9562941 - 01/07/09 10:02 AM (1 year, 7 months ago) |
|
|
No problem man,you will be very happy with them,and they will produce 10 or more pods per plantAnd if you keep cutting off the old pods,they will just keep pushing more out.
--------------------
|
Dr. uarewotueat
Peyote Farmer
Registered: 09/02/06
Posts: 16,454
Loc: UK
Last seen: 1 year, 2 hours
|
Re: Poppies - from Poppyseed to Opium [Re: KBG1977]
#9563025 - 01/07/09 10:30 AM (1 year, 7 months ago) |
|
|
i'm sure KBG works for McCormick's 
|
KBG1977
Solid
Registered: 08/23/08
Posts: 6,005
|
|
HAHAHA,no,but I will endorse their seeds for growing;)
--------------------
|
noobieshroomie
Cheesecake for breakfast
Registered: 07/19/08
Posts: 12,537
Loc: Not Too Sure
|
Re: Poppies - from Poppyseed to Opium [Re: KBG1977]
#9563474 - 01/07/09 12:12 PM (1 year, 7 months ago) |
|
|
ok so i planted some seeds today
i put them in ice cube trays to sprout
once they get big enough i will transplant into bigger pots
i put 2-5 seeds in each one
i will update as soon as they sprout
wish me luck
-noobie-
--------------------
AMU
Best Thread Ever
CapZilla said:
not sure what GE and FAE are but i should probably get some.
Citric said:
Your signature is wrong on colonization temps!
GOOD JUDGMENT COMES FROM EXPERIENCE
EXPERIENCE COMES FROM BAD JUDGMENT
ROOM TEMP 70-75 IS BEST FOR COLONIZATION
Thank you mycochef
Edited by noobieshroomie (01/07/09 12:12 PM)
|
KBG1977
Solid
Registered: 08/23/08
Posts: 6,005
|
Re: Poppies - from Poppyseed to Opium [Re: noobieshroomie]
#9563504 - 01/07/09 12:18 PM (1 year, 7 months ago) |
|
|
--------------------
|
chriscreeks
Stranger
Registered: 12/12/08
Posts: 4
Last seen: 1 year, 3 months
|
Re: Poppies - from Poppyseed to Opium [Re: KBG1977]
#9571808 - 01/08/09 05:59 PM (1 year, 7 months ago) |
|
|
thanks this is a bad ass thread!
|
TODAY
Battletoad
Registered: 09/25/03
Posts: 10,218
Loc: Metropolis City, USA
|
Re: Poppies - from Poppyseed to Opium [Re: chriscreeks]
#9590201 - 01/11/09 06:01 PM (1 year, 7 months ago) |
|
|
WEWT.
In October I scattered a fuckton of seeds in soil on some private/public accessible land. Basically, wherever I saw freshly turned over soil (there is construction going on involving bulldozers, backhoes, etc) I scattered some seeds. I just checked the place out for the first time since then and man oh man do I have a lot of lettuce growing
Only problem is that they are right next to the damn road in every place where they took root. Literally, people will be walking only feet away from them. This isn't the most public of lands but there are at least a few people each day that might walk by these patches. Also, the flowers these will produce will definitely stick out and might draw unwanted attention. Last time I saw a poppy in my town it was in a planter box in front of a business downtown where hundreds of people walk by each day...and it never got picked (except by me). Maybe there is hope, maybe not, but I'm do want to get some quality O again this year.
I've got to remember to not use too many seeds next time...I hope natural selection will leave me some bigguns...there's no way I'm thinning these plots (too public).
--------------------
ca'rouse (k-rouz)
intr.v.
To engage in boisterous, drunken merrymaking.
|
KBG1977
Solid
Registered: 08/23/08
Posts: 6,005
|
Re: Poppies - from Poppyseed to Opium [Re: TODAY]
#9590291 - 01/11/09 06:19 PM (1 year, 7 months ago) |
|
|
I think they will be all right,unless somebody has a poppy fetish;)Just let them grow,and see what happens.You think you can take some photos of them for us all to see?
--------------------
|
TODAY
Battletoad
Registered: 09/25/03
Posts: 10,218
Loc: Metropolis City, USA
|
Re: Poppies - from Poppyseed to Opium [Re: KBG1977]
#9590323 - 01/11/09 06:23 PM (1 year, 7 months ago) |
|
|
You know what...I will take some photos. I promise I'll have them up in a couple months when I visit the spot again. They'll probably be in hook stage and maybe even some early flowers by then. But yeah, these sites will be pretty impressive methinks.
Ooohhhh, I also have another site in the way deep woods that I had tried to turn into a pot patch last season but I couldn't collect enough water so had to abandon it. Anyway, there are four rows of nice upturned dirt about 15 feet long that I filled with seed in October as well. I won't visit there for a while though...too long of a hike.
--------------------
ca'rouse (k-rouz)
intr.v.
To engage in boisterous, drunken merrymaking.
|
KBG1977
Solid
Registered: 08/23/08
Posts: 6,005
|
Re: Poppies - from Poppyseed to Opium [Re: TODAY]
#9590924 - 01/11/09 08:25 PM (1 year, 7 months ago) |
|
|
Can't wait to see the pictures man
--------------------
|
RasJeph
Mr. Anon
Registered: 06/23/08
Posts: 2,800
Loc: Upstate NY
Last seen: 7 days, 18 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#9636780 - 01/19/09 10:05 AM (1 year, 7 months ago) |
|
|
Anyone have a nice pictorial like the one by MycoCakeEater that is gone now on page one?
|
Konnrade
↑↑↓↓<--><-->BA
Registered: 09/13/05
Posts: 13,820
Loc: LA Suburbs
Last seen: 27 days, 6 hours
|
Re: Poppies - from Poppyseed to Opium [Re: noobieshroomie]
#9637965 - 01/19/09 02:38 PM (1 year, 7 months ago) |
|
|
Quote:
noobieshroomie said:
ok so i planted some seeds today
i put them in ice cube trays to sprout
once they get big enough i will transplant into bigger pots
i put 2-5 seeds in each one
i will update as soon as they sprout
wish me luck
-noobie-
In my experience it's best not to transplant poppies, as their roots are fragile.
If I was going to transplant them, I would do so by using peat moss pots, which are designed for transplanting. They're made of compressed moss, so you just place the pot in soil to transplant them and the roots grow through... no need to take the plant out of its place and risk harming it.
You can do the same thing with little pots made of newspaper, I've heard.
--------------------
I find your lack of faith disturbing
|
KBG1977
Solid
Registered: 08/23/08
Posts: 6,005
|
Re: Poppies - from Poppyseed to Opium [Re: Konnrade]
#9638242 - 01/19/09 03:27 PM (1 year, 7 months ago) |
|
|
I never have problems transplanting poppies.Here is my poppy growing Technique.First I get my soil mix together,you can use any basic potting soil mix,I use half Florida sand,Horse manure,and regular potting mix.I then fill small pots,or Dixie cups up with the mix.I then water the mix to where it's drenching with water,let it drain,then sprinkle a few poppy seeds in each container.I then put it in the shade for a week,or less,mist it one or more times a day,this isn't necessary if your soil stays moist enough.Within a week you'll have a few sprouts in each pot.Now,this it what I do next,I let them all grow together for a few weeks,until they start on a couple of sets of leaves.Now you can thin/pluck out all the weaker ones,and leave one single best one in each container,then let them grow for another month or so,until they get too big for the containers,then you can space them correctly,and put them in the ground.Another thing I do is instead of plucking out the thinnings,you can gently dig them out with a tooth pics,and either put them in the ground right away,or in other containers,thus not wasting plants,and seeds.I never loose a single plant this way,and the toothpick is gentle enough not to mess up the root system.The advantage to my method of growing poppies is,when you just toss thousands of seeds out in the ground,they produce massive clumps of thousands of plants,that are impossible to thin,and left unthined will grow tiny weak one podded plants,and that's if you're lucky.With my method you get evenly space poppies that will have ample room,and ample root space.i first tried the scattering method with my first poppy grow,and all the plant were so tangled,and fighting for space,that hardly any of the few thousand plants made it to maturity.i got only a few pods from some of the plants that were on the edges of the garden away from the mass.Anyway hope this helps some of you guys out,and happy growing
--------------------
|
Shroomeup
Snipes
Registered: 02/16/07
Posts: 808
|
Re: Poppies - from Poppyseed to Opium [Re: KBG1977]
#9642038 - 01/20/09 12:09 AM (1 year, 7 months ago) |
|
|
^^^Good tips. Sounds exactly like my experience. My technique is now very similar to yours.
|
KBG1977
Solid
Registered: 08/23/08
Posts: 6,005
|
Re: Poppies - from Poppyseed to Opium [Re: Shroomeup]
#9643916 - 01/20/09 08:07 AM (1 year, 7 months ago) |
|
|
Right on man,My poppies suffered a bit of frost damage,and some of the leaves turned purple,but when they start looking better,I'll post some pics
--------------------
|
Konnrade
↑↑↓↓<--><-->BA
Registered: 09/13/05
Posts: 13,820
Loc: LA Suburbs
Last seen: 27 days, 6 hours
|
Re: Poppies - from Poppyseed to Opium [Re: KBG1977]
#9649002 - 01/20/09 11:40 PM (1 year, 7 months ago) |
|
|
My biggest problem has always been getting the buggers to germinate in the first place, followed only by making sure the sprouts get enough sun (lots of tall buildings in the way of direct light).
I suppose I should be taking a more careful approach instead of broadcast sowing, though.
--------------------
I find your lack of faith disturbing
|
2muchTea4ME
Stranger
Registered: 02/03/09
Posts: 28
Last seen: 1 year, 6 months
|
Re: Poppies - from Poppyseed to Opium [Re: liveby]
#9754683 - 02/07/09 02:19 PM (1 year, 6 months ago) |
|
|
superb thanks op
|
RogerRabbit
Bans for Pleasure
Registered: 03/26/03
Posts: 30,196
Loc: USA Mountain Northwest
Last seen: 1 hour, 38 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: 2muchTea4ME]
#9765795 - 02/09/09 03:24 PM (1 year, 6 months ago) |
|
|
Sorry to be asking a question without reading all fifty pages, but does anyone have any experience with deer around the poppies? I know there's some plants they love and some they stay away from. I'd like the poppies to be in a field nearby that isn't fenced to keep the deer out.
RR
--------------------
www.mushroomvideos.com
the preacher man says,
"Sex is a filthy horrible, evil, dirty act, spawned by the devil himself, that you save for the one person you truly love."
|
Juke Adro
I love peach fluff
Registered: 04/05/08
Posts: 5,768
Loc: Inside your head
Last seen: 8 days, 8 hours
|
Re: Poppies - from Poppyseed to Opium [Re: RogerRabbit]
#9770549 - 02/10/09 07:49 AM (1 year, 6 months ago) |
|
|
Copy pasta
I have had a poppy bed for 10yrs, all of a sudden no poppies,do deer eat poppies?all other plants near the poppies are fine, usually if deer eat plants some part of the plant is left, not the case, there is nothing where the poppies were, and it didn't show any signs of digging.any thoughts? as I do love poppies and want to replant them.thanks
Doug says that yes deer do eat poppies but more likely you're identifying a "plant-of-the-year" problem. :-( I find that most years, for whatever reason, the conditions were right for one species of perennials to die off in gardens in the region. One year it might be shasta daisies and everybody is buying shasta to replace the dead ones in the garden. The next year it might be bleeding hearts. So this year could be the year of the poppy.
Or you could have put down too heavy a mulch over top of them and they rotted. (check to see if there's any root left and what condition it's in)
Or a vole could have decided to eat them (similarly you'll see damage there but the majority of the root will be absent)
Or you might have had a thaw-freeze-thaw situation where you had water trapped on the crown of the plant rotting them out (the plant of the year syndrome).
Bottom line - it's hard to say without seeing the actual plant and the conditions in the garden through the winter. (and are you sure they're dead - or just late this year?)
In any case, perennials are long-lived; unfortunately, they are not usually forever. Even the best of plants die in time.
Look at it this way- now you have the opportunity to get some new plants, in a new color or new breeding line. You have a great reason to go shopping for new poppies! :-))
--------------------
Someone said: im actually not using ms, im using prints.
  
|
RogerRabbit
Bans for Pleasure
Registered: 03/26/03
Posts: 30,196
Loc: USA Mountain Northwest
Last seen: 1 hour, 38 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: Juke Adro]
#9782233 - 02/12/09 01:59 AM (1 year, 6 months ago) |
|
|
Quote:
In any case, perennials are long-lived; unfortunately, they are not usually forever. Even the best of plants die in time.
But. . .poppies are annual, not perennial.
I'll find out about the deer, and also how much the bees like them too. I've got ten pounds of white clover and a few million acres with lots of meadows to play in, so I'll just mix the poppy seeds into the clover and spread it out over a few square miles. Hopefully, they don't become an invasive species.
RR
--------------------
www.mushroomvideos.com
the preacher man says,
"Sex is a filthy horrible, evil, dirty act, spawned by the devil himself, that you save for the one person you truly love."
|
Juke Adro
I love peach fluff
Registered: 04/05/08
Posts: 5,768
Loc: Inside your head
Last seen: 8 days, 8 hours
|
Re: Poppies - from Poppyseed to Opium [Re: RogerRabbit]
#9786571 - 02/12/09 08:23 PM (1 year, 6 months ago) |
|
|
Just keep the areas where you plant on your map, they can become a weed after about 2 seasons, bees will come but not anything more than you will notice IMO
--------------------
Someone said: im actually not using ms, im using prints.
|
Ego Death
Justadropofwaterinanendlesssea
Registered: 04/27/03
Posts: 10,447
Loc: The War Machine
|
Re: Poppies - from Poppyseed to Opium [Re: Juke Adro]
#9803678 - 02/15/09 07:37 PM (1 year, 6 months ago) |
|
|
I was told its easy to grow poppies - just chuck the seeds on the ground. Last year I tried in several locations but nothing grew 
Do you guys think it was just a duff batch of seeds?
I've got a private field so I could grow shit loads if I wanted too
Is there a time of year that is best for scattering the seed? The intended field has lots of grass growing in it (regular grass not MJ!)
|
Juke Adro
I love peach fluff
Registered: 04/05/08
Posts: 5,768
Loc: Inside your head
Last seen: 8 days, 8 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Ego Death]
#9803704 - 02/15/09 07:43 PM (1 year, 6 months ago) |
|
|
Maybe the grass is too think and they cant get no light and/or root space IMO they would have sprouted but died.
Try clearing a patch and plant around spring time that's when they get planted over this way.
--------------------
Someone said: im actually not using ms, im using prints.
|
Prof. Astro
acirebma
Registered: 04/15/08
Posts: 4,080
Last seen: 19 days, 2 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Ego Death]
#9803712 - 02/15/09 07:44 PM (1 year, 6 months ago) |
|
|
Start them in cups, there is a tek I posted on vespiary.
Now is a good time.
--------------------
|
Prof. Astro
acirebma
Registered: 04/15/08
Posts: 4,080
Last seen: 19 days, 2 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Prof. Astro]
#9803725 - 02/15/09 07:47 PM (1 year, 6 months ago) |
|
|
I actually have a question regarding legality, how do you interpret them.
It is to my understanding they are legal for purpose other than consumption. As in, you may grow but do not ingest. Sort of like the law Florida has with picking mushrooms, it is not illegal, but drying or consuming after picking is.
--------------------
|
Dr. uarewotueat
Peyote Farmer
Registered: 09/02/06
Posts: 16,454
Loc: UK
Last seen: 1 year, 2 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Prof. Astro]
#9803770 - 02/15/09 08:00 PM (1 year, 6 months ago) |
|
|
so far as i am aware, poppies are pretty much illegal in all forms in the US, except seeds.
look at shroomery policy about trading pods, that pretty much reflects the law.
from memory i believe that there have been cases of people getting busted over there for merely growing poppies.
Quote:
Is there a time of year that is best for scattering the seed?
do it now, if you wait much longer then it will be too late to get good sized plants for this year.
poppy photoperiod is opposite to MJ, they flower as the day length increases rather than decreases.
|
Prof. Astro
acirebma
Registered: 04/15/08
Posts: 4,080
Last seen: 19 days, 2 hours
|
|
Well that's good to know, people should remove those that are visible from the road at least. I don't think helicopters would be looking for them, so anyone who grows would be safe in backyard I think.
--------------------
|
Dr. uarewotueat
Peyote Farmer
Registered: 09/02/06
Posts: 16,454
Loc: UK
Last seen: 1 year, 2 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Prof. Astro]
#9803794 - 02/15/09 08:08 PM (1 year, 6 months ago) |
|
|
i think someone would have to be VERY unlucky to get busted for that.
growing them in conjunction with other ornamental flowers in areas where they are illegal is always a good idea.
|
|
Previous
Index
Next
Threaded
Shop for: 
Edit 
Reply 
Patience Is Key In This Hobby.
