|
Wiccan_Seeker
INFJcounselor-idealist


Registered: 02/06/02
Posts: 20,583
Loc: Virgo Supercluster (or b...
Last seen: 1 hour, 57 minutes
|
Poppies - from Poppyseed to Opium
#4016111 - 04/05/05 07:15 AM (4 years, 7 months ago) |
|
|
Log in to view attachment
The above file is the entire thread until July 25 2006
Poppies - from Poppyseed to Opium.
Okay, Shroomerites, this is an open-and-shut case: As for my second post in this thread: You CUT it, you PASTE it, you PRINT it and ?then- you READ it!
If you have an interest in Poppies, growing pretty flowers and beautiful pods for your floral arrangements or perhaps other poppy pleasures, then this thread is for you!
The next post is about 8 printed pages and it tells you just about everything that is known regarding poppies from seed to opium. Beware that anything beyond culinary use of poppyseed, or sowing culinary poppyseed itself, is a criminal act in many countries. This edited version of a DEA manuscript I?ve found online will blow you away with anything you ever wanted to know about this plant. In case you wonder: yes, it is the viable poppyseed you can find in the supermarket spice rack that the following document is about, so don?t (accidentally or otherwise) break any local laws.
The following document is provided for informational purposes only, be warned that there may be severe laws against poppies and their products where you live, that high dosages of even poppyhead tea can be lethal and that upon slight misuse poppy products are ?very likely- to destroy your life through habituation and addiction. Opium and plant parts containing it are to be considered Hard Drugs, often legally but certainly in their (mis)use.
If you have any information to add that's useful and not covered or detailed by said post, please post it. Let's make this thread The Mother Of All Poppy-Posts 
Please do not post about heroin or synthetics, painkillers or other such shite: this thread is about the Opium Poppy, Papaver Somniferum, and the natural products of this plant that require no chemical treatments nor go beyond Opium. This thread is all about the Poppy! And now, here comes the best poppy-post you ever read in your life, thanks to the DEA and the true ?drug warriors? who have put it online in the public domain!
Edited by Wiccan_Seeker (07/27/06 07:17 AM)
|
Wiccan_Seeker
INFJcounselor-idealist


Registered: 02/06/02
Posts: 20,583
Loc: Virgo Supercluster (or b...
Last seen: 1 hour, 57 minutes
|
Re: Poppies -- from Poppyseed to Opium [Re: Wiccan_Seeker]
#4016118 - 04/05/05 07:16 AM (4 years, 7 months ago) |
|
|
POPPIES -- FROM POPPYSEED TO OPIUM
Opium is the name for the latex produced within the seed pods of the opium poppy, Papaver somniferum. The plant is believed to have evolved from a wild strain, Papaver setigerum, which grows in coastal areas of the Mediterranean Sea. Through centuries of cultivation and breeding for opium, the species somniferum evolved. Today, P. somniferum is the only species of Papaver used to produce opium. Opium contains morphine, codeine, noscapine, papaverine, and thebaine. All but thebaine are used clinically as analgesics to reduce pain without a loss of consciousness. Thebaine is without analgesic effect but is of great pharmaceutical value due to its use in the production of semisynthetic opioid morphine analogues such as oxycodone (Percodan), dihydromorphenone (Dilaudid), and hydrocodone (Vicodin).
The psychological effects of opium may have been known to the ancient Sumerians (circa 4,000 B.C.) whose symbol for poppy was hul, "joy" and gil, "plant". The plant was known in Europe at least 4,000 years ago as evidenced by fossil remains of poppy seed cake and poppy pods found in the Neolithic Swiss Lake Dwellings. Opium was probably consumed by the ancient Egyptians and was known to the Greeks as well. Our word opium is derived from the Greek. The poppy is also referred to in Homer's works the Iliad and the Odyssey (850 B.C.). Hippocrates (460-357 B.C.) prescribed drinking the juice of the white poppy mixed with the seed of nettle.
The opium poppy probably reached China about the fourth century A.D. through Arab traders who advocated its use for medicinal purposes. In Chinese literature, there are earlier references to its use. The noted Chinese surgeon Hua To of the Three Kingdoms (220-264 A.D.) used opium preparations and Cannabis indica for his patients to swallow before undergoing major surgery.
The beginning of widespread opium use in China is associated with the introduction of tobacco smoking in pipes by Dutch from Java in the 17th century. The Chinese mixed Indian opium with the tobacco, two products that were being traded by the Dutch. This practice was adopted throughout the region and predictably resulted in increased opium smoking, both with and without tobacco.
By the late-1700s the British East India Company controlled the prime Indian poppy growing regions and dominated the Asian opium trade. By 1800, they had a monopoly on opium; controlling supply and setting prices.
In 1805, the German pharmacist Friedrich W. Serturner isolated and described the principal alkaloid and powerful active ingredient in opium. He named it morphium after Morpheus, the Greek god of dreams. We know it today as morphine. This event was soon followed by the discovery of other alkaloids of opium: codeine in 1832 and papaverine in 1848. By the 1850s these pure alkaloids, rather than the earlier crude opium preparations, were being commonly prescribed for the relief of pain, cough, and diarrhea. This period also saw the invention and introduction of the hypodermic syringe.
By the late eighteenth century opium was being heavily used in China as a recreational drug. The Imperial court had banned its use and importation but large quantities were still being smuggled into China. In 1839 the Qing Emperor ordered his minister Lin Zexu to address the opium problem. Lin petitioned Queen Victoria for help but was ignored. In reaction, the emperor confiscated 20,000 barrels of opium and detained some foreign traders. The British retaliated by attacking the port city of Canton. Thus the First Opium War began. The Chinese were defeated and the Treaty of Nanjing was signed in 1842. The British required that the opium trade be allowed to continue, that the Chinese pay a large settlement, and that the Chinese cede Hongkong to the British Empire. The Second Opium War began and ended in 1856 over western demands that opium markets be expanded. The Chinese were again defeated and opium importation to China was legalized.
In the United States during the 19th century, opium preparations and 'patent medicines' containing opium extract such as paregoric (camphorated tincture of opium) and laudanum (deodorized opium tincture) became widely available and quite popular. In the 1860s morphine was used extensively pre- and post-operatively as a painkiller for wounded soldiers during the Civil War. Civil War physicians frequently dispensed opiates. In 1866 the Secretary of War stated that during the war the Union Army was issued 10 million opium pills, over 2,840,000 ounces of other opiate preparations (such as laudanum or paregoric), and almost 30,000 ounces of morphine sulphate. The inevitable result was opium addiction, called the 'army disease' or the 'soldier's disease.' These opium and morphine addiction problems prompted a scientific search for potent but nonaddictive painkillers. In the 1870s, chemists synthesized a supposedly non-addictive, substitute for morphine by acetylating morphine. In 1898 the Bayer pharmaceutical company of Germany was the first to make available this new drug, 3,6-diacetylmorphine, in large quantities under the trademarked brand name Heroin. 3,6-diacetylmorphine is two to three times more potent than morphine. Most of the increase is due to its increased lipid solubility, which provides enhanced and rapid central nervous system penetration.
In December 1914, the United States Congress passed the Harrison Narcotics Act which called for control of each phase of the preparation and distribution of medicinal opium, morphine, heroin, cocaine, and any new derivative that could be shown to have similar properties. It made illegal the possession of these controlled substances. The restrictions in the Harrison Act were most recently redefined by the Federal Controlled Substances Act of 1970. The Act lists as a Schedule II Controlled Substance opium and its derivatives and all parts of the P. somniferum plant except the seed.
In 1997, Southeast Asia still accounts for well over half of the world's opium production. It is estimated that the region has the capacity to produce over 2 kT (2.000 metric tons) of Opium annually. The chemical structure of opiates is very similar to that of naturally produced compounds called endorphins and enkephalins. These compounds are derived from an amino acid pituitary hormone called beta-lipotropin which when released is cleaved to form met-enkephalin, gamma-endorphin, and beta-endorphin. Opiate molecules, due to their similar structure, engage many of the endorphins' nerve-receptor sites in the brain's pleasure centers and bring about similar analgesic effects. In the human body, a pain stimulus usually exites an immediate protective reaction followed by the release of endorphins to relieve discomfort and reward the mental learning process. Opiates mimic high levels of endorphins to produce intense euphoria and a heightened state of well-being. Regular use results in increased tolerance and the need for greater quantities of the drug. Profound physical and psychological dependence results from regular use and rapid cessation brings about withdrawal sickness.
In addition to the pleasure/pain centers, there is also a concentration of opiate receptors in the respiratory center of the brain. Opiates have an inhibiting effect on these cells and in the case of an overdose, respiration can come to a complete halt. Opiates also inhibit sensitivity to the impulse to cough.
A third location for these receptors is in the brain's vomiting center. Opiate use causes nausea and vomiting. Tolerance for this effect is built up very quickly. Opiates effect the digestive system by inhibiting intestinal peristalsis. Long before they were used as painkillers, opiates were used to control diarrhea.
The opium poppy, Papaver somniferum, is an annual plant. From a very small round seed, it grows, flowers, and bears fruit (seed pods) only once. The entire growth cycle for most varieties of this plant takes about 120 days. The seeds of P. somniferum can be distinguished from other species by the appearance of a fine secondary fishnet reticulation within the spaces of the coarse reticulation found all over their surface. When compared with other Papaver species, P. somniferum plants will have their leaves arranged along the stem of the plant, rather than basal leaves, and the leaves and stem will be 'glabrous' (hairless). The tiny seeds germinate quickly, given warmth and sufficient moisture. Sprouts appear in fourteen to twenty-one days. In less than six weeks the young plant has grown four large leaves and resembles a small cabbage in appearance. The lobed, dentate leaves are glaucous green with a dull gray or blue tint.
Within sixty days, the plant will grow from one to two feet in height, with one primary, long, smooth stem. The upper portion of this stem is without leaves and is the 'peduncle'. One or more secondary stems, called 'tillers', may grow from the main stem of the plant. Single poppy plants in Southeast Asia often have one or more tillers.
As the plant grows tall, the main stem and each tiller terminates in a flower bud. During the development of the bud, the peduncle portion of the stem elongates and forms a distinctive 'hook' which causes the bud to be turned upside down. As the flower develops, the peduncle straightens and the buds point upward. A day or two after the buds first point upward, the two outer segments of the bud, called 'sepals,' fall away, exposing the flower petals.
Opium poppies generally flower after about ninety days of growth and continue to flower for two to three weeks. The exposed flower blossom is at first crushed and crinkled, but the petals soon expand and become smooth in the sun. Opium poppy flowers have four petals. The petals may be single or double and may be white, pink, reddish purple, crimson red, or variegated. The petals last for two to four days and then drop to reveal a small, round, green fruit which continues to develop. These fruits or pods (also called 'seedpods', 'capsules,' 'bulbs,' or 'poppy heads') are either oblate, elongated, or globular and mature to about the size of a chicken egg. The oblate-shaped pods are more common in Southeast Asia.
The main stem of a fully-matured P. somniferum plant can range between two to five feet in height. The green leaves are oblong, toothed and lobed and are between four to fifteen inches in diameter at maturity. The mature leaves have no commercial value except for use as animal fodder.
Only the pod portion of the plant can produce opium alkaloids. The skin of the poppy pod encloses the wall of the pod ovary. The ovary wall consists of an outer, middle, and inner layer. The plant's latex (opium) is produced within the ovary wall and drains into the middle layer through a system of vessels and tubes within the pod. The cells of the middle layer secrete more than 95 percent of the opium when the pod is scored and harvested.
Cultivators in Mainland Southeast Asia tap the opium from each pod while it remains on the plant. After the opium is scraped, the pods are cut from the stem and allowed to dry. Once dry, the pods are cut open and the seeds are removed and dried in the sun before storing for the following year's planting. An alternative method of collecting planting seeds is to collect them from intentionally unscored pods, because scoring may diminish the quality of the seeds. Aside from being used as planting seed, the poppy seeds may also be used in cooking and in the manufacture of paints and perfumes. Poppy seed oil is straw-yellow in color, odorless, and has a pleasant, almond-like taste. The opium poppy grows best in temperate, warm climates with low humidity. It requires only a moderate amount of water before and during the early stages of growth. In addition, it is a 'long day' photo-responsive plant. As such, it requires long days and short nights before it will develop flowers.
The opium poppy plant can be grown in a variety of soils; clay, sandy loam, sandy, and sandy clay, but it responds best to sandy loam soil. This type of soil has good moisture-retentive and nutrient-retentive properties, is easily cultivated, and has a favorable structure for root development. Clay soil types are hard and difficult to pulverize into a good soil texture. The roots of a young poppy plant cannot readily penetrate clay soils, and growth is inhibited. Sandy soil, by contrast, does not retain sufficient water or nutrients for proper growth of the plant.
Excessive moisture or extremely arid conditions will adversely affect the poppy plant's growth and reduce the alkaloid content. Poppy plants can become waterlogged and die after a heavy rainfall in poorly drained soil. Heavy rainfall in the second and third months of growth can leach alkaloids from the plant and spoil the opium harvest. Dull, rainy, or cloudy weather during this critical growth period may reduce both the quantity and the quality of the alkaloid content.
Opium poppies were widely grown as an ornamental plant and for seeds in the United States until the possession of this plant was declared illegal in the Opium Poppy Control Act of 1942. New generations of plants from the self-sown seed of these original poppies can still be seen in many old ornamental gardens.
The major legal opium poppy growing areas in the world today are in govemment-regulated opium farms in lndia, Turkey and Tasmania, Australia. The major illegal growing areas are in the highlands of Mainland Southeast Asia, specifically Burma (Myanmar), Laos, and Thailand, as well as the adjacent areas of southern China and northwestern Vietnam. The area is known as the 'Golden Triangle'. In Southwest Asia, opium poppies are grown in Pakistan, Iran, and Afghanistan. Opium poppy is also grown in Lebanon, Guatemala, Colombia and Mexico.
The highlands of Mainland Southeast Asia, at elevations of 800 meters or more above sea level, are prime poppy growing areas. Generally speaking, these poppy-farming areas do not require irrigation, fertilizer, or insecticides for successful opium yields.
Most of the opium poppies of Southeast Asia are grown in Burma (Myamnar), specifically in the Wa and Kokang areas which are in the northeastern quadrant of the Shan State of Burma. Laos is the second-largest illicit opium-producing country in Southeast Asia and third-largest in the world.
In Laos, poppy is cultivated extensively in Houaphan and Xiangkhoang Provinces, as well as the six other northern provinces: Bokeo, Louangnamtha, Louangphabang, Oudomxai, Phongsali and Xaignabouli. Poppy is also grown in many of the remote, mountainous areas of northern Thailand, particularly in Chiang Mai, Chiang Rai, Mae Hong Son, Nan and Tak Provinces.
In China, opium poppies are cultivated by ethnic minority groups in the mountainous frontier regions of Yunnan Province, particularly along the border area with Burma's Kachin and Shan States. Son La Province, situated between China and Laos, is a major opium poppy cultivation area in Vietnam, as are Lai Chau and Nghe An Provinces. It is noteworthy that the dominant ethnic groups of Mainland Southeast Asia are not poppy cultivators. The Burmans and Shan of Burma, the Lao of Laos, the Thai of Thailand, the Han Chinese of Yunnan, China, and the Vietnamese of Vietnam are lowlanders and do not traditionally cultivate opium poppies. Rather, it is the ethnic minority highlander groups, such as the Wa, Pa-0, Palaung, Lahu, Lisu, Hmong, and Akha who grow poppies in the highlands of the countries of Southeast Asia. A typical nuclear family of Mainland Southeast Asian highlanders ranges between five and ten persons, including two to five adults. An average household of poppy farmers can cultivate and harvest about one acre of opium poppy per year. Most of the better fields can support opium poppy cultivation for ten years or more without fertilization, irrigation, or insecticides, before the soil is depleted and new fields must be cleared. In choosing a field to grow opium poppy, soil quality and acidity are critical factors and experienced poppy farmers choose their fields carefully. In Southeast Asia, westerly orientations are typically preferred to optimize sun exposure. Most fields are on mountain slopes at elevations of 1,000 meters (3,000 feet) or more above sea level. Slope gradients of 20 degrees to 40 degrees are considered best for drainage of rain water.
In Mainland Southeast Asia, virgin land is prepared by cutting and piling all brush, vines and small trees in the field during March, at the end of the dry season. After allowing the brush to dry in the hot sun for several days, the field is set afire. This method, called 'slash-and burn' or 'swidden' agriculture, is commonly practiced by dry field farmers - both highland and lowland - throughout Mainland Southeast Asia in order to ready the land for a variety of field crops. The slash-and-burn method is also used to clear fields for poppy cultivation. Before the rainy season in April, fields by the hundreds of thousands all over the region are set ablaze. A fog-like yellow haze hangs over the area for weeks, reducing visibility for hundreds of miles. In the mountains, the dense haze blocks out the sun and stings the eyes.
A typical highlander family will plant an area of two or three rai in opium poppy (2.53 rai is equivalent to one acre). In August or September, toward the end of the rainy season, highland farmers in Southeast Asia prepare fields selected for opium poppy planting. By this time, the ash resulting from the burn-off of the previous dry season has settled into the soil, providing additional nutrients, especially potash. The soil is turned with long-handled hoes after it is softened by the rains. The farmers then break up the large clumps of soil. Weeds and stones are tossed aside and the ground is leveled off.
Traditionally, most highland and upland farmers in Southeast Asia do not use fertilizer for any of their crops, including the opium poppy, but in recent years opium poppy farmers have started using both natural and chemical fertilizers to increase opium poppy yields. Chicken manure, human feces or the regions' abundant bat droppings are often mixed into the planting soil before the opium poppy seed is planted.
The planting must be completed by the end of October in order to take advantage of the region's 'long days' in November and December. The opium poppy seed can be sown several ways: broadcast (tossed by hand); or fix-dropped by hand into shallow holes dug with a metal-tipped dibble stick. About one pound of opium poppy seed is needed to sow one acre of land. The seeds may be white, yellow, coffee-color, gray, black, or blue. Seed color is not related to the color of the flower petals. Beans, cabbages, cotton, parsley, spinach, squash and tobacco are crops typically planted with the opium poppy. These crops neither help nor hinder the cultivation of the opium poppy, but are planted for personal consumption or as a cash crop.
In the highlands of Southeast Asia, it is a common practice to plant maize and opium poppies in the same fields each year. The maize keeps down excessive weeds and provides feed for the farmer's pigs and ponies. It is grown from April to August. After harvesting the maize, and with the stalks still standing in the fields, the ground is weeded and pulverized. Just before the end of the rainy season, in successive sowings throughout September and October, the poppy seed is broadcast among the maize stalks. These stalks can protect young opium poppy plants from heavy rains.
The opium poppy plants form leaves in the first growth stage, called the 'cabbage' or 'lettuce' stage. After a month of growth, when the opium poppy is about a foot high, some of the plants are removed (called 'thinning') to allow the other plants more room to grow. The ideal spacing between plants is believed to be 20 to 40 centimeters, or about eight to twelve plants per square meter, although some researchers in northern Thailand have reported as many as 18 plants per square meter.
During the first two months, the opium poppies may be damaged or stunted by nature through the lack of adequate sunshine, excessive rainfall, insects, worms, hail storms, early frost, or trampling by animals. The third month of growth does not require as much care as the first two months. Three to four months after planting, from late December to early February, the opium poppies are in full bloom.
Mature plants range between three to five feet in height. Most opium poppy varieties in Southeast Asia produce three to five mature pods per plant. A typical opium poppy field has 60,000 to 120,000 poppy plants per hectare, with a range of 120,000 to 275,000 opium-producing pods. The actual opium yield will depend largely on weather conditions and the precautions taken by individual farmers to safeguard the crop. The farmer and his family generally move into the field for the final two weeks, setting up a small field hut on the edge of the opium poppy field.
The scoring of the pods (also called 'lancing,' 'incising,' or 'tapping') begins about two weeks after the flower petals fall from the pods. The farmer examines the pod and the tiny crown portion on the top of the pod very carefully before scoring.
The grayish-green pod will become a dark green color as it matures and it will swell in size. If the points of the pod's crown are standing straight out or are curved upward, the pod is ready to be scored. If the crown's points turn downward, the pod is not yet fully matured. Not all the plants in a field will be ready for scoring at the same time and each pod can be tapped more than once.
A set of three or four small blades of iron, glass, or glass splinters bound tightly together on a wooden handle is used to score two or three sides of the pod in a vertical direction. If the blades cut too deep into the wall of the pod, the opium will flow too quickly and will drip to the ground. If the incisions are too shallow, the flow will be too slow and the opium will harden in the pods. A depth of about one millimeter is desired for the incision.
Using a blade-tool designed to cut to that depth, scoring ideally starts in late afternoon so the white raw opium latex can ooze out and slowly coagulate on the surface of the pod overnight. If the scoring begins too early in the afternoon, the sun will cause the opium to coagulate over the incision and block the flow. Raw opium oxidizes, darkens and thickens in the cool night air. Early the next morning, the opium gum is scraped from the surface of the pods with a short-handled, flat, iron blade three to four inches wide.
Opium harvesters work their way backwards across the field scoring the lower, mature pods before the taller pods, in order to avoid brushing up against the sticky pods. The pods continue to produce opium for several days. Farmers will return to these plants - sometimes up to five or six times - to gather additional opium until the pod is totally depleted. The opium is collected in a container which hangs from the farmer's neck or waist.
The opium yield from a single pod varies greatly, ranging from 10 to 100 milligrams of opium per pod. The average yield per pod is about 80 milligrams. The dried opium weight yield per hectare of poppies ranges from eight to fifteen kilograms.
As the farmers gather the opium, they will commonly tag the larger or more productive pods with colored string or yarn. These pods will later be cut from their stems, cut open, dried in the sun and their seeds used for the following year's planting.
The wet opium gum collected from the pods contains a relatively high percentage of water and needs to be dried for several days. High-quality raw opium will be brown (rather than black) in color and will retain its sticky texture. Experienced opium traders can quickly determine if the opium has been adulterated with tree sap, sand, or other such materials. Raw opium in Burma, Laos and Thailand is usually sun-dried, weighed in a standard 1.6 kilogram quantity (called a 'viss' in Burma; a 'choi' in Laos and Thailand), wrapped in banana leaf or plastic and then stored until ready to sell, trade, or smoke. While opium smoking is common among most adult opium poppy farmers, heavy addiction is generally limited to the older, male farmers. The average yearly consumption of cooked opium per smoker is estimated to be 1.6 kilograms.
A typical opium poppy farmer household in Southeast Asia will collect 2 to 5 choi or viss (3 to 9 kilograms) of opium from a year's harvest of a one-acre field. That opium will be dried, wrapped and stacked on a shelf by February or March. If the opium has been properly dried, it can be stored indefinitely. Excessive moisture and heat can cause the opium to deteriorate but, once dried, opium is relatively stable. In fact, as opium dries and becomes less pliable, its value increases due to the decrease in water weight per kilogram.
Before opium is smoked, it is usually 'cooked'. Uncooked opium contains moisture, as well as soil, leaves, twigs, and other impurities which diminish the quality of the final product.
The raw opium collected from the opium poppy pods is placed in an open cooking pot of boiling water where the sticky globs of opium alkaloids quickly dissolve. Soil, twigs, plant scrapings, etc., remain undissolved. The solution is then strained through cheesecloth to remove these impurities. The clear brown liquid that remains is opium in solution, sometimes called 'liquid opium'. This liquid is then re-heated over a low flame until the water is driven off into the air as steam leaving a thick dark brown paste. This paste is called 'prepared', 'cooked', or 'smoking' opium. It is dried in the sun until it has a putty-like consistency. The net weight of the cooked opium is generally only eighty percent that of the original raw opium. Thus, cooked opium is more pure than its original, raw form, and has a higher monetary value.
Cooked opium is suitable for smoking or eating by opium users. Traditionally there is only one group of opium poppy farmers, the Hmong, who prefer not to cook their opium before smoking. Most other ethnic groups, including Chinese opium addicts, prefer smoking cooked opium. Raw or cooked opium contains more than thirty-five different alkaloids, including morphine, which accounts for approximately ten percent of the total raw opium weight.
|
Cloud9
I don't feel,and it feelsgreat



Registered: 07/03/03
Posts: 720
Loc: between here and there
Last seen: 2 months, 12 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#4016136 - 04/05/05 07:24 AM (4 years, 7 months ago) |
|
|
Good info, thx for the post.
--------------------
"Look down on the upside"
|
esin
cheesefondue


Registered: 11/21/01
Posts: 1,275
Loc: Lysergia
Last seen: 1 year, 1 month
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#4016383 - 04/05/05 08:56 AM (4 years, 7 months ago) |
|
|
Great write-up! Thanks! 
One minor correction, the hypothesis that Papaver Somniferum originates from the mediterranean Papaver Setigerum has been disproven.
Quote:
The plant is closely related to opium poppy P. somniferum L. and some authors have treated it as a variety or sub-species of that species. Rouy and Foucand ([13] ) and Bonnier [(12)] listed it as a sub-species in floras dealing with southwestern Europe.
The cytological evidence of a close affinity between P setigerum and P somniferum is discussed by Fulton ([14] ). P. somniferum is diploid ( n=11) and P. setigerum is tetraploid ( n=22) with exactly twice the number of chromosomes. No other species of Papaver is known to have the number n=11 or a multiple of this number. This information indicates that P setigerum is not the wild ancestral species of the cultivated P somniferum, as was formerly believed since a diploid would not be derived from a tetraploid plant.
from: Detection of Morphine in Papaver setigerum DC
|
Wiccan_Seeker
INFJcounselor-idealist


Registered: 02/06/02
Posts: 20,583
Loc: Virgo Supercluster (or b...
Last seen: 1 hour, 57 minutes
|
Re: Poppies -- from Poppyseed to Opium [Re: esin]
#4016453 - 04/05/05 09:24 AM (4 years, 7 months ago) |
|
|
Interesting!
Your paper identifies Morphine as being a significant component of Papaver Setigerum, which means a whole range of opium alkaloids will be present and the dried juice of P.Setigerum can be considered an "Opium" albeit likely an inferior one.
BUT: The Controlled Substances schedules identify it thus:
"Opium poppy" means the plant of the species papaver somniferum L., except the seeds thereof.
This means that if you have a field of Papaver setigerum it is *not* an Opium Poppy field as described by US law, but if you do certain things to it you end up with "a preparation containing morphine" which ofcourse *is* illegal. Since many countries define their controlled substances definitions to the American template, this means that in many countries living plants of Papaver setigerum are *not* Opium Poppies by law because Papaver setigerum is NOT a somniferum.
...strictly speaking a floral arrangement of setigerum bulbs are not "Opium poppy capsules", but setigerum-opium would be a felony:
"Poppy straw" means all parts, except the seeds of the opium poppy, after mowing.
And Opium Poppy, if you recall, is defined as Somniferum only. Looks like a loophole in the US law which is interesting, but in a real court you would ofcourse be unconstitutionally nailed and haled off to prison with a fat mandatory minimum for smartassery.
But if these are the definition of all the lawtext on the topic, then your house could be one huge floral arrangement, your garden a Setigerum field and no *FAIR* judge could condemn you for it.
Edited by Wiccan_Seeker (04/06/05 01:31 PM)
|
MycoCakeEater


Registered: 06/16/03
Posts: 1,483
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#4016672 - 04/05/05 10:29 AM (4 years, 7 months ago) |
|
|
Alright, my turn. 
1. Introduction
The Opium Poppy(Papaver Somniferum) is the worlds most controversial flower. While some use it for the beautiful flowers, others use it for cooking,relive from pain,and best of all,for recreational and spiritual purposes. But beware,as frequent as the use comes, addiction follows. In no way is this drug to be abused, or you may be abused your self by Mother Opium. Opium is both an angel and a demon.Now without delay let the guide begin.
2. A Basic Rundown on the Opium Alkaloids
Opium is made of four main alkaloids morphine, codeine, thebaine and papaverine.About twenty other alkaloids exist in opium but they have little or no significance medically or economically. A number of other "opium alkaloids" are commercial products and are used medically(hydrocodone), but?they are not obtained directly from opium, but by conversion of morphine, codeine and thebaine.
Morphine being the most prevalent, Most raw opium usually has between 8% and 19% of morphine.The second most prevalent, but just as, is Codeine.The codeine content of opium is related inversely to the morphine content but only in a general way. Codeine percentage in opium can range from 1% to over 3%.The third most prevalent are Thebaine & Papaverine. Thebaine is the most poisonous opium alkaloid and is scarcely used medically.However, it is converted into several other products: hydrocodone & oxycodone.Papaverine has a considerable medical use, so much so that supplies available from opium have sometimes run short. It is then manufactured synthetically.
3. Growing
In the United States and Canada, poppy seeds are perfectly legal. This is because, like our very loved mushroom spores, poppy seeds do not actually contain any of the alkaloids that are in the fully-grown poppy plant.You can purchase seeds from many online retailers, gardening stores, hardware stores, and florists.
There are many strains of papaver:
Nigrum - White and purple Opium Poppies that produce whimsical, often peony-like flowers that mature to medium-sized pods of decent yield.
Persian Whites - These Opium Poppies produce gorgeous white flowers, and are considered a "high-yield" strain. They make an excellent addition to any garden, indoors or out.
Tazmanian - Big and beautiful, Tazmanian poppies are one of the largest somniferum strains. Considered by many to be the "best of the best", Tazmanian poppies produce monster-sized pods that produce many seeds with each generation.
Hens and Chicks - A unique pod that is composed of 1 main pod surrounded by 20-30 smaller pods.
Giganthemum- The largest opium poppy pod, size can range from golf ball to baseball sized pods. Yield is VERY good.
For this grow, our strain of choice Giganthemum (these are planted in the late fall in SE US, due to freak weather during weather they were growing but slowly through the winter) 
First we have to start with a few seeds.........

After about 2 weeks you'll see some seedlings like these. Its time to thin guys 

Then after a couple of weeks.....


Now lets fast forward a couple weeks.....




And a few more weeks of an unusual mild winter..........



And now its Spring time, and now they are officially supposed to grow and that they are!................



And now ladies and gents is the poppies as of today (April 05)





Lets say about 2 months from now .............



When the pod is ready to slice...... 

And the final product........... 

Now lets say that smoking opium just isn't your thing.





MCE's Poppy Tea Recipe
Grind pods into a flour with a coffee grinder, put the grounds into your French press. Now boil some water to a rolling boil. Take the water off of the heat and pour into your french press. Put the top on the french press, and push down the strainer so that the poppy straw is 1/3 down in the water. Slowly move it down throughout 10 minutes. Pour, add honey and fresh mint leaves. Enjoy!
All for now.
Be Safe. Be Responsible. Be Happy.
Thanks, MycoCakeEater
|
Wiccan_Seeker
INFJcounselor-idealist


Registered: 02/06/02
Posts: 20,583
Loc: Virgo Supercluster (or b...
Last seen: 1 hour, 57 minutes
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: MycoCakeEater]
#4017039 - 04/05/05 12:08 PM (4 years, 7 months ago) |
|
|
Wow! Just.. -wow- Beautiful photoshoot and a well-illustrated TEK! Now let me take the stick from you and add some more. This installment shall be from my herbal grimoire: LEMON LAUDANUM
Poppyheads contain Opium, because the juice has dried up in the pods. Unfortunately it also contains lots of other constituents which do not help the taste. Now the standard way to extract poppyheads is to make a tea of them. This tastes pretty foul in my opinion and far worse: it negatively affects both potency and richness of the experience, because many alkaloids are stripped from the opium that really ought to be in there. This happens because of heating over 70'C which destroys the Meconic acid which makes the alkaloids more soluble. Meconic acid and Narcotine/noscapine significantly potentiate the Opium without being true narcotics themselves. To remedy the flavor and extract the whole opium into a tasty beverage I have developed my "Lemon Laudanum". Be warned that Lemon Laudanum may be highly illegal, but it truely is highly addictive and not forgiving of overdose.
Firstly a quantity of poppyheads is ground to a powder and mixed well. The strength of this is determined. An oral dosage of standardized opium tends to lie in the range of 1-3 grains which is roughly 50-200mg. This strength is usually contained in 2-10gr ground poppyheads, with 4 grams usually falling between these extremes. Then you know said batch has a given dosage per portion. You could then proceed to make Lemon Laudanum.
LEMON LAUDANUM
water................1/2 liter lemon juice..........1 lemon/oz honey................3 tablespoons ground poppyheads....1 measured dose
1...put the water, honey and lemon juice in an empty 1 liter soda bottle. 2...put this in the refrigerator and chill. 3...add the ground poppyheads and vigorously shake. 4...put this in the refridgerator for at least 2 hours or 12 hours at most.
You can do all this before bedtime and wake up to a laudanum breakfast! It hits you best that way, on a completely empty stomach.
5...pour the liquid through a handkerchief and squeeze the liquid from the "dog", as poppy residue is often called. 6...drink the Lemon Laudanum ice cold and with determination.
It will come on strong rather rapidly on an empty stomach, will plateau after 1-2 hours and lasts the full 8-10 hours.
Once a year or less often I drink my Laudanum, and I've skipped over a year now. Perhaps this year I'll imbide again. You must make it a special occasion. My last occasion was with my mother in 2003, a mere few months before she died, where I showed her the satisfaction of poppies despite her depression. My next occasion will likely be with my best friends to celebrate the coming of the good season, spring or summer. (winters are cold here) It will be a celebration of friendship, chillin' in the forest on a warm day and it will be their first time to meet Opium. They're very experienced Travellers and want to taste the pleasures. Who can blame them. I'm educating them every now and then for months now so they can reconsider their desire to imbide.
A nearby park has a corner with good poppies, so that part's but minor. I could've harvested the shit out of that public patch year after year, or sown culinaries in the forest, but a few bulbs for tea are all you really need if you keep it a harmless pleasure. And if you have nothing to binge on, you won't be able to find yourself craving the Opium after one such binge.
Personally I say: Once a year, or less, or not at all. And for me that works, because i realize that the opposite of that Heaven must be Hell.
|
Wiccan_Seeker
INFJcounselor-idealist


Registered: 02/06/02
Posts: 20,583
Loc: Virgo Supercluster (or b...
Last seen: 1 hour, 57 minutes
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#4017329 - 04/05/05 01:07 PM (4 years, 7 months ago) |
|
|
About lancing pods:
Some years ago AFOAF sowed some poppyseeds. No devious intent, he just wanted to see if it could be done with spicerack poppies. And it -could- be done. Over small lettuces stood a few walnut-sized bulbs on top of gracefully curved stalks.
So to see if it could be done he decided to lance the poppyheads one evening, using a throw-away boxcutter blade. His plan was to score three slits on either side of the pod but ended up doing three slits on one quarter of each pod. His first lancing cut right through the surprisingly thin wall making the juice drip inside the pod.
The second lancing was about right, but the white juice spilled across the blade so he did his subsequent lancings upward instead of downward. Some drops of the juice spilled on the soil.
The other morning the drops on the pods had dried to dark brown ickiness. To see if it could be done he decided to scrape upwards to see if he could catch Opium. There was very little yield, perhaps 5-10 mg off of one pod. Wondering about the taste of Opium he put it to his tongue. It was sharp and VERY bitter.
Then he knew what he wanted to know. He spat out the brown dab, uprooted the plants and put them on his compost heap.
If he had *harvested* then he had grown poppies in the Dutch half-shade (temperate climate) from culinary seeds, gotten two-foot Nigrums with beautiful purplehearted flowers, light-grayish green pods big as walnuts and each of those single pods per plant would have yielded him, I guess, 10-30mg of Opium.
This is the only lancing story I know of:D
|
Cloud9
I don't feel,and it feelsgreat



Registered: 07/03/03
Posts: 720
Loc: between here and there
Last seen: 2 months, 12 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#4017403 - 04/05/05 01:19 PM (4 years, 7 months ago) |
|
|
Great pictorals, helps alot being able to see the life cycle.
--------------------
"Look down on the upside"
|
Locus
Playing With Fire



Registered: 03/11/04
Posts: 5,910
Loc: Deep Inside
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#4018660 - 04/05/05 06:54 PM (4 years, 7 months ago) |
|
|
Wiccan/Myco
--------------------
"Fear is the great barrier to human growth." ~ Dr. Robert Monroe
The important thing is not to stop questioning. Curiosity has its own reason for existing. One cannot help but be in awe when he contemplates the mysteries of eternity, of life, of the marvelous structure of reality. It is enough if one tries merely to comprehend a little of this mystery every day. Never lose a holy curiosity. ~ Albert Einstein
~~~*Dosis sola facit venenum*~~~
*Check my profile to listen to my music*
|
World Spirit



Registered: 07/27/01
Posts: 8,462
Loc: Tibet
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#4019365 - 04/05/05 09:49 PM (4 years, 7 months ago) |
|
|
Wow. Quite a thread!@
|
rocknliam
happy willowdweller


Registered: 12/12/03
Posts: 307
Last seen: 4 months, 8 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: World Spirit]
#4020226 - 04/06/05 02:15 AM (4 years, 7 months ago) |
|
|
Ok, so did i understand correctly, sow seeds at the beggining of winter? In Australia we don't get the frosts or anything, so maybe my cat should grow a little patch, and, he should plant them now. If this is the case he might sow some seeds on friday.
|
Wiccan_Seeker
INFJcounselor-idealist


Registered: 02/06/02
Posts: 20,583
Loc: Virgo Supercluster (or b...
Last seen: 1 hour, 57 minutes
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: World Spirit]
#4020876 - 04/06/05 09:12 AM (4 years, 7 months ago) |
|
|
It's not enough: it never is 
With nothing to do this afternoon I've decided to put it to good use for all of you poppyheads 
For the last four hours printer booklets, stacks of yellowed photocopies, reference books, computer files and internet links have been all over the place and this mayhem on my real and virtual Desktops has resulted in me writing an article for all'a'yall!
The writing was one thing, but zipping a ton of info into an information-dense yet pleasant read quite another. I like to think I succeeded in all these things, but you be the judge. Most of the information you see here is NEW TO THE NET as I took them from assorted offline sources, including books from the 1920s, and have connected dots not connected before. The Shroomery gets the scoop, I'll take it to Erowid later.
So to all you poppyheads out there, sit back and enjoy. If you have printed MycoCakeEater's and my own teks and just ate up the DEA TEK then you definately want to run this through the printer, stacks of info you've never seen before!
Isn't sharing what this community is all about? 
---------------------------------------------------------------------
DUTCH COMMERCIAL POPPY CULTIVATION An informational article by Wiccan_Seeker
INTRODUCTION
The Dutch have got a tradition of commercial Poppy cultivation on their own soil. They are among the few nations that are furthest from the equator, yet still manage to commercially compete in the international poppyseed trade. During the second World War and in the 1950s Holland experimented with extracting Opium alkaloids from harvested Poppy capsules but this has not proven to be economically viable. Holland has significantly taken part in the ?East Indies? (Asian) Opium trade until the 1800s but on its own soil has not engaged in Opium production due to the high cost of labor. Dutch Poppies can produce Opium that is as high in quality as Turkish Opium, the world quality standard, but in significantly lesser amounts per Poppy capsule leading to an overall far smaller yield.
In Holland Poppies are either grown on farmlands of many acres for production of poppyseed, in small patches for semi-commercial production of poppyseed and dried Poppy capsules for floral arrangements and finally in personal garden patches for the beauty of their flowers and capsules as well as for private use of collected Opium and Poppy capsule infusions for inebriating and medicinal uses.
This article will outline the cultivation and harvest characteristics of Papaver somniferum var. ?nigrum? when sown in a cool, temperate climate and will focus on the semi-commercial and private cultivation of smaller patches of Poppies. The information density of this article is unusually high so please read carefully.
This article is written for informational purposes only and the author cannot be held responsible to anything directly or indirectly related or assumed to be related to this text, it?s content or assumed meaning thereof. The information contained herein is a consolidation of multiple offline and online information sources and by no means advocates the breaking of any law. Be warned that many things and acts surrounding the Poppy plant are illegal in many countries and that misuse of Poppy products may cause injury or death, and carries the high probability of physical and psychological addiction. The Poppy has been a grace to many, but the damnation of many more.
THE DUTCH CLIMATE
Dutch Poppies are generally cultivated in the province of Zeeland and the adjacent west part of Brabant, which lie close to the cost and tend to be more moderate in climate then the rest of Holland, as well as one of the major agricultural areas of the small country. Poppies tend to be sown in spring after the last frosts have passed, which is in March to April. As an ?emergency crop? it can be sown as late as early May but then will yield far less poppyseed than is economically viable. Given the life cycle of 120 days the Dutch Poppy-growing season thus stretches out from March until August. If you look at the climatologic statistics for those months in that region you will notice a steady progression from an average temperature of 6?C/43?F at sowing time to 18?C/65?F monthly average temperature at harvest time. During this time this area experiences an even 60-75mm precipitation, which after subtraction of evaporation yields a positive precipitation balance of 10-25mm/month. From March onward the local sun exposure is 110-125-200-200-200-200-125 hours per month respectively. Holland lies in Climate Zone 8 (average annual minimum temperature -12 to -7?C = 10-20?F) while Papaver somniferum is hardy until Hardiness Zone 7 (AAMT -18 to -12?C = 0-10?F) which means that seeds shed in summer and fall will survive the Dutch winters and sprout in spring. All this paints the picture of a cool, wet climate that has little sun exposure but despite this the tough Poppy thrives in Holland to the extent of allowing commercial poppyseed cultivation.
PREPARING THE SOIL AND FERTILIZING
Holland grows annual crops of between 500-10.000 hectares of Poppies, mostly in Zeeland province and western Brabant. Poppies can be grown after many kinds of crops in ?crop rotation? and can be regarded as universal in that respect. The soil needs to be prepared to yield a very fine sowing bed, as the seed is very small and slow to germinate. Many Poppy patches fail because of bad soil structure (crumbly clay) as Poppies prefer a fine, loose soil that drains well. It has been general practice to start out with 8-12 grams of Nitrogen fertilizer per square meter, given at the time of sowing, with Potassium and Phosphorus being added to meet soil analysis. Of particular importance are Nitrogen and Phosphorus.
A convenient way to fertilize small personal patches as practiced in the Third World which is endorsed by the FAO is the use of human urine, which weds the advantages of biological fertilizer with the rapid assimilation and availability of chemical fertilizer. In this virtually odorless practice one adult?s urine of one day is diluted with 5-10 volumes of water and used to fertilize one sq meter for the entire growing season. Trivial as it may seem this corresponds to 14gr of Nitrogen, 1.5gr of Potassium and 1gr of Phosphorus plus trace minerals which is sufficient for an entire season, fully biologic and incapable of harming crops if properly applied. The Nitrogen will be fully bio-available in 1-2 weeks. Urine is acidifying and said fertilization spends 1.5 ounce of lime (calcium carbonate) per sq meter from either the soil or through addition to balance pH.
Recently there has been experimentation to split the fertilization in two doses, one given at sowing time and the second at the onset of flowering. This increases yield and the likeliness of a good crop. For the small patch farmer it can be advantageous to continuously fertilize, but over-fertilization harms and in extreme cases kills the plant.
SEED AND SOWING
The seed is very fine and if fresh it can yield 1.000 seedlings per gram of seed. It is usually treated with TMTD to decontaminate it as fungal diseases are the Poppy?s only serious plagues. Old seed often germinates poorly and seed of poor quality ought to be treated in any case to assure a well-planted field.
The goal is to end up with 30-60 healthy plants per square meter, This tends to lead to smaller plants and smaller capsules then in tropical countries but a greater certainty of a good crop as the space of weak or dying plants is immediately claimed by it?s stronger neighbors which leads to strong Darwinian selection while at the same time it allows for greater cultivation setbacks: the fewer plants will produce more and bigger capsules and the cost of sowing seed is entirely unimportant compared to the yield of a successful crop.
In theory one kilo of poppyseed is entirely sufficient to yield a million poppies on two hectares of farmland, but in practice this amount is impossible to sow out commercially. Therefore commercial growers usually use 2-3 kilos of poppyseed per hectare (0.2-0.3gr/sq meter) and some even go to 0.5gr/sq meter, but in that case thinning is required to avoid yield reduction due to overcrowding. Often the seed is mixed with an inert material (such as white sand) to bulk up the volume for convenient sowing. A particularly advantageous mixture is that of one ounce of poppyseed with five ounces of White Clover. White Clover will shield the germinating Poppies from weeds and in fact fixates Nitrogen from the air to enrich the soil. Poppies are sown when the frost has passed, usually in mid-April but it can even be sowed in early May. The earlier Poppies are sown, the greater the yield will be as optimal sun exposure is preferable. Poppies can take a bit of frost but are fragile to it in the seedling stage. Poppyseed is to be sown very shallowly, if covered at all.
Poppies can be sown in three ways.
The most convenient commercial way is to sow it in rows. Per meter there are three rows and the goal is to get ten to twenty healthy plants per row per square meter to end up with the desired 30-60 plants. This is accomplished by sowing more seeds and once they have come up using a 5-inch wide hoe to isolate plants by weeding perpendicular to the rows. Sowing in rows is the standard commercial way of poppy-farming as all stages in the growth cycle from sowing to harvest can be done with common farming machines instead of the far more expensive manual labor. Sowing in rows is the technique used for the vast commercial multi-hectare poppyfields.
The semi-commercial smaller grower with a substantial patch tends to favor broadcast sowing, where the seed is tossed about widely by hand from a pouch worn around the waist. Broadcast sowing is the technique most often used in the tropical poppyfields and is favored by ?guerilla farmers?, being people who sow in the wild as it is done on the slash-and-burn Opium Poppy fields of Asia.
The third method is highly labor intensive and favored only by private cultivators of very small patches. It basically consists of poking 30-60 shallow holes evenly across a square meter and dropping a few seeds in each hole, sprinkled between the fingers like salt. If you divide a sq meter up into squares of 5x5 or 6x6 inch and sow some seeds in the middle, to leave one plant per square, you have created the ideal growing space for the Commercial Dutch Poppy, the seed of which is the often praised Dutch culinary poppyseed used mostly in baking bread and rolls. Poppies can be grown in pots, indoors or outdoors, as well, it can thrive in throwaway plastic 5oz coffee-cups with a draining hole but best results are obtained from 5-6 inch pots which have the added benefit of measuring out the optimal growing space if put side-by-side in squares.
GUERILLA FARMING
Poppies thrive on disturbed soil and are hardy up to Climate Zone 7, strongly re-seed and on most soils require no fertilizer or watering. This makes them excellently suitable for guerilla farming in most parts of the world. If you look at Guerilla Farming as it is done in western countries (without slash-and-burn methods) then this usually is done in one of two ways.
Broadcast-Prepared is the way most commercial Opium fields and garden patches are created. This is a successful technique that entails raking a piece of soil that supports weeds to both remove the weeds and loosen the soil, and then sowing poppyseed on the seedbed, treading it and leaving to create the next patch. The energy spent in this method is the manual labor of raking, but it yields a high certainty of successful germination. The other method can be called:
Broadcast-Unprepared. This method consists of broadcast-sowing Poppyseed on unraked soil which has not been worked in any way. If the areas are well-colonized (such as grassy meadows) the successful germination rate can shrink to almost zero but on semi-bare ground, sowing before most weeds have come up, germination rates can be quite good. The energy spent in this method is the cost of the additional sowing seed that is required because a successful germination rate of 1% can be considered high. Sowing upon worked farmland or ground disturbed for road construction etc. falls under ?Broadcast-Prepared? and successful germination rates can be very high. Broadcasting and not treading the seed, in the proximity of an ant-hill, often constitutes to feeding the ants because the seeds are 45% oil and high in protein, and the perfect size for an ant to haul off to it?s hill.
A curious device used for poppyseed guerilla farming is the ?poppy-gun?. The ?poppy-gun? consists of a short wide tube (like the inner roll of toiletpaper) closed off on one end with the loose rubber skin of a balloon. Some seed is dropped into it (10 grams still account for 10.000+ viable seeds) the bunch of seeds is grabbed and drawn back through the balloon like a rock in a catapult, and released, so that the seed is flung through the air up to 25 yards like fine buckshot, spreading out more efficiently then can be accomplished through broadcasting.
Be aware that guerilla farming changes the ecosystem where the seeds are introduced and that, unless confined to designated patches, it is disruptive to the local flora which means Broadcast-Unprepared techniques are to be discouraged according to common environmentalist ethics.
HARVESTING
Poppyseed should be allowed to ripen on the plant, which results in the plant wilting and drying while standing in the field. Totally unripe poppyseed of the Nigrum variety is white, then turns purple-red and ripens to a steel-blue color. At this time birds will start to take interest in the capsules and may break them to get to the nutritious seed. Poppyseed ?runs? easily, which means that if a bag or Poppy capsule has a small hole, most or all the seed will run out of it like sand through an hourglass. Bird pecking is detrimental to the harvesting of Poppy capsules as well, and spilled seed will come up as a weed in next year?s crop, causing over-seeding or growing like a weed among the species then planted in the crop rotation program.
The seed should be dried well and kept in the dark on a well-ventilated dry place, preferably in bags of fine cloth, semi-commercial growers often use pillowcases for the purpose awaiting purchase by bakers and herbalist shops.
The Dutch harvest around 80-300 grams of poppyseed per square meter, with a good yield being about 120 grams.
Poppy capsules from Dutch culinary poppies tend to be walnut-sized.
For florist purposes the prettiest poppies are selected and typically there will be 50-200 poppy capsules per square meter, with 100 poppy capsules being average. The poppy capsules are picked when they are dried and bound to bouquets that typically hold 100 capsules. The poppy capsules are picked with stem and sold intact with seeds to not damage the capsule.
For apothecary purposes poppy capsules were gathered in the distant past, and the pharmacopeia dictated they should be gathered with 4 inches/10 cm of stem below the knots and freed of seeds to yield the ?drogery? called Fructus Papaveris Sine Semine (Poppy Capsules without Seeds). The yield of Poppy capsules from Dutch Culinary Poppies lies between 50-200 grams with 100 grams from 100 capsules being typical. If standardized Opium of 10% Morphine content is taken as the standard, then the ripened unincised Poppy capsules contain 0.5-10gr Opium per square meter within them, with 2-4 grams of contained Opium being typical. The poppy straw without the capsules contains one-tenth the concentration of Opium within them, so they are usually discarded.
The alkaloid content of poppy capsules increases as the capsule ripens, then diminishes somewhat as the poppyhead dries out on the stem. Snapping the dried poppy capsules off of their stems is the preferred method of harvesting Poppy products for apothecary purposes in guerilla farming as one can rapidly harvest far more opium equivalents by stem-snapping then through pod-lancing even though gum Opium would be the preferred product.
If for apothecary purposes the poppy capsules are lanced they will yield an Opium which can be as strong as Turkish Opium, but far lesser quantities of it. While the Tropical Poppies on average yield 80mg of Opium per Poppy capsule the Dutch Poppy, mostly because of the poor weather stays far behind that and produces, on average a mere 20mg. Even though far more labor intensive the high density of Poppy capsules per square meter of Dutch Poppies might still yield 1-4 grams of Opium per square meter, two grams on average, which rivals the best poppyfields were it not that the smaller stature of Dutch Poppies and their high sowing density makes it near impossible to lance within a field of them, as treading and brushing against them becomes unavoidable. The resulting lanced poppy capsules still contain significant amounts of Opium but are mostly depleted by the lancing.
HARVESTING SUPERIOR SEED
Poppies both cross-pollinate and self-pollinate to yield capsules and seed. The improvement of Dutch Poppies until now has not been intensive and mostly is done by selection from populations, even though selective pollination has been performed in the past. The Dutch Poppies are not GM because genetic manipulation bears great stigma in especially the health food sector where Dutch poppyseed is highly esteemed for it?s flavor, texture and culinary oil production.
Selection from population is a practice that is even commanded by the Bible as ?saving the best grain for next year?s planting?. Selection criteria vary for the purpose for which they are cultivated. A florist lays emphasis on more, prettier, bigger flowers and an esthetic plant. An Opium gatherer often lays emphasis on fewer but bigger capsules which yield more Opium with less labor involved. A Poppy capsule collector (for florist or apothecary purposes) would lay emphasis on the number of poppies and wants them as well-shaped as possible.
Dutch Culinary Poppies are improved upon criteria that meet the demands of the poppyseed trade. A smaller, tougher plant of reduced biomass which is more resistant to molds and plagues and has superior growth characteristics aimed at providing a healthy crop that yields the highest reliable yield of poppyseed, and it does so by the strategy of more plants with more somewhat smaller capsules, instead of fewer larger plants with fewer but larger capsules.
Dutch Culinary Poppies are ideal for those who are looking for a superior producer strain of poppyseed and walnut sized poppy capsules for florist or apothecary purposes that is improved to give reliably high yields in cooler, less sunny climates.
|
esin
cheesefondue


Registered: 11/21/01
Posts: 1,275
Loc: Lysergia
Last seen: 1 year, 1 month
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#4021290 - 04/06/05 11:09 AM (4 years, 7 months ago) |
|
|
Wow, even more! This needs to go into the Garden FAQ!
EDIT: Oh, I just noticed it is now sticky!
Edited by esin (04/06/05 11:12 AM)
|
Cloud9
I don't feel,and it feelsgreat



Registered: 07/03/03
Posts: 720
Loc: between here and there
Last seen: 2 months, 12 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: esin]
#4037552 - 04/10/05 03:12 PM (4 years, 7 months ago) |
|
|
I got a question about fertilizing, I was gonna water them with a 15-30-15 solution weekly, will it be too much and burn them? Or should I only fertilize every other week?
--------------------
"Look down on the upside"
|
MycoCakeEater


Registered: 06/16/03
Posts: 1,483
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Cloud9]
#4039138 - 04/10/05 10:51 PM (4 years, 7 months ago) |
|
|
When I did a prepared bed of poppies. I just used some good pro-mix w/ blood and bone meal added in. Poppies are very sensitive when young, but when they reach about cabbage size is when they hardy up. I wouldnt go with a weekly fert schedule. Id say more around the lines of once a month.
|
Wiccan_Seeker
INFJcounselor-idealist


Registered: 02/06/02
Posts: 20,583
Loc: Virgo Supercluster (or b...
Last seen: 1 hour, 57 minutes
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Cloud9]
#4041961 - 04/11/05 04:42 PM (4 years, 7 months ago) |
|
|
15-30-15 sounds right, but it must be diluted as directed.
The best thing to do is the piss plan, but if you really want the 153015 then it is best to measure out the correct dose of fert for the entire season. For 15-30-15 you need about two ounce of the pure fertilizer per square meter of poppies. Put this in a bottle. Use that one amount to spread out over the season in any way you see fit, since this on normal soil will not overfertilize. I'd say do it evenly, six portions of fert with each two weeks between them and should it form flowerbuds early, then adding the remainder.
Ideally you should sprinkle 1 ounce of lime (calcium carbonate) per square meter. You do this once. You can repeat the fert growing season after season, but the lime basically does not deplete. Use ONLY this lime if the Nitrogen (the first 15) is not in nitrate form. If it is, or if the fert contains lime, leave it be.
Remember: 2oz fert/sq meter for the WHOLE SEASON!!
Like Myco says: it's best to either use it all two weeks before sowing, or like he suggests, when it cabbages. Seedlings are babies.. you don't feed babies bacon & eggs
Edited by Wiccan_Seeker (04/11/05 04:44 PM)
|
GeoMcCheeseburgers
one-eyed willie



Registered: 07/08/03
Posts: 34,834
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#4047953 - 04/12/05 09:47 PM (4 years, 7 months ago) |
|
|
Quick question. I assume you lance the pods before they open up and flower correct or no?
Also I have a pot that is 12 inches wide and about 13 inches deep. In theory how many total (maxed out) poppies could I grow in this pot if I wanted to push its limits? Thanks a lot guys.
Final question. I have two variety's of seeds. In theory if I was to grow indoors by sunlight through a window only no artificial light what variety would be my best choice? Giganthemum or Persian Whites?
-------------------- cortezthekiller said:
dont you feel fucking special cause your user name is GeoMcCheeseburgers
Edited by mattzdope (04/12/05 09:58 PM)
|
Wiccan_Seeker
INFJcounselor-idealist


Registered: 02/06/02
Posts: 20,583
Loc: Virgo Supercluster (or b...
Last seen: 1 hour, 57 minutes
|
|
Quote:
Quick question. I assume you lance the pods before they open up and flower correct or no?
I don't lance poppies: I on occasion gather floral arrangements from a nearby park 
But to your question: you've got the flowerbuds confused with the pods. The flowerbuds must not be lanced.
You got a seedling, it becomes a "cabbage", the cabbage sends up the peduncle (main stem) and if you're lucky some tillers (secondary stems). These produce upside down flowerbuds, they erect and open and you get the flowers. After the petals fall off the pods, from the heart of the flowers, will grow in size. Ten days after the petals drop you may or may not lance the poppies. If you leave them standing they will dry on the dying plant and the seed ripen into them. Yu may then choose to snap off the dried pods to extract the seed and perhaps keep the seedless pods for poppyhead tea which is as highly addictive as the opium. From sowing to dried pods with ripe seeds 3-4 months pass.
Indoors Persian White would be best as they are smaller. Persians don't "cabbage" but develop fluently into flowering.
Ten plants for that pot would be reeeally pushing it, as you are counting on more growth around the pot then above it. You will have a thick bush growing from a relatively small pot. I'd say put one or two in the center of the pot and the rest around the rim. It's basically like growing a clump in a garden. In the windowsil you might consider one-quart tin cans with holes in the bottoms to really *use* that windowsil-space. One plant per tin can, centered. It takes three growth seasons of growing & selecting the best seeds for the next run to adapt a plant to the place where you're growing it.
You can think of "creating" (rather: selecting) a "Windowsil Poppy" which will then be 1-2ft high and still produce 1-3 walnut-sized pods per quart tin can. You'd want a dwarfed plant which still produces good pods, like the Dutch have done to weed.
Edited by Wiccan_Seeker (04/13/05 06:19 AM)
|
liveby
Wasted For Time


Registered: 06/15/04
Posts: 1,507
Last seen: 2 days, 14 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#4060559 - 04/15/05 08:35 PM (4 years, 7 months ago) |
|
|
hm i wonder if anyone has tried the old fashion 3rd world country way and piss on the garden?
--------------------

http://www.bruceeisner.com/ -Creating a Sensible Culture
|
butterflydawn
lucid dreamer


Registered: 01/25/04
Posts: 1,793
Loc: lost at sea
Last seen: 2 months, 2 days
|
Re: Poppies - from Poppyseed to Opium [Re: liveby]
#4061981 - 04/16/05 09:26 AM (4 years, 7 months ago) |
|
|
very nice thread!
-------------------- lucidal expansion
|
myndreach
philosopher



Registered: 08/07/04
Posts: 2,368
|
Re: Poppies - from Poppyseed to Opium [Re: butterflydawn]
#4095070 - 04/25/05 12:48 PM (4 years, 6 months ago) |
|
|
Great thread. When is a good plantint time for Arizona?
|
Stonerguy
I smoke penis


Registered: 05/29/04
Posts: 5,503
Loc: Lost
|
Re: Poppies - from Poppyseed to Opium [Re: liveby]
#4098211 - 04/26/05 08:42 AM (4 years, 6 months ago) |
|
|
Quote:
liveby said: hm i wonder if anyone has tried the old fashion 3rd world country way and piss on the garden?
It works i think your piss is 90-0-0 Nitrogen up the ass!!! If you do do it dilute yoru piss alot or you will burn the little things.
-------------------- yawn...
SG
|
gobbler
Stranger
Registered: 04/26/05
Posts: 10
Last seen: 4 years, 6 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Stonerguy]
#4103961 - 04/27/05 06:30 PM (4 years, 6 months ago) |
|
|
i heart poppies, how long dfrom the time they open till lancing?
|
Cloud9
I don't feel,and it feelsgreat



Registered: 07/03/03
Posts: 720
Loc: between here and there
Last seen: 2 months, 12 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: gobbler]
#4119906 - 05/01/05 06:05 PM (4 years, 6 months ago) |
|
|
Mine are only about three weeks old and about 2" tall..
--------------------
"Look down on the upside"
|
JaguarWarrior101
ShamanicAlchemist InTraining


Registered: 03/23/05
Posts: 184
Loc: State of Euphoria
Last seen: 3 years, 4 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Cloud9]
#4130461 - 05/03/05 10:51 PM (4 years, 6 months ago) |
|
|
If guerrilla farming has low germination rates, would it be better to grow them in peat pots until germination, and then plant the peat pots?
-------------------- The above post is purely hypothetical, and should not be considered the true thoughts, opinions, or actions of a real life person.
We perceive. This is hard fact. But what we perceive is not a fact of the same kind, because we learn what to perceive.
~Carlos Castaneda
|
JaguarWarrior101
ShamanicAlchemist InTraining


Registered: 03/23/05
Posts: 184
Loc: State of Euphoria
Last seen: 3 years, 4 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: JaguarWarrior101]
#4131246 - 05/04/05 02:33 AM (4 years, 6 months ago) |
|
|
If only the seeds do not contain opium, is there a way or is it worth extracting it from the plant itself after harvest?
-------------------- The above post is purely hypothetical, and should not be considered the true thoughts, opinions, or actions of a real life person.
We perceive. This is hard fact. But what we perceive is not a fact of the same kind, because we learn what to perceive.
~Carlos Castaneda
|
Mykul
Shaman of Analog


Registered: 09/01/04
Posts: 11
Loc: From Seattle to Palm Spri...
Last seen: 3 years, 10 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: JaguarWarrior101]
#4134909 - 05/04/05 09:21 PM (4 years, 6 months ago) |
|
|
I found that if one just cuts the stem of the poppy and then makes the cuts, holding the stem upside down over a liter or so of H2O or even allowing the heads of the poppy to rest just below the surface of the water, one can cut the hard part out completely. The latex mixes well with water and one can go from plant to cooked opium with out the painful task of the harvest. I know you can't harvest as much from one plant as you would if you did give it a couple of days, but if you have plenty of the flowers and was not trying to open your own drug store then this would work just fine. It has worked for me and I learned this in Laos. My mother is Hmong, and although it says most Hmong do not prefer it cooked some do. Just a little tip I picked up in my travels. Plus if you hang them over the water and add a little heat to the water to cause it to steam then the latex will drip into the water and begin the cooking process sooner.
--------------------
|
Iamthewalrus
every evening Idied and everynight I wasreborn


Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 1 month
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: MycoCakeEater]
#4161704 - 05/11/05 12:05 PM (4 years, 6 months ago) |
|
|
wow perfect day to find this thread...I've started some single red tasmanians as well grocery store variety for comparison...and I got pics and am pretty sure thye need some water but I don't wanna over do it obviously...this is only from 1 mornining in the sun...I'll get a pic of the left over seeds in a bit(they are red so looks like seed colour can in cases be in indicitive to flower colour :P and much smaller then grocery store seeds and from a VERY reliable source whos written an amazing guide as well just not sure about the water for now I wanna know how much water to add and if my method for adding water seems adequate(60cc syringe)
I have a horrible fuckin body flu so apologize if I'm not makign sense in anyway...I need 500mg naproxen plus an apple(since that much naproxen can cause ulsers without food, oh and I take effexor which will also contribute to stomach damage if I don't eat with the pill) sitting by my bed for when I wake up just to get up...I'm not used to pouding headaches ick...anyways on with the pics and advice(hopefully)
these first ones were taken when the sun was just about down..so I apologize for the sliht blurriness..I've never taken pics at sundown before



heres the pics of what needs to watered and obviously the 1 dosen't(ironically thats the spice :P)...anyways how much water should I had per lil tray when they get dry like that..I'm assuming I should water, they are around 2" x 2" x 2"...


heres what I was planning on watering very gently with

and I'll update this post with a pic of the seeds I used later on and I apologize again but stomach is burnin so prolly best to get something else in there to avoid stomach problems...last thing I want is an ulcer..so anyways I've been distratced while typing this up so if something don't makes sense since I'm cloudly headed as it is I'll edit that later too
Edited by Iamthewalrus (05/11/05 12:36 PM)
|
Iamthewalrus
every evening Idied and everynight I wasreborn


Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 1 month
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Iamthewalrus]
#4172682 - 05/13/05 08:41 PM (4 years, 6 months ago) |
|
|
I decided to mist lightly for watering instead and when it rains it goes under and old truck hood we got...since its not warm out theres no heat build up and they still get light...pretty sure I see some germination but its VERY hard to tell...the sinle red seeds are like grains of sand...heres the best pic I could get
|
Iamthewalrus
every evening Idied and everynight I wasreborn


Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 1 month
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Iamthewalrus]
#4172704 - 05/13/05 08:48 PM (4 years, 6 months ago) |
|
|
oh and I'll ask starter if I can post the guide he made for me...its the best I've seen so far(no offence or anything hes just pro all the way)
|
Wiccan_Seeker
INFJcounselor-idealist


Registered: 02/06/02
Posts: 20,583
Loc: Virgo Supercluster (or b...
Last seen: 1 hour, 57 minutes
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Iamthewalrus]
#4173830 - 05/14/05 07:38 AM (4 years, 6 months ago) |
|
|
Please post it right here in this thread!
I've had a personal communication the other day where someone told me he had a habit consisting of a daily shot of 100mg extracted hydrocodone. (extracted from 10 Vicodin, quite messy to shoot that)
Said person tried my Lemon Laudanum with 5 grams of ground poppyheads, which he soaked overnight. That morning he drank it down while experiencing physical withdrawal of not having shot his daily hydrocodone.
He ended up being surprised by the strength of the drug's effects. It was not as euphoric as shot hydrocodone but he experienced a strong body high as well as surprisingly strong mental effects.
5gr of poppyheads contains about 75-250mg (1-4 grains) of standardized Opium and is more than i'd recommend a newbie.
Still that its potency impressed someone with a shot 100mg hydrocodone habit shows that Lemon Laudanum (and poppyhead tea) certainly is no laughing matter.
|
Iamthewalrus
every evening Idied and everynight I wasreborn


Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 1 month
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#4174106 - 05/14/05 10:10 AM (4 years, 6 months ago) |
|
|
lol I dunno if I should talk what starter has done or not but I think this is ok...first time he tried edible opium he od'd lol...only funny cause he pulled through ...I love u dude seriously...I would love to have your level of patience and will power 
EDIT: I'm waiting on starters word cause I don't think he made this guide public so I have to respect that he may not want it to be
Edited by Iamthewalrus (05/14/05 02:36 PM)
|
flowstone
blustering

Registered: 01/25/05
Posts: 6,485
Loc: precious
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#4175151 - 05/14/05 03:28 PM (4 years, 6 months ago) |
|
|
not sure if you saw my other thread, I will post my questions here for you.
(quoted from another thread, sorry for the cross reference no one gave me exact answers)
I was wondering if an ever clear extraction of pods would leave anything behind a hot water extraction would not. And vice verse, does pod tea leave actives in the left over straw?
Quoted from W_S:
"This happens because of heating over 70'C which destroys the Meconic acid which makes the alkaloids more soluble. Meconic acid and Narcotine/noscapine significantly potentiate the Opium without being true narcotics themselves."
So a low simmer at less that 70'C is the best way to make pods tea, temperature wise? Could these pods be used again in an everclear laudanum extraction for any effects?
70'C= how close to boiling temp? I always used to get the water hot just before it boils, and then pour it over my pods, but I am thinking a low simmer at or below 70C will be more beneficial.?
and one more ;0
Are you saying a 8 hour cold water soak will get everything a 10 minute simmer will?
-------------------- these long agonizing months without you...have been long and agonizing..
"War Doesn't Decide Who's Right... It Only Decides Who's Left."
|
flowstone
blustering

Registered: 01/25/05
Posts: 6,485
Loc: precious
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#4176968 - 05/15/05 01:13 AM (4 years, 6 months ago) |
|
|
Here is a tek to extract morphine from pods.
Quote:
iceolated smokeables by Ab Strak
fresh pods were freezed, then ground in a blender, with 3 volume equivalents of cold water, and allowed to stand for 1 hour. The resulting goo was stirred, then sifted crudely, to retain the biggest pieces. The filtrate was allowed to stand for 1 hour at room temperature, after which the fairly clear, light brown top layer was decanted into a bottle, which was not to be filled completely. The filter residue was extracted again with water, fractions were combined. The closed bottle was kept still, in a freezer at -5 centigrade until 2/3 of the solution was frozen. The freezing solution was filtrated, after which the ice was discarded. The filtrate was put back in the bottle, and the freezing procedure was repeated. The resulting brown solution was allowed to evaporate on a hot water bath, yielding a brittle brown substance which was potent and tasteful enough to smoke pleasurably.
Hypothesis of the success of the procedure:
The active ingredient, a morphine salt, is highly soluble, even in cold water. Acid or base addition is unnecessary and unwanted because of possible decomposition of the salt, into possibly less soluble constituents.
Heating is unnecessary and unwanted because of possible degradation of saccharides and peptides (inflicted effect explained below), and additional dissolving other unwanted materials, like lipids.
The crystallization of water in the solution forces other molecules than water out of the matrix. Small molecules, like morphine maleate move easily to stay in the liquid phase. Large molecules, like (poly)saccharides and (poly)peptides can not move easily enough, and are included in the ice. An additional effect may be that plant saccharides have a high affinity to water. So, may be, small saccharides are included in the ice as well.
The freezing therefore accomplishes a separation between alkaloids and "nutritional" materials. This statement is confirmed by direct evaporation of cold water extract.
It is important not to break the ice crystals during formation, because cavities will form, enclosing active ingredients. This is experimentally confirmed.
Additional note: The extraction can be accomplished from dried pods also, however, a third extraction step is required, and more time to allow for dissolving.
and here is the same tek written by another person, reworded( somewhat simpler to understand0
Quote:
1. Take pods, dried or fresh, and freeze them 2. Add 4 parts water for each 1 part pod material into a blender and grind it up good 3. Pour it over in a mug or similar, stirr it well for some minutes, then let it sit for about 1 hour in room temp. 4. Strain it to discard the biggest chunks, use a strainer with fairly big holes. 5. Fill the upper brown and most clear layer over into a bottle, let the rest stay in the mug 6. Extract the goo and particles left in the mug with more water, like was done with the pods in step 2 and 3. 7. Strain and pour this solution also over into the bottle 8. Shake bottle and put in a freezer (Dont cap the bottle, could explode if pressure expands it while freezing) 9. When half the solution in the bottle has frozen filtrate it with a cloth (t-shirts work fine) and discard the ice. 10. Put the solution back into bottle, shake it well, freeze it down again like in step 8 and 9. 11. Take this second filtrated solution and evaporate it in a pot placed in a larger pot with cooking water (warm bath) 12. The brown substance left in the smaller pot when evaporated, sometimes a bit like mexican tar, can be smoked.
This type of Morphine salt extracted with this method is highly soluble in cold water No need for any acidic chemicals in the process, no ascorbic acid, lemon juice, etc. This makes it less soluble. The morphine stays in the water, the junk in the ice that you discard.
-------------------- these long agonizing months without you...have been long and agonizing..
"War Doesn't Decide Who's Right... It Only Decides Who's Left."
|
Iamthewalrus
every evening Idied and everynight I wasreborn


Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 1 month
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: flowstone]
#4177019 - 05/15/05 01:33 AM (4 years, 6 months ago) |
|
|
I really fuckin hate how theres like 10 diff types of weeds around here that look pretty much identical to poppies(at an early stage) is there some kinda of test you can do or look for something? I really have no clue...I'm brand new to the horticulture world :P...well poppys for sure
|
flowstone
blustering

Registered: 01/25/05
Posts: 6,485
Loc: precious
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Iamthewalrus]
#4177067 - 05/15/05 01:57 AM (4 years, 6 months ago) |
|
|
HOLY MOLY! THank goodness poppies.org is working
I just got through page twenty of the threads in the 'tea room', reading select threads. GREAT INFO.. Something to note: When making tea from the stems, use only the top 5 inches of the stem. THe bottom portion of the stem contains aprox 30% alkaloids that the top 5 inches hold, or roughly only 10% that the pods would hold.
Also, always wipe your pods down to remove dust and anything on the outside. use a damp cloth and possible add a small amount of vinegar to the dampness.
-------------------- these long agonizing months without you...have been long and agonizing..
"War Doesn't Decide Who's Right... It Only Decides Who's Left."
|
BostonSteamer
Stranger

Registered: 05/16/05
Posts: 5
Last seen: 3 years, 5 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: flowstone]
#4183650 - 05/16/05 06:54 PM (4 years, 6 months ago) |
|
|
sorry to be off topic but.... Flowstone(or fellow shroomers) do you know of any teks for extracting hydrocodone from either dried pods or raw opium, thanks guys
|
namaste
RuNnINg OwL


Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 2 days, 9 hours
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: BostonSteamer]
#4204537 - 05/21/05 07:17 PM (4 years, 5 months ago) |
|
|
Sowed these gigs last February, accidently broke a leaf and found some neat stuff. Apparently thinnings are also slightly active 


I read at poppies.org how some veterns prefer to mix ground pods with Cookies and Cream ice-cream. They said less is used than with T and the taste is masked well, but I'd still like to try the Lemonaide.
I'm going to let the largest pods go to seed and collect and dry the rest for a floral arrangment a few days after they reach maturity, to avoid people seeing them and theft.
Does anyone have an opinion if the Nods are pronounced more from any one certain derivative? Or is codiene just the most desirable?
--------------------
 
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
rocknliam
happy willowdweller


Registered: 12/12/03
Posts: 307
Last seen: 4 months, 8 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: namaste]
#4213240 - 05/24/05 05:35 AM (4 years, 5 months ago) |
|
|
Flowstone, do you have any personal experience of that working? Or can anyone vouch for the method?
|
flowstone
blustering

Registered: 01/25/05
Posts: 6,485
Loc: precious
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: rocknliam]
#4223333 - 05/26/05 04:07 PM (4 years, 5 months ago) |
|
|
Never done it. It was an old thread over at poppies org
The people there seen to think it works. Keep in mind you would be leaving a lot of goodies behind because you would just be getting smoke-able morphine( I think) Which means you could make tea for the codeine to get what is left over.
-------------------- these long agonizing months without you...have been long and agonizing..
"War Doesn't Decide Who's Right... It Only Decides Who's Left."
|
Iamthewalrus
every evening Idied and everynight I wasreborn


Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 1 month
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: flowstone]
#4229288 - 05/28/05 03:38 AM (4 years, 5 months ago) |
|
|
starter gave me the go ahead so tomorrow I'll find away to post his guide
|
Wiccan_Seeker
INFJcounselor-idealist


Registered: 02/06/02
Posts: 20,583
Loc: Virgo Supercluster (or b...
Last seen: 1 hour, 57 minutes
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Iamthewalrus]
#4229349 - 05/28/05 05:45 AM (4 years, 5 months ago) |
|
|
Hmm I feel this thread is derailing. It's originally about the natural products "from poppyseed to (cooked) opium" and now we are discussing things that are opium no longer but rather refined products that have lost several *kinds* of alkaloids.
Walrus, please post the morphine extraction in another thread because they deal with refined extracts.
Opium is the dried-up juice of the poppy. Poppyhead fluids are whole Opium dissolved in water. Cooked opium is a technique to remove physical impurities for smoking. To selectively change the nature of Opium into that of crude morphine is not the direction this thread was intended for, which basically revolves around the joys of cultivating poppies and the pleasures of opium. It;s a bit like a "distilling fermented sugar into 200 proof spirits" in a winemaking thread. I'd love to see the tek, but i think this thread will be taken off topic by it as far too many people have a isolated alkaloid fix-ation already.
|
Iamthewalrus
every evening Idied and everynight I wasreborn


Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 1 month
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#4232234 - 05/29/05 12:46 AM (4 years, 5 months ago) |
|
|
the guide is about growing tasmanian poppys, it does have some extraction stuff too towards the end...but there is much goodness about growing the poppies as well(plus making edible opium) all with good pics...I really think it belongs here but its your call
|
Wiccan_Seeker
INFJcounselor-idealist


Registered: 02/06/02
Posts: 20,583
Loc: Virgo Supercluster (or b...
Last seen: 1 hour, 57 minutes
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Iamthewalrus]
#4232640 - 05/29/05 06:50 AM (4 years, 5 months ago) |
|
|
The thing is this thread is basically about the virtues of opium and the growing of your own poppies. There are good reasons to draw distinctions between Whole Opium products vs isolates.
Opium throughout history has caused many dire problems, but the Opiate world literally went to shite when Morphine was invented along with the hypodermic syringe.
Part of the point of this thread is to turn pharmaceutical/street shite users back to Mother Nature and the finest opiate of all: whole Opium, as part of the whole back-to-nature and grow-your-own trend.
Homegrown whole opium cannot be unnaturally administered. If grown yourself it has natural limitations on its use and whole Opium, let it be known, gives a better, fuller Opiate experience than any Opioid including heroin and the stuff nowadays passed off as heroin.
People can put a patch in their garden, or the forest, or among the weeds on that vacant lot close to their home and be self-sufficient in their drug needs with no dealers or cutting agents involved. It's taking responsibility for your drug and your use of it right from the start. 
The DEA document that kicked off this thread proceeded to detail isolation of morphine in 55 gallon drums, transportation of Choi bricks of 999 morphine to the labs to be converted to heroins 3 & 4 by the kilo. I chose to post the version I found where all that shite is snipped off, so it is just about the poppy and whole Opium.
I would love to see that Taz TEK here, I have little doubt it will be anything but a treasure. But please ask your friend if he'd consider snipping the parts that detail extracts other than whole Opium from the TEK as posted in this thread.
Whole Opium would be:
-Poppy plant juice & plant parts dry or fresh (pods!) -Water extract of poppy plant parts made hot or cold, neat or acidified and drank whole -Pod Putty which is evaporated water extract of poppy plant parts -Opium (aka Raw Opium, Gum Opium) which is dried poppy juice (from lancing pods or juiced from the fresh plant parts) -Opium tincture (Laudanum) which is whole opium dissolved in aquatic alcohol. -Smoking Opium (Cooked Opium) which is Opium, disdsolved in water, filtered and evaporated until a paste is obtained.
All these techniques have three things in common: they are low-tech but more importantly: they produce products containing whole Opium and no selective isolates and can not be abused by injection.
Please ask your friend if its ok to have certain passages snipped from the TEK document to fit this thread. I think he'd likely understand and agree if he saw the rationale behind it.
You take it in your garden You take it in your house You take it in your body
Thats how it should be. Also, legally, 9/10 judges would view a person who makes tea of a herb with other eyes than one who isolates morphine and then perhaps bangs it in a syringe.
Please try to get the edited TEK in here. Neuro and I are discussing how to keep this thread ontopic and keep the info pouring in. This thread is solid gold, lets go for a platinum thread on this fascinating culinary & gardening & psychoactive herb!
|
flowstone
blustering

Registered: 01/25/05
Posts: 6,485
Loc: precious
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#4241352 - 05/31/05 06:27 PM (4 years, 5 months ago) |
|
|
No, I would never inject ANY drug.
The reason I was asking about a salt cold water/freeze morphine extract is so I could get a smoke-able product from poppy straw. See, tea is great and all, but sometimes you just want to experience the full spectrum. I will admit smoking an extracted morphine will NOT be the same as smoking 'whole opium' lanced from the pods, but it would be the closest somebody like me could get. Also, I DID make a separate thread about this, but no one seemed to have any answers.
-------------------- these long agonizing months without you...have been long and agonizing..
"War Doesn't Decide Who's Right... It Only Decides Who's Left."
|
Iamthewalrus
every evening Idied and everynight I wasreborn


Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 1 month
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Wiccan_Seeker]
#4241536 - 05/31/05 07:26 PM (4 years, 5 months ago) |
|
|
I pmed you about editing the guide...my buddy seems to have lost most interest in this forum so I doubt he'll mind the slight edit but after seeing it you may change your mind(its really good shit)...its not about extracting morphine its about taking your opium and refining it slightly again with some great pics(also a guide for mixing ice hash(which he made as well) with opium
EDIT: WOOHOO! my tassies have germinated(using the guide in question )
oh and btw I re-read what you think is suitable for this thread and I honestly think the whole guide is...the "extraction" part is a simple one that just gets the opium into a more pure form...theres nothing about extracting morphine or anything...the only part you may not want is the mixing with hash hes included including a pic of growroom(weed) he was once a mod at overgrow(not that that matters)
Edited by Iamthewalrus (06/02/05 03:59 AM)
|
Iamthewalrus
every evening Idied and everynight I wasreborn


Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 1 month
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#4249647 - 06/02/05 07:06 PM (4 years, 5 months ago) |
|
|
well I know your a busy man wiccan since I haven't gotten a response yet from my pm...so later on I'm gonna go ahead and post the guide myself...I'm keeping it in tact and anything you want out feel free to edit
|
Iamthewalrus
every evening Idied and everynight I wasreborn


Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 1 month
|
Re: Poppies - from Poppyseed to Opium *DELETED* [Re: Iamthewalrus]
#4249951 - 06/02/05 08:12 PM (4 years, 5 months ago) |
|
|
Post deleted by IamthewalrusReason for deletion: updated version of this tek is already posted so one of the mods can move it over since starter has given permission
|
Twirling
Barred Spiral


Registered: 02/03/03
Posts: 2,458
Last seen: 19 days, 4 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Iamthewalrus]
#4250413 - 06/02/05 09:59 PM (4 years, 5 months ago) |
|
|
Awesome thread. What are the differences in psychoactive effects of the different strains of poppies? I've read that giganthemum tend to be more narcotic, whereas the smaller varities are more euphoric. Any more input on that?
It's obvious to me that the drug war absolutly ruins the poppy and people's use of opiates/opioids because the profit for heroin is so much greater than that of morphine, and especially opium. Morphine can easily be converted into heroin, which is 5x's as potent, and thus allows drug networks to increase the volume they sell. Instead of people using a much more subtle drug, the market is flooded with the hardest and most damaging of the opiate/opioid chemicals. Opium has it's dangers, sure, but it's of a far different magnitude.
|
neuro
Phytophiliac


Registered: 08/10/99
Posts: 6,604
Loc: Rigel 7
Last seen: 14 days, 17 hours
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Iamthewalrus]
#4250548 - 06/02/05 10:38 PM (4 years, 5 months ago) |
|
|
Are you referring to this thread?
|
Iamthewalrus
every evening Idied and everynight I wasreborn


Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 1 month
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: neuro]
#4250980 - 06/03/05 12:36 AM (4 years, 5 months ago) |
|
|
ya thats the one I didn't know it was posted doh! lol...well I'll just continue posting it so its here in the poppy thread...he mentioned something about it being archived so that makes sense...oh well
EDIT: lol wiccan I just talked to starter and he mentioned that you asked about putting this guide in this thread already...I wish I knew that thread existed...anyways you can bring it over or I can continue posting its your call
Edited by Iamthewalrus (06/03/05 12:55 AM)
|
Iamthewalrus
every evening Idied and everynight I wasreborn


Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 1 month
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Iamthewalrus]
#4253623 - 06/03/05 07:28 PM (4 years, 5 months ago) |
|
|
this lil guy popped up RIGHT where I was planting my seeds...i've never grown poppies before so I can't be 100% but I'm pretty sure it is(nothing else around here that looks like that)...what do you guys think?
|
pshawny
Mycobian



Registered: 09/11/04
Posts: 1,332
Loc: Shroomery
Last seen: 9 months, 10 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: MycoCakeEater]
#4254344 - 06/03/05 10:59 PM (4 years, 5 months ago) |
|
|
Can empty pods be dried, ground into powder, capsuled, and ingested with positive results?
--------------------
|
Iamthewalrus
every evening Idied and everynight I wasreborn


Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 1 month
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: pshawny]
#4257677 - 06/04/05 10:18 PM (4 years, 5 months ago) |
|
|
well looks like starter updated the guide slightly since before it was public and also added a few more pics so one of the mods can move that one over here if they want(he gave me the go ahead so no need to ask) and I'm deleting my post
my tassies are germinating like crazy...I've heard they are in high demand with a low supply so I'll make sure to let some pods go to seed and spread em around 
my store bought poppy seeds are also germinating but I plan to detroy them at cabbage stage since poppies will cross polinate(from what I've read) and obviously I wanna keep the tassies pure
|
ShroomOmatic
Ethno Apprentice

Registered: 10/14/04
Posts: 2,373
Loc: Sailing the Seas of Chees...
|
Re: Poppies - from Poppyseed to Opium [Re: Twirling]
#4258579 - 06/05/05 02:11 AM (4 years, 5 months ago) |
|
|
WOW! What an amazing post! Thank you for all the good info!
--------------------
|
rocknliam
happy willowdweller


Registered: 12/12/03
Posts: 307
Last seen: 4 months, 8 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Iamthewalrus]
#4258663 - 06/05/05 02:44 AM (4 years, 5 months ago) |
|
|
Iamthewalrus - Are they in pots? if so you could give them to a friend to raise, or you could try putting sandwhich bags or paper bags over the flowers to stop pollen spreading, Just a thought, might be too much work though, not sure what the size of your project is.
|
Iamthewalrus
every evening Idied and everynight I wasreborn


Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 1 month
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: rocknliam]
#4258711 - 06/05/05 03:14 AM (4 years, 5 months ago) |
|
|
they are in trays mostly in the pics I posted above...theres one pot(1 tassie pot too) but they haven't germinated in there yet(the store bought, tassies have)...tassies are WAY ahead...good call on the friend thing tho I think I'm gonna do that...don't wanna waste any goodies 
EDIT: btw can anyone tell me if thats a poppy or not growing where I planted(I'm pretty sure it is based on the colour and shape of the leaves but again this is my first go so I can't be 100% sure...pretty sure its a tassie as well
Edited by Iamthewalrus (06/05/05 03:16 AM)
|
rocknliam
happy willowdweller


Registered: 12/12/03
Posts: 307
Last seen: 4 months, 8 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Iamthewalrus]
#4258738 - 06/05/05 03:32 AM (4 years, 5 months ago) |
|
|
I was leaning more towards non poppy as it doesnt look like any of the ones i have grown, the leaves tend to be more wavy and softer looking, hard to describe, but i could well be wrong, i have only grown twice before myself.
|
Iamthewalrus
every evening Idied and everynight I wasreborn


Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 1 month
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: rocknliam]
#4258746 - 06/05/05 03:34 AM (4 years, 5 months ago) |
|
|
either way I got lots germinating so its no biggie..its just RIGHT in the area I planted and nothing else around here looks like that...it also has a lot features of a poppy...and is getting bigger and bigger....guess we'll find out
thx for the response tho...was hoping SOMEONE would
|
Iamthewalrus
every evening Idied and everynight I wasreborn


Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 1 month
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Iamthewalrus]
#4309484 - 06/17/05 10:34 PM (4 years, 5 months ago) |
|
|
I'll post pics of my poppies tomorrow...there coming along slowly...is it normal for them to be pretty slow in teh early stages? I'm just starting to get jaggy leaves coming out(single red tasmanian btw)...good news is they survived a massive heat wave recently thats about as hot as our summers get...so I'm confident they will be fine...its times like these that make me proud to be a canadian! :P
|
rocknliam
happy willowdweller


Registered: 12/12/03
Posts: 307
Last seen: 4 months, 8 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Iamthewalrus]
#4310186 - 06/18/05 04:28 AM (4 years, 5 months ago) |
|
|
Oh i thought you were Aussie, i'll post some pics of mine soon too.
|
Iamthewalrus
every evening Idied and everynight I wasreborn


Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 1 month
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: rocknliam]
#4312032 - 06/18/05 08:48 PM (4 years, 5 months ago) |
|
|
I didn't have access to the cam today(its not mine) so soon as I get it and its daylight I'll post pics
|
rocknliam
happy willowdweller


Registered: 12/12/03
Posts: 307
Last seen: 4 months, 8 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: rocknliam]
#4312760 - 06/19/05 12:42 AM (4 years, 5 months ago) |
|
|
Ok here are some pics of the small poppy grow i have at home. These originated from store bought spice rack poppy seeds. I grew them once, and these are grown from the seed that i collected from my first grow.
I think i may be a little tight on soil space, as this is my first time in pots, and i have only grown in the ground before, so i dont know how well these will go - we will have to see.
These are some little ones that were transplanted not long ago into this pot. Their growth is a little slower than that of the other poppies, i have used no fertilisers on any of them. My hand for size comparison.
 
This poppy is at about the same stage of growth as the later ones, but is much smaller, i am going to keep seed from this one seperate and hopefully get a little substrain of smaller poppies.

This is a bunch of poppy seeds that have just grown in a pot, i am debating on wether to thin these and get a bit of a usable product or just watch them and see which ones survive.

The next three pictures are of poppies that i have under my window. They are the largest of them all so far, and there are 7 plants, in two boxes. I think the boxes may be too small, but we'll see. (i've only grown in the ground once before, this is first time in pots)
 
|
Iamthewalrus
every evening Idied and everynight I wasreborn


Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 1 month
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: rocknliam]
#4312867 - 06/19/05 01:34 AM (4 years, 5 months ago) |
|
|
mine are still much smaller then those...just starting to get some jagged leaves coming out...I've decided I'm not thining(even tho they are in lil cubes)...I'm just gonna put the whole cubes in the ground once they are about as big as the ones in your first pic and see what happens...I'm happy to have even gotten germination my first go
|
Iamthewalrus
every evening Idied and everynight I wasreborn


Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 1 month
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Iamthewalrus]
#4315267 - 06/19/05 09:29 PM (4 years, 5 months ago) |
|
|
got the cam and will post pics in the mornin! ...they look so sexy...I'm just happy that they survived the last week when we had EXTREMELY high temps for this time of year...I know now they can take whatever my summer has to throw at them...and that gives them the perfect amount of time to grow full size and be ready in the fall(right along side with weed)
|
JaguarWarrior101
ShamanicAlchemist InTraining


Registered: 03/23/05
Posts: 184
Loc: State of Euphoria
Last seen: 3 years, 4 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Iamthewalrus]
#4315610 - 06/19/05 11:29 PM (4 years, 5 months ago) |
|
|
They grow fast, I seen them get 10x bigger in like a week after thinning out the extra ones. Mine are around the same size as rockinliam's.
-------------------- The above post is purely hypothetical, and should not be considered the true thoughts, opinions, or actions of a real life person.
We perceive. This is hard fact. But what we perceive is not a fact of the same kind, because we learn what to perceive.
~Carlos Castaneda
|
CloakandDagger
Stranger
Registered: 12/12/04
Posts: 95
Last seen: 2 years, 9 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: JaguarWarrior101]
#4315643 - 06/19/05 11:41 PM (4 years, 4 months ago) |
|
|
I've got mad germination my first time, indoor grow, within about 5 days i'm already seeing those nice little green stalks start to make their way out of the soil
|
JaguarWarrior101
ShamanicAlchemist InTraining


Registered: 03/23/05
Posts: 184
Loc: State of Euphoria
Last seen: 3 years, 4 months
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: CloakandDagger]
#4315661 - 06/19/05 11:49 PM (4 years, 4 months ago) |
|
|
I found germination outdoors to be very high, I put them in moisture domes and left them outside. Temps ranged from 4-13*c during the germination time. I've heard the cool temps are actually good for this.
-------------------- The above post is purely hypothetical, and should not be considered the true thoughts, opinions, or actions of a real life person.
We perceive. This is hard fact. But what we perceive is not a fact of the same kind, because we learn what to perceive.
~Carlos Castaneda
|
Iamthewalrus
every evening Idied and everynight I wasreborn


Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 1 month
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: JaguarWarrior101]
#4316153 - 06/20/05 04:30 AM (4 years, 4 months ago) |
|
|
I think the heat wave we had slowed em down a lil...they seemed to have picked up speed now that the temp has dropped...I'm gonna take a pic once the sun is out a lil more
|
Iamthewalrus
every evening Idied and everynight I wasreborn


Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 1 month
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: Iamthewalrus]
#4316582 - 06/20/05 10:16 AM (4 years, 4 months ago) |
|
|
heres some of my baby tassies:




|
FooMan
Dr. Feel Good



Registered: 02/02/05
Posts: 6,996
Loc: Amsterdam
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#4319742 - 06/21/05 06:05 AM (4 years, 4 months ago) |
|
|
-------------------- "Those who would sacrifice a little freedom for a little order, will lose both, and deserve neither." - Thomas Jefferson
|
JaguarWarrior101
ShamanicAlchemist InTraining


Registered: 03/23/05
Posts: 184
Loc: State of Euphoria
Last seen: 3 years, 4 months
|
Re: Poppies - from Poppyseed to Opium [Re: FooMan]
#4322368 - 06/21/05 08:12 PM (4 years, 4 months ago) |
|
|
I might have to get some snap shots myself to share...
-------------------- The above post is purely hypothetical, and should not be considered the true thoughts, opinions, or actions of a real life person.
We perceive. This is hard fact. But what we perceive is not a fact of the same kind, because we learn what to perceive.
~Carlos Castaneda
|
Wiccan_Seeker
INFJcounselor-idealist


Registered: 02/06/02
Posts: 20,583
Loc: Virgo Supercluster (or b...
Last seen: 1 hour, 57 minutes
|
|
POPPIES - FROM POPPYSEED TO OPIUM The thread that delivers, delivers.. And keeps on delivering 
Oook it's Poppy Garden time! Last year I bought a supermarket gardenseed packet for Papaver somniferum var. "Danish Flag"http://files.shroomery.org/files/05-25/943014364-danishpoppy02.jpg> . Hmm, a poppy closeup! Look at those flowers! My garden was swarming with bumblebees eager to pollinate the flowers, and there's one in the left flower right now. They flew from flower to flower, I saw the pollination of flower X with Y happen before my eyes! I had a pic where one bumblebee was "doing" a flower and another patiently hovered over it for his turn - but the pic was a blur. .
 . This is a true Ethno Garden pic! Here you see a psychoactive Danish poppy, and the wooden bowl below it holds last years harvest, from the best of which that very poppy was sown. The 24gr poppies in the bowl will give 2 cups of (4gr) Lemon Laudanum to each of three voyagers, making for a luxurious Opium day.
-------------------------------- come on people, keep it coming! its the best poppythread ever! --------------------------------
|
JaguarWarrior101
ShamanicAlchemist InTraining


Registered: 03/23/05
Posts: 184
Loc: State of Euphoria
Last seen: 3 years, 4 months
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#4327289 - 06/23/05 12:54 AM (4 years, 4 months ago) |
|
|
How do you like these little guys?





-------------------- The above post is purely hypothetical, and should not be considered the true thoughts, opinions, or actions of a real life person.
We perceive. This is hard fact. But what we perceive is not a fact of the same kind, because we learn what to perceive.
~Carlos Castaneda
|
MeneerCactus
Free Spore RingEurope


Registered: 01/20/02
Posts: 1,094
Loc: The Low Lands
Last seen: 1 month, 5 days
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#4327497 - 06/23/05 02:13 AM (4 years, 4 months ago) |
|
|
High,
On your special request here the copy and paste from topic http://www.shroomery.org/forums/showflat.php/Cat/0/Number/4319765/an/0/page/1/gonew/1#UNREAD
High All,
It is time for a new post. It is entheo garden related and I think this is the right forum to place my pictures.
Papaver Somniferum is a very easy and beautifull plant to grow. Just through the seeds in your garden in spring or fall and nature does the rest. After a few years your garden is cased with poppie seed and it will act like weed.
Many rivers to cross and a few steps to have a nice smoke.
Here we go...
All that is needed.

Yesterdays fresh harvest.

The harvest is put into some water.

The water is heated (30 minutes) "Au Bain Marie" poppie water does not boil.

I used aquariumfilter synthetic cotton (polyfill alike) to filter the O-water.

Filtered the O-water twice this way.

Placed the juice in a petries under a lamp (warm not hot).

14 hrs later it was dried and ready to scratch.

A nice result and transformation of yesterdays harvest.

And a kind of close up.

Thats all fooks, I hope you enjoyed the show!
-------------------- "Millions of years of evolution just to .... light up a joint"
|
JaguarWarrior101
ShamanicAlchemist InTraining


Registered: 03/23/05
Posts: 184
Loc: State of Euphoria
Last seen: 3 years, 4 months
|
Re: Poppies - from Poppyseed to Opium [Re: MeneerCactus]
#4328220 - 06/23/05 11:18 AM (4 years, 4 months ago) |
|
|
Any word on how to extract alkaloids from the plant itself? It's a shame to let them go to waste...
-------------------- The above post is purely hypothetical, and should not be considered the true thoughts, opinions, or actions of a real life person.
We perceive. This is hard fact. But what we perceive is not a fact of the same kind, because we learn what to perceive.
~Carlos Castaneda
|
namaste
RuNnINg OwL


Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 2 days, 9 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#4329409 - 06/23/05 05:14 PM (4 years, 4 months ago) |
|
|
Update on my Gigs




All plants seem to have four pods each...quite happy so far
--------------------
 
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
JaguarWarrior101
ShamanicAlchemist InTraining


Registered: 03/23/05
Posts: 184
Loc: State of Euphoria
Last seen: 3 years, 4 months
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#4330394 - 06/23/05 09:13 PM (4 years, 4 months ago) |
|
|
Nice!
-------------------- The above post is purely hypothetical, and should not be considered the true thoughts, opinions, or actions of a real life person.
We perceive. This is hard fact. But what we perceive is not a fact of the same kind, because we learn what to perceive.
~Carlos Castaneda
|
namaste
RuNnINg OwL


Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 2 days, 9 hours
|
|
Thank you 
Quote:
Any word on how to extract alkaloids from the plant itself? It's a shame to let them go to waste...
My understanding is that the pod and the five inches of stem below are the most worthy and everything else...heh, maybe you could try pod puddy on the leaves, and compost the rest.
--------------------
 
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
JaguarWarrior101
ShamanicAlchemist InTraining


Registered: 03/23/05
Posts: 184
Loc: State of Euphoria
Last seen: 3 years, 4 months
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#4332081 - 06/24/05 11:06 AM (4 years, 4 months ago) |
|
|
I read somewhere here that the plant contains 10% of the alkaloids as the pods, if this is true and though that is low, the amount of biomass of the plant would mean that's still quite a bit.
Looking at your poppies makes me feel like I planted mine a little late...
-------------------- The above post is purely hypothetical, and should not be considered the true thoughts, opinions, or actions of a real life person.
We perceive. This is hard fact. But what we perceive is not a fact of the same kind, because we learn what to perceive.
~Carlos Castaneda
|
namaste
RuNnINg OwL


Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 2 days, 9 hours
|
|
I guess we'll have to wait for an expert.
I sowed mine Feb/March, the first warm day the snow melted. I'm in zone 5, last year I didn't plant till May 1, but still got a nice harvest in August.
I'm starting to think the most important part of sowing is to magically time the bloom with your summer's drought 
Was just reading over at PORG, I never knew that the longer you let them grow, the bigger they get
--------------------
 
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
Wiccan_Seeker
INFJcounselor-idealist


Registered: 02/06/02
Posts: 20,583
Loc: Virgo Supercluster (or b...
Last seen: 1 hour, 57 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#4333033 - 06/24/05 03:42 PM (4 years, 4 months ago) |
|
|
indeed: dried pods contain 1.5-5% Opium (as 10% morphine) whereas dried plant contains 0.15-0.5% per weight. Still that means that 40gr dried poppy plant (1/25 kg) holds a dose of 60-200mg Opium, the orally active range of 1-3 grains.
2-10gr pods = 20-100gr plant
|
namaste
RuNnINg OwL


Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 2 days, 9 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#4333827 - 06/24/05 08:23 PM (4 years, 4 months ago) |
|
|
Quote:
2-10gr pods = 20-100gr plant
WoW!
After two weeks of rain, the thunderclouds came. Knowing these were immature I thought it would be best to pick them rather than let them become diluted. Got these seeds from Lifenergy, Thank you wherever you are 


and something that looks like boobs

Thank you for all the great info Wiccan, I'm always telling my wife stories about you. We have decided to let the pods dry, and save them for very special occaisions (once or twice a year), where they'll be mixed with yogurt or ice-cream, sposta be more efficient and less bitter
--------------------
 
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
MeneerCactus
Free Spore RingEurope


Registered: 01/20/02
Posts: 1,094
Loc: The Low Lands
Last seen: 1 month, 5 days
|
|
Quote:
JaguarWarrior101 said: Any word on how to extract alkaloids from the plant itself? It's a shame to let them go to waste...
On poppies.org forum in the tearoom is a post about a kind of ICE O Lation process which extracts pure O from poppie tea (pt). I gues this tek can also work for the parts you suggested.
-------------------- "Millions of years of evolution just to .... light up a joint"
|
JaguarWarrior101
ShamanicAlchemist InTraining


Registered: 03/23/05
Posts: 184
Loc: State of Euphoria
Last seen: 3 years, 4 months
|
Re: Poppies - from Poppyseed to Opium [Re: MeneerCactus]
#4342870 - 06/27/05 12:10 PM (4 years, 4 months ago) |
|
|
Quote:
MeneerCactus said:
Quote:
JaguarWarrior101 said: Any word on how to extract alkaloids from the plant itself? It's a shame to let them go to waste...
On poppies.org forum in the tearoom is a post about a kind of ICE O Lation process which extracts pure O from poppie tea (pt). I gues this tek can also work for the parts you suggested.
I can't seem to do a search on there because I'm not a member, and they aren't accepting new members. Any chance you could post or PM me a link?
-------------------- The above post is purely hypothetical, and should not be considered the true thoughts, opinions, or actions of a real life person.
We perceive. This is hard fact. But what we perceive is not a fact of the same kind, because we learn what to perceive.
~Carlos Castaneda
|
DeQuincy
Paddo hunter

Registered: 03/16/01
Posts: 68
Loc: The Netherlands
Last seen: 1 year, 10 months
|
|
This Iceolation process originates from a someone called Ab Strak and was first publiced (to my knowledge) on an site called clubopium.tk
Here's a link:
http://adh.2.forumer.com/index.php?s=e70268609213f3dd4fffb021016c2a42&showtopic=171
Good luck.
-------------------- there's no vestige of a beginning no prospect of an end
(hutton)
if you came to conquer, you'll be king for a day, but you too will deteriorate and quickly fade away...
you have NO CONTROL
(bad religion)
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: Poppies - from Poppyseed to Opium [Re: DeQuincy]
#4345816 - 06/28/05 01:42 AM (4 years, 4 months ago) |
|
|
ok let me see if i got this right, like would it work. , you puree frozen, seedless, dry pods in ice old water, then let sit for hours in the fridge, disolving morphine, then you decant the liquid out, and allow the liquid to freze. then remove ie rystals with a seive, and repeat a few times untill muh water has been sooped away. then you put the remaining alkaloid rich liquid into a tray, and then reduce at about 70c untill all that is left is dry residue. and bingo thats good stong-ass opium?
is that it in a nuthell, or am i missing something obvious/
--------------------
|
JaguarWarrior101
ShamanicAlchemist InTraining


Registered: 03/23/05
Posts: 184
Loc: State of Euphoria
Last seen: 3 years, 4 months
|
Re: Poppies - from Poppyseed to Opium [Re: Mitchnast]
#4346655 - 06/28/05 12:14 PM (4 years, 4 months ago) |
|
|
What do you guys think of the following? I find it very interesting, but am curious why they suggest a grain based alcohol.
Laudanum, a tincture of opium, was very popular in high social circles around the turn of the century.
It was used by practically every English author at that time, as well as statesmen, diplomats, and anyone else who had a liking for it. Opium was legal in most western nations until the early twentieth century, and Laudanum could be purchased at any drug or general store.
To prepare Laudanum, simply dissolve as much opium as possible in a jug of pure grain alcohol.
Everclear works great. Do not use denatured, wood, or isopropyl (rubbing) alcohol. Purchase your alcohol only from a liquor store or from a reputable moonshiner. Laudanum tastes absolutely terrible, but some things are worth forcing down. The main advantage of Laudanum is that the alcohol acts as a preservative, and helps to maintain that "just picked" freshness in your opium. The alcohol also pre-dissolves the opium so that it enters your body more efficiently. ~ http://www.erowid.org/plants/poppy/opium_poppy_cultivation/opium_poppy_cultivation5.shtml
-------------------- The above post is purely hypothetical, and should not be considered the true thoughts, opinions, or actions of a real life person.
We perceive. This is hard fact. But what we perceive is not a fact of the same kind, because we learn what to perceive.
~Carlos Castaneda
|
Wiccan_Seeker
INFJcounselor-idealist


Registered: 02/06/02
Posts: 20,583
Loc: Virgo Supercluster (or b...
Last seen: 1 hour, 57 minutes
|
|
Wood alcohol is poison, rubbing alcohol isnt good either and potato alcohol often tastes foul.
Hence the grain alcohol. They mean high proof spirits specifically sold for human consumption.
|
DeQuincy
Paddo hunter

Registered: 03/16/01
Posts: 68
Loc: The Netherlands
Last seen: 1 year, 10 months
|
Re: Poppies - from Poppyseed to Opium [Re: Mitchnast]
#4349451 - 06/29/05 02:29 AM (4 years, 4 months ago) |
|
|
Mitchnast, here's another write-up on the same method. This one was created by Shaganos of the porg after Ab's method.
I cannot post the link due to specific forum rules, pm me if you like to have the link (discussion etc)
1. Take pods, dried or fresh, and freeze them 2. Add 4 parts water for each 1 part pod material into a blender and grind it up good 3. Pour it over in a mug or similar, stirr it well for some minutes, then let it sit for about 1 hour in room temp. 4. Strain it to discard the biggest chunks, use a strainer with fairly big holes. 5. Fill the upper brown and most clear layer over into a bottle, let the rest stay in the mug 6. Extract the goo and particles left in the mug with more water, like was done with the pods in step 2 and 3. 7. Strain and pour this solution also over into the bottle 8. Shake bottle and put in a freezer (Dont cap the bottle, could explode if pressure expands it while freezing) 9. When half the solution in the bottle has frozen filtrate it with a cloth (t-shirts work fine) and discard the ice. 10. Put the solution back into bottle, shake it well, freeze it down again like in step 8 and 9. 11. Take this second filtrated solution and evaporate it in a pot placed in a larger pot with cooking water (warm bath) 12. The brown substance left in the smaller pot when evaporated, sometimes a bit like mexican tar, can be smoked.
Good luck
-------------------- there's no vestige of a beginning no prospect of an end
(hutton)
if you came to conquer, you'll be king for a day, but you too will deteriorate and quickly fade away...
you have NO CONTROL
(bad religion)
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: Poppies - from Poppyseed to Opium [Re: DeQuincy]
#4351855 - 06/29/05 05:56 PM (4 years, 4 months ago) |
|
|
  
  
  
 
i found alot of plants, some of which i never expected to come up, like whole patches of tiny poppies around parking lots.
many of the poppies growing on the dyke are waist-high, and have many tillers.
still my favorite one is the one that popped up in my front yard. here it is.

  
--------------------
Edited by Mitchnast (07/01/05 12:49 PM)
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Mitchnast]
#4351863 - 06/29/05 05:58 PM (4 years, 4 months ago) |
|
|
the white one is actually purple just much lighter purple the tiny one are darker purple. i think it look like they are lighter when larger. these are bulk seed from bulk barn.
--------------------
|
namaste
RuNnINg OwL


Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 2 days, 9 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Mitchnast]
#4352240 - 06/29/05 07:33 PM (4 years, 4 months ago) |
|
|
So how about an Everclear extraction on the "bulk material" or plant puddy?
--------------------
 
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: Poppies - from Poppyseed to Opium *DELETED* [Re: namaste]
#4353389 - 06/29/05 10:58 PM (4 years, 4 months ago) |
|
|
Post deleted by MitchnastReason for deletion: h5
--------------------
|
Iamthewalrus
every evening Idied and everynight I wasreborn


Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 1 month
|
Re: Poppies - from Poppyseed to Opium [Re: Mitchnast]
#4353580 - 06/29/05 11:33 PM (4 years, 4 months ago) |
|
|
I know of that stinging plant...we get them here...it definitely stings like a bitch(its comparable to being stung by a bee in multiple places)
|
flowstone
blustering

Registered: 01/25/05
Posts: 6,485
Loc: precious
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: flowstone]
#4356549 - 06/30/05 06:08 PM (4 years, 4 months ago) |
|
|
Quote:
flowstone said: Here is a tek to extract morphine from pods.
Quote:
iceolated smokeables by Ab Strak
fresh pods were freezed, then ground in a blender, with 3 volume equivalents of cold water, and allowed to stand for 1 hour. The resulting goo was stirred, then sifted crudely, to retain the biggest pieces. The filtrate was allowed to stand for 1 hour at room temperature, after which the fairly clear, light brown top layer was decanted into a bottle, which was not to be filled completely. The filter residue was extracted again with water, fractions were combined. The closed bottle was kept still, in a freezer at -5 centigrade until 2/3 of the solution was frozen. The freezing solution was filtrated, after which the ice was discarded. The filtrate was put back in the bottle, and the freezing procedure was repeated. The resulting brown solution was allowed to evaporate on a hot water bath, yielding a brittle brown substance which was potent and tasteful enough to smoke pleasurably.
Hypothesis of the success of the procedure:
The active ingredient, a morphine salt, is highly soluble, even in cold water. Acid or base addition is unnecessary and unwanted because of possible decomposition of the salt, into possibly less soluble constituents.
Heating is unnecessary and unwanted because of possible degradation of saccharides and peptides (inflicted effect explained below), and additional dissolving other unwanted materials, like lipids.
The crystallization of water in the solution forces other molecules than water out of the matrix. Small molecules, like morphine maleate move easily to stay in the liquid phase. Large molecules, like (poly)saccharides and (poly)peptides can not move easily enough, and are included in the ice. An additional effect may be that plant saccharides have a high affinity to water. So, may be, small saccharides are included in the ice as well.
The freezing therefore accomplishes a separation between alkaloids and "nutritional" materials. This statement is confirmed by direct evaporation of cold water extract.
It is important not to break the ice crystals during formation, because cavities will form, enclosing active ingredients. This is experimentally confirmed.
Additional note: The extraction can be accomplished from dried pods also, however, a third extraction step is required, and more time to allow for dissolving.
and here is the same tek written by another person, reworded( somewhat simpler to understand0
Quote:
1. Take pods, dried or fresh, and freeze them 2. Add 4 parts water for each 1 part pod material into a blender and grind it up good 3. Pour it over in a mug or similar, stirr it well for some minutes, then let it sit for about 1 hour in room temp. 4. Strain it to discard the biggest chunks, use a strainer with fairly big holes. 5. Fill the upper brown and most clear layer over into a bottle, let the rest stay in the mug 6. Extract the goo and particles left in the mug with more water, like was done with the pods in step 2 and 3. 7. Strain and pour this solution also over into the bottle 8. Shake bottle and put in a freezer (Dont cap the bottle, could explode if pressure expands it while freezing) 9. When half the solution in the bottle has frozen filtrate it with a cloth (t-shirts work fine) and discard the ice. 10. Put the solution back into bottle, shake it well, freeze it down again like in step 8 and 9. 11. Take this second filtrated solution and evaporate it in a pot placed in a larger pot with cooking water (warm bath) 12. The brown substance left in the smaller pot when evaporated, sometimes a bit like mexican tar, can be smoked.
This type of Morphine salt extracted with this method is highly soluble in cold water No need for any acidic chemicals in the process, no ascorbic acid, lemon juice, etc. This makes it less soluble. The morphine stays in the water, the junk in the ice that you discard.
Hey guys, just thought I would let you know I am trying this^ tek with a small batch. I will let you know how it turns out!
-------------------- these long agonizing months without you...have been long and agonizing..
"War Doesn't Decide Who's Right... It Only Decides Who's Left."
|
rocknliam
happy willowdweller


Registered: 12/12/03
Posts: 307
Last seen: 4 months, 8 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: flowstone]
#4358179 - 07/01/05 02:01 AM (4 years, 4 months ago) |
|
|
i might try that with some pods i have from last years grow, i too shall let you know how it goes if i do it.
|
liveby
Wasted For Time


Registered: 06/15/04
Posts: 1,507
Last seen: 2 days, 14 hours
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: rocknliam]
#4358257 - 07/01/05 02:19 AM (4 years, 4 months ago) |
|
|
interesting essay that was quite interesting :
http://www.ieo.org/opm_mass.html - monkeys addicted to opium
--------------------

http://www.bruceeisner.com/ -Creating a Sensible Culture
Edited by liveby (07/01/05 02:42 AM)
|
rocknliam
happy willowdweller


Registered: 12/12/03
Posts: 307
Last seen: 4 months, 8 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: liveby]
#4358276 - 07/01/05 02:24 AM (4 years, 4 months ago) |
|
|
John - Let's not fuck up this thread.
|
liveby
Wasted For Time


Registered: 06/15/04
Posts: 1,507
Last seen: 2 days, 14 hours
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: rocknliam]
#4358310 - 07/01/05 02:38 AM (4 years, 4 months ago) |
|
|
Quote:
rocknliam said: John - Let's not fuck up this thread.
--------------------

http://www.bruceeisner.com/ -Creating a Sensible Culture
|
eve69
--=..Did Adam and ...?=--


Registered: 04/30/03
Posts: 2,379
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: liveby]
#4358822 - 07/01/05 08:56 AM (4 years, 4 months ago) |
|
|
I just wanted to say, (though I don't want to destroy the high nature of the thread) I am a poppy addict, and I have been so on and off for five years, and the addiction is as strong or worse than heroin, and so poppies aren't all that fun all the time, especially as soon as one has reached their tolerance and the high fades and it becomes a bad tasting drudgery of just keeping the withdrawls away.
I just wanted people reading this to also consider this so that they have some balanced viewpoint.
A good thread idea would be methods you have used to quit. I could write a book having quit at least twenty times.
--------------------

|
rocknliam
happy willowdweller


Registered: 12/12/03
Posts: 307
Last seen: 4 months, 8 days
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: eve69]
#4362563 - 07/02/05 08:39 AM (4 years, 4 months ago) |
|
|
So i did this extraction, though i cut alot of corners and modified the method a little. Anyway i did this on 7 small to medium dry pods that were about a year old, maybe a little less.
It does smoke, though i haven't smoked any to test potency etc. I dont know if i will even use this stuff as it seems like i might enjoy it too much, not sure though.
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
pics from today. out in the wild patch, a la jhonny poppyseed [Re: rocknliam]
#4363253 - 07/02/05 02:00 PM (4 years, 4 months ago) |
|
|
Edited by Mitchnast (07/02/05 02:10 PM)
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: pics from today. out in the wild patch, a la jhonny poppyseed [Re: Mitchnast]
#4364830 - 07/02/05 11:17 PM (4 years, 4 months ago) |
|
|
ok,now ive long been under the impresion that opium poppies are legal to grow for floral uses and seed in canada. i just went over the books and according to the law, the plant, all preparations, andeven the seeds are schedule one. actually growing them could carry life imprisonment. is this right? cause i buy the seeds at any store, for food aND in garden centers, for growing. ive seen them in almost any respectable garden INCLUDING public civic gardens. i could walk around town and point out dozens of old cogers guilty of an idictable offence with HUGE penalties.
ive never known ANYONE to be charged for growing and evry horticulturist ive spoken to has assured me that papaver somniferum is perfectly legal, when according to the actual written law, you cant posses the plant..
am i missing something here? or should i yank up my cabbages?
--------------------
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: pics from today. out in the wild patch, a la jhonny poppyseed [Re: Mitchnast]
#4364837 - 07/02/05 11:20 PM (4 years, 4 months ago) |
|
|
http://www.erowid.org/psychoactives/law/countries/law_canada.shtml
SCHEDULE I
(Sections 2 to 7, 29, 55 and 60)
1. Opium Poppy (Papaver somniferum), its preparations, derivatives, alkaloids and salts, including:
(1) Opium
(2) Codeine (methylmorphine)
(3) Morphine (7,8--didehydro--4,5--epoxy--17--methylmorphinan--3,6--diol)
(4) Thebaine (paramorphine)
and the salts, derivatives and salts of derivatives of the substances set out in subitems (1) to (4), including:
(5) Acetorphine (acetyletorphine)
(6) Acetyldihydrocodeine (4,5--epoxy--3--methoxy--17--methylmorphinan--6--ol acetate)
(7) Benzylmorphine (7,8--didehydro--4,5--epoxy--17 --methyl--3--(phenylmethoxy) morphinan--6--ol)
(8) Codoxime (dihydrocodeinone O--(carboxymethyl) oxime)
(9) Desomorphine (dihydrodeoxymorphine)
(10) Diacetylmorphine (heroin)
(11) Dihydrocodeine (4,5--epoxy--3--methoxy--17--methylmorphinan--6--ol)
(12) Dihydromorphine (4,5--epoxy--17--methylmorphinan--3,6--diol)
(13) Ethylmorphine (7,8--didehydro--4,5--epoxy--3--ethoxy--17--methylmorphinan--6--ol)
(14) Etorphine (tetrahydro--7?--(1--hydroxy--1--methylbutyl)--6,14--endo--ethenooripavine)
(15) Hydrocodone (dihydrocodeinone)
(16) Hydromorphinol (dihydro--14--hydroxymorphine)
(17) Hydromorphone (dihydromorphinone)
(18) Methyldesorphine (?6--deoxy--6--methylmorphine)
(19) Methyldihydromorphine (dihydro--6--methylmorphine)
(20) Metopon (dihydromethylmorphinone)
(21) Morphine--N--oxide (morphine oxide)
(22) Myrophine (benzylmorphine myristate)
(23) Nalorphine (N--allylnormorphine)
(24) Nicocodine (6--nicotinylcodeine)
(25) Nicomorphine (dinicotinylmorphine)
(26) Norcodeine (N--desmethylcodeine)
(27) Normorphine (N--desmethylmorphine)
(28) Oxycodone (dihydrohydroxycodeinone)
(29) Oxymorphone (dihydrohydroxymorphinone)
(30) Pholcodine (3--[2--(4--morpholinyl)ethyl]morphine)
(31) Thebacon (acetyldihydrocodeinone)
but not including
(32) Apomorphine (5,6,6a,7--tetrahydro--6--methyl--4H --dibenzo[de,g]quinoline--10,11--diol)
(33) Cyprenorphine (N--(cyclopropylmethyl)--6,7,8,14--tet- rahydro--7?--(1--hydroxy--1--methylethyl)--6,14--endo --ethenonororipavine)
(34) Nalmefene (17-(cyclopropylmethyl)-4,5?-epoxy-6-methylenemorphinan-3,14-diol)
(34.1) Naloxone (4,5?-epoxy-3,14-dihydroxy-17-(2- propenyl)morphinan-6-one)
(34.2) Naltrexone (17-(cyclopropylmethyl)-4,5?-epoxy-3,14- dihydroxymorphinan-6-one)
(35) Narcotine (6,7--dimethoxy--3--(5,6,7,8--tetrahydro--4- --methoxy--6--methyl--1,3--dioxolos [4,5--g]isoquinolin --5--yl)--1(3H)--isobenzofuranone)
(36) Papaverine (1--[(3,4--dimethoxyphenyl)methyl] --6,7--dimethoxyisoquinoline)
(37) Poppy seed
--------------------
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: pics from today. out in the wild patch, a la jhonny poppyseed [Re: Mitchnast]
#4364868 - 07/02/05 11:29 PM (4 years, 4 months ago) |
|
|
hmm it doesnt include plants on the inclusive list of 'its preparations, derivatives, alkaloids and salts' perhaps that is the loophole, it also make no mention of dried matter. which is relitively useless without futher prep. it mentions neither on the inclusions oR exceptions. hmmm ok. any ideas on this?
--------------------
|
DeQuincy
Paddo hunter

Registered: 03/16/01
Posts: 68
Loc: The Netherlands
Last seen: 1 year, 10 months
|
DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4365529 - 07/03/05 04:13 AM (4 years, 4 months ago) |
|
|
Inspired by Wiccan S's article about "DUTCH COMMERCIAL POPPY CULTIVATION" me and few friends headed off to the Dutch province of Zeeland last week.
We live in the Netherlands and get around quite a bit for work. But none of us had ever seen a commercial poppy field. That said we all live in the middle and west of the country and Zeeland is in the extreme south west. About 200 km from our home town. Anyway we booked a night in a youth hostel near the old town of Domburg. It happened to be an old castle, loved the place:

The first day we hit jackpot, not to far from our hostel we found these fields of joy. Poppies and more poppies as far as you can see:

 Look, all these delicious ripening pods.


 Poppies waving in the wind. Zeeland, being surrounded by the sea (zee=sea) is windy to say the least.
We left all the pods where they are, them being someone lively hood. Except a few for seeds of course.  Anyway we have positive prove that Zeeland is the (smaller)Dutch equivalent of Tasmania. I must say it felt really good to wander through such a big poppy plot. Even my wife, who isn't into opiates, was stunned by their beauty. And she recognized the sweet aroma of poppies, even before we were able to see them.
Love, DeQuincy
-------------------- there's no vestige of a beginning no prospect of an end
(hutton)
if you came to conquer, you'll be king for a day, but you too will deteriorate and quickly fade away...
you have NO CONTROL
(bad religion)
|
rocknliam
happy willowdweller


Registered: 12/12/03
Posts: 307
Last seen: 4 months, 8 days
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: DeQuincy]
#4365654 - 07/03/05 06:10 AM (4 years, 4 months ago) |
|
|
Wow you were able to get that close, that is quite amazing. Beautiful pictures.
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: rocknliam]
#4366192 - 07/03/05 11:23 AM (4 years, 4 months ago) |
|
|
umm woot
seriously.
left to dry in the feild, that would make for some fine floral arrangements.
you know they will be harvested with a combine tho.
--------------------
|
JaguarWarrior101
ShamanicAlchemist InTraining


Registered: 03/23/05
Posts: 184
Loc: State of Euphoria
Last seen: 3 years, 4 months
|
Re: Poppies - from Poppyseed to Opium [Re: Wiccan_Seeker]
#4367731 - 07/03/05 10:32 PM (4 years, 4 months ago) |
|
|
Quote:
Wiccan_Seeker said: Wood alcohol is poison, rubbing alcohol isnt good either and potato alcohol often tastes foul.
Hence the grain alcohol. They mean high proof spirits specifically sold for human consumption.
What about rum? What does rum come from, and would it make a good choice?
-------------------- The above post is purely hypothetical, and should not be considered the true thoughts, opinions, or actions of a real life person.
We perceive. This is hard fact. But what we perceive is not a fact of the same kind, because we learn what to perceive.
~Carlos Castaneda
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
|
morphine is more soluable in cold water than any volitile you would want to try. problem is it dries so damn slow. but at least you can always drink it
|
flowstone
blustering

Registered: 01/25/05
Posts: 6,485
Loc: precious
|
|
Rum is made from sugar cane.
-------------------- these long agonizing months without you...have been long and agonizing..
"War Doesn't Decide Who's Right... It Only Decides Who's Left."
|
Iamthewalrus
every evening Idied and everynight I wasreborn


Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 1 month
|
Re: Poppies - from Poppyseed to Opium [Re: flowstone]
#4371669 - 07/05/05 09:00 AM (4 years, 4 months ago) |
|
|
this a great fucking thread...my poppies are still growing very slow(and I lost all of the ones in the smaller containers) my guess is lack of water + unusally hot summer...I'm thinking of putting down mulched straw in the flower pot till I transplant since it will help hold moisture + keep the roots cool(and add nitrogen to the soil)
Edited by Iamthewalrus (07/05/05 09:03 AM)
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Iamthewalrus]
#4372509 - 07/05/05 02:40 PM (4 years, 4 months ago) |
|
|
  
  
  
 
lots of pod development today, i will be releived when the showy petals stop happening. lastthing i need i some little girl picking a bouquet for her mommy.
--------------------
|
rocknliam
happy willowdweller


Registered: 12/12/03
Posts: 307
Last seen: 4 months, 8 days
|
Re: Poppies - from Poppyseed to Opium [Re: Mitchnast]
#4375019 - 07/06/05 07:59 AM (4 years, 4 months ago) |
|
|
Mitchncast, what are you doing with these, pod harvest, lancing, or just letting them enjoy their life till they die. Or should i say, what is your cat planning on doing with these?
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: Poppies - from Poppyseed to Opium [Re: rocknliam]
#4376430 - 07/06/05 04:04 PM (4 years, 4 months ago) |
|
|
i make lovely floral arrangements,
--------------------
|
Iamthewalrus
every evening Idied and everynight I wasreborn


Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 1 month
|
Re: Poppies - from Poppyseed to Opium [Re: Mitchnast]
#4377379 - 07/06/05 07:46 PM (4 years, 4 months ago) |
|
|
heres a closeup of my only surviving tassies(this is my first time growing plants this year of any kind so I'm cutting myself a lil slack) I just put shredded straw around the poppies to help hold moisture and hopefully keep the roots cooler since its been so fuckin hot this year so far(our normal summer would be perfect for poppys but this summer is hot as hell...anyways a close up of what I got so far...I'm prolly gonna try some more...correct me if I'm wrong but if you start late u will still get a harvest just smaller plants and less opium?


I'm considering also starting persian whites at a different location(I don't want cross breeding...I want to keep these strains pure and get seed)
also planning to try an indoor poppy grow in the future
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Iamthewalrus]
#4378378 - 07/07/05 12:47 AM (4 years, 4 months ago) |
|
|
first off, poppies like the dry. not too dry when young. but you dont want to be watering at all in flower. they also like cool nigts and hot days.
long days stimulate flowering. some jump right to flower, especially thoe cultivated for yeild. long growing isnt good when your buissness needs seed or opium. so general nigrum and album flower early. about 2 weeks earlyier than ornamentals in the same conditions. basic disturbed soil, full sun, and the right nutrients are all keys to size and potency. if thats what you're into. but arguably whatever your purpose. large flowers and pods are best. strains ith natutally larger pods werent nesisarily bred for opium, so if youre groing giganthemums youve got a pod whose flesh and even latex, are low in morphine and codine compaired to strains grown for that purpose.
luckily for those with monkeys, the commonly available bulk seed are strong in bananas.
ornamental varieties are mid-range. probably cultivated for appearance from opium- harvest stocck plants in the old days.
this is merely the oppinion of my humble dancing feces.
personally i like to grow the weak giganthemums, sine i don't need the opium, i just want the flowers for my legal activities. you know, decorating the dried arrangement in my wicker basket shaped like broad topped a chair while i burn patchouli and read romance novels immagining that im fabio. mmmm, im faaaabio. see how i eat figs and ooze machismo. look at my pouty lips, my pouty manhood. saying "come to me" i'm fabio.
nothing weird like consuming opium, just good legal vanity and self-delusion.
that said, hopefully none too "sarcobviously",
late plants have smaller flowers. if very late plants after the days grow short, do not flower at all, but rather grow and cabbage into massive heads, branching into bushes withought stretching into stalks. (Conditions pending) untill the winter freeze.
supposEDLY that survive the winter frozen beneith the snow.
im gonna try it after flowering this year, so if anyone notices all the plants in my garden dissappear after they are all mature pods. im not doing opium, im just being fabio. making room for next years early start. kiss me.
also i diddn't grow weed this year. and i certainly don't mess around with those mushroom things.
guess ill just have to stick to legal highs like datura and nutmeg. mmmm, insipid fatuousness.
--------------------
|
Iamthewalrus
every evening Idied and everynight I wasreborn


Registered: 03/24/04
Posts: 3,744
Loc: Ontario
Last seen: 1 year, 1 month
|
Re: Poppies - from Poppyseed to Opium [Re: Mitchnast]
#4379072 - 07/07/05 08:01 AM (4 years, 4 months ago) |
|
|
I get the feeling you think I"m growing ornamental(or maybe that wasn't directed at me) anyways these are single red tasmanian(supposedly big pods AND potent opium)...I've tried both wet and dry...and when I upped watering on these few poppies I got they started to look more healthy and grow a lil faster...I'm not saying yoru wrong tho...could be strain could be the fact that this is the early stages(you mentioned dry is best wtih flowering) anyways...I'm hoping for at least a few plants that go mature...I'll be happy with that (I'd like to spred this seed around too since I've heard the dealers have a low supply and high demand) thats why I'm growing...for the seed :P
|
liveby
Wasted For Time


Registered: 06/15/04
Posts: 1,507
Last seen: 2 days, 14 hours
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: DeQuincy]
#4398965 - 07/13/05 07:05 AM (4 years, 4 months ago) |
|
|
I wet my pants , nice pictures
--------------------

http://www.bruceeisner.com/ -Creating a Sensible Culture
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: liveby]
#4403521 - 07/14/05 12:34 PM (4 years, 4 months ago) |
|
|
my garden poppies are doing great cept for SHITWADS of aphids. evry plant has them, and they are growing and spreading like cancer. my nigrums finished and the pods are huge for such small plants, and aphids are starting to get at pods and buds. so evry other day ive been wetting foliage and sprinkling juvenile ladybugs that i got at the garden center into the foliage. ive already noiced adults and larvae present, but my aphid problem requires MORE!!
some of my gigs are 4 ft tall and will be an easy 6 by the time they finish. ive got some massive cabbage stretching too. ive also got some signs of nute deficiency (new leaves forming white and twisted) but only in a few and probably due to crowding. plus we have had an overcast rainy week. they really needsome sun.
i haven checked my wild pach in days, im hoping the pods will dry on he plants nbecaue the ones i tried to dry shriveled up.
i just hope in he meantime nobody fucks them up.
i also hope he ladybugs work.
--------------------
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4404053 - 07/14/05 02:17 PM (4 years, 4 months ago) |
|
|
  
   and some ladybugs doing the work
 some datura and morning glory
|
JaguarWarrior101
ShamanicAlchemist InTraining


Registered: 03/23/05
Posts: 184
Loc: State of Euphoria
Last seen: 3 years, 4 months
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4405556 - 07/14/05 08:24 PM (4 years, 4 months ago) |
|
|
I just found out aphids have live young, and they are actually born pregnant!
-------------------- The above post is purely hypothetical, and should not be considered the true thoughts, opinions, or actions of a real life person.
We perceive. This is hard fact. But what we perceive is not a fact of the same kind, because we learn what to perceive.
~Carlos Castaneda
Edited by JaguarWarrior101 (07/14/05 08:25 PM)
|
rocknliam
happy willowdweller


Registered: 12/12/03
Posts: 307
Last seen: 4 months, 8 days
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: JaguarWarrior101]
#4406057 - 07/14/05 10:39 PM (4 years, 4 months ago) |
|
|
JaguarWarrior101 - Hah, that is pretty crazy.
And Mitchncast - Nice beds man, very even, i can't wait till they bloom
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: rocknliam]
#4408945 - 07/15/05 06:08 PM (4 years, 4 months ago) |
|
|
they are starting o bloom now. in other news. heres some in the wild note how dispite their great opium potential, i do not lance them. i wish them to dry on the plant for botanical decor.
 
Edited by Mitchnast (07/17/05 10:20 PM)
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4416307 - 07/17/05 07:39 PM (4 years, 4 months ago) |
|
|
tip for those scraping up opium resudie.
cooked opium is sticky gooey crap. if youre not careful you will lose half of it into the cleanup. wetting your fingertip slightly will allow you to handle it withought it becomming a smeary mess, a tiny bit will disolve, but nothing compaired to the mess caused by getting hunks smeared accross the fingertips, knives, and work surfaces.
by wetting a fingertip you can actually push the tar off the knife into the final container. no more knife-to knife nonsense.
you can always lick the film off your finger if you want a taste anyway. this meathod should produce a very bitter-sweet substance.
oh, and by the way. i saw the ice-o-lation process done. and it works very well, best way ive ever seen. you don't have to use a warm bath, you can use a pan in the oven, just keep he temp at a minimum. most ovens are in farenheight, set it to 150f and you wont destroy the secondary potentiators and still dry the product quickly, which are destroyed at about 167f or 75 c. the cold water extracion part also works well. you don't need much water, opium disolves INCREDIBLY willingly. it will even dissolve into slightly wet opium, so he saturaion point of opium into water is quite high. a low dry heat beats a warm bath when reducing to final product. and its much faster. use a very flat surface, if you get dry spots, just push goo over the dry patch and the dry crusty stuff will redissolve into the goo. contunue drying
if you cant get all the opium scraped up, (it is sticky and soft) re-use the same pan next time, that way it will dissolve back ino the next generation.
the final product of the ice-o-lationmeathod is straightup black tar opium. nothing putty about it. you do get some parcipitate if you cut corners, (sugars and fats) but nothing compaired to puty techniques.
sugars and fats fall out of soluion before opium, you can use a coffee filter at near-completion to be rid of them entirely, youll be able to see them as a brownish fluffy sediment suspended in the fluid.
FOAF tried this and wanted you all to know the things above for informative reference. he also said be careful and be safe. i concurr
he likes the forum.
--------------------
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4416867 - 07/17/05 10:18 PM (4 years, 4 months ago) |
|
|
heres a pic of 16 grams of cold-cooked opium
 arguably it should be substantially more potent than the heat-cooked variety. FOAF hasnt tried it yet. i will update when he does. he grows the same type of poppy as me.he wants to use my poppies, even offered me twice the floral value. but i told him sorry, i don't wanna get mixed up with production of a schedule 1 narcotic.
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4417006 - 07/17/05 10:52 PM (4 years, 4 months ago) |
|
|
foaf has another tip for geting all the opium back, if you cant scrape it all up out of the pan, pour a bit of water in the pan and rub it back into solution. pour it ino a glass and voila, poppy tea. you can also wash your razor, any foil you used for drying or storing, and the opium container when its all gone. Not one little bit need be wasted. as long as you have a little water, you can always reclaim it from even the most complicated of media. it disolves better than sugar.
so no more messing around for those of you who make mesess
the cleanup water is some potent tea. your reward for a job well done.
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4418589 - 07/18/05 10:51 AM (4 years, 4 months ago) |
|
|
  
  
   notice how the plants in the shady part of the garden are all toppled over, direct sun is imporant.
--------------------
|
justb
Stranger
Registered: 07/18/05
Posts: 3
Last seen: 4 years, 3 months
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: liveby]
#4422532 - 07/19/05 07:35 AM (4 years, 4 months ago) |
|
|
Quote:
As last note I would like to add, that, when observing frozen bottles of iceolateonic, which lied in the freezer for too long, I see dendrites of concentrate. Upon melting, these "veins" liquify firstly, hence giving rise to probably an easier, quicker and more reproducable procedure for iceolating.
This is a passage from Ab Strak regarding this tek. I'm wondering if any here have experimented with this tek in this regard?
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: justb]
#4423513 - 07/19/05 12:35 PM (4 years, 4 months ago) |
|
|
  
  
  couple pics from the gartden today, got some nice danish flags out a few peoniflorum bastard crosses. tons of garnet red poppies. and the gigs are in full swing. still waiting for my venus, and black peonys. if i dont get them im taking pics of what came up in their place and demanding my 6.99 back
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4423519 - 07/19/05 12:39 PM (4 years, 4 months ago) |
|
|
oh yes notice the second last pic, the tiki in the background, i found washed up on the beach 2 years ago in halls harbour. it was completely covered wih seaweeds and sponges. i thought it was a log of driftwood untill i picked it up. the neighbors joke that its why my garden grows so well. ....or why im plagued with aphids.
--------------------
|
Wiccan_Seeker
INFJcounselor-idealist


Registered: 02/06/02
Posts: 20,583
Loc: Virgo Supercluster (or b...
Last seen: 1 hour, 57 minutes
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4424634 - 07/19/05 05:31 PM (4 years, 4 months ago) |
|
|
I just got to say.. this thread is turning out so beautifully, with the TEKs and the photoshoots.. Wow. Let's keep it coming!
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Wiccan_Seeker]
#4427939 - 07/20/05 11:21 AM (4 years, 4 months ago) |
|
|
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4428621 - 07/20/05 01:50 PM (4 years, 4 months ago) |
|
|
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4438365 - 07/22/05 02:06 PM (4 years, 3 months ago) |
|
|
floral arrangement
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4441215 - 07/23/05 01:39 AM (4 years, 3 months ago) |
|
|
friend tried the opium, smoked, waste of product, barely threshold however, two knifetips ingested resulted in intense waves of gushing analgesia and euphoria for hours. certainly a strong substance, not to be taken lightly fast acting, powerful, and to the point. in about 15 minute he was gushing, after an hour and a half he reported he experience still intensifying. he talked and talked about anything he was thinking about, normally hes rather quiet. tried to initiate contact with passing strangers, when normally he has a hard time breaking the ice. claimed to have little control of his mind. sounded like fun. i cant do it tho. better half sees it as too risky. i think i would use it for pain tho. realistically. when do i get in any real pain? oh well. just thought i would let you all know i know a guy who did it and he was obvously having a great time for only a small bit. probably a half gram. one max. he said he could really see the addiction potential. compared it to 4 "T4"s never tried those myself. so i doesn't help me get the idea but i immagine alot of folks here know what that's like. i smoked some weed tho. i found evrything he was saying brilliantly hilarious. he was making pictures in his mind clear as day, he said he saw a huge spacecraft moving slowly by. i mentioned things like someone through a porthole or an astronaught sparkwelding on the hull and he would see it. o then i said "immaging a turtle, with a confused look on his face" and bam he saw it. by this time he forgot the game and he cut the next description short to hurry me allong to the punchline. thinking that i was building up some long-winded joke.
he was also singing some song on the radio, and slipped in ideas beween the words, the only thing he could think of tho was "im a retard" and he was grinning powefully the whole time. he also bought a slice of pizza and tore it into many small squares and left it on the bench. alo at ome point he tried to fight, but ended up in the bushes hunched over a public steel ashtray. then he wanted to try hitting me with a stick, i let him but expressed concern that it would look bad. so he started hitting a bench and then realized it was making alot of noise, then away we went. later we were pretending to be aliens and i was whining on and on about the drugery of anal probes and mind wipes. and he was advocating the masters superiority. somehow this got inot a discussion about making really good virtual reality with polarized contact lenses with fiber optic imaging. and how it could be used to change the world. like kidnap the preident tie him to a bed and force a false reality of an aliean autopsy directly into his eyes. then showing a brain transfer, and implant with boot up screen so he would think his brain was stolen and put into a puppet body.. it was alot of fun. i was having almost as much fun just hanging with him i never thought it as a social drug before, guess for some it is.
--------------------
|
NomadicHand
Stranger
Registered: 07/23/05
Posts: 1
Last seen: 4 years, 3 months
|
|
My one surviving poppy! This was the first day he bloomed.
Bloom
A bit over 2 feet tall
Unfortunately I had to kill it. Apparently my mother is familiar with poppies.
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: justb]
#4443597 - 07/23/05 03:35 PM (4 years, 3 months ago) |
|
|
Quote:
As last note I would like to add, that, when observing frozen bottles of iceolateonic, which lied in the freezer for too long, I see dendrites of concentrate. Upon melting, these "veins" liquify firstly, hence giving rise to probably an easier, quicker and more reproducable procedure for iceolating.
oh hmm, so one could use many containers and combine a final inensified product for low-heat reduction, producing a very thick and substantial film. wouldnt multi-stage freezing and seiving be slightly more efficient at retaining solution, i just think perhaps over freezing would trap desired dissolved particles in pockets of ice. and therefore lose more final product
then again. you can always save the meltwater and use it for another extraction with another bunch of material. logistically speaking you dont have to lose anything, because evrything disolves in cold water. you just get a ladder of refinement going, and the final unobtainable ammount (bottom of the ladder when you run out of pods) could just be swallowed up in the form of tea.
hmm. too easy. vERY too easy. this technique, if it became used in any semblence of mainstream would lead to a SERIOUS crackdown on poppy cultivation.
floral enthusiasts like me would suffer. i cannott stress enough caution. if youre making this stuff and getting addicted, YIKES, youre on a fast road to trouble it would be so easy to support your habit and also make money pushing opium to the general drug-class.
the gold would go through their veins, like a thousand railroad trains...
god i hope nobody opens that pandoras box. this stuff started wars. can you immagine if a perfect drug like cold-extract opium became popular? i find the idea scary, the more i find about about papaver somnniferum, the more i feel near a curse. it scares me, its like i was burried and forgotten. and here us kids of a new generation withought the understanding of the socio-cultural impact of a easily obtained powerful narcotic, have dug up the old ways.
its too eay for a moron to do this. i almost feel bad that were discusing it. because where creating knowlage that could and almost certainly WOULD be abused.
scary.
can you immagine people justifying their usage, and not realizing how much they need it.
*shudder*
--------------------
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4444289 - 07/23/05 07:13 PM (4 years, 3 months ago) |
|
|
if anyone here is at poppies.org and knows of any way i could join that community (on appeal or petition) i would LOVE to post there, i read it all the time
--------------------
|
DeQuincy
Paddo hunter

Registered: 03/16/01
Posts: 68
Loc: The Netherlands
Last seen: 1 year, 10 months
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4445751 - 07/24/05 02:36 AM (4 years, 3 months ago) |
|
|
Quite a few of the newest members at poppies.org, including myself although under an other sceen name, were noticed at the little brother site of the PORG: Clubopium. Either you are invited or you ask really politly at:
http://adh.2.forumer.com/index.php?s=f9c7a384798591259018739d34f41918&showforum=4
You can can join or post anonymious (sp?). If joined you can pm the mods who are also mods at the porg. I think you make a good chance.
See you at the porg!
-------------------- there's no vestige of a beginning no prospect of an end
(hutton)
if you came to conquer, you'll be king for a day, but you too will deteriorate and quickly fade away...
you have NO CONTROL
(bad religion)
|
justb
Stranger
Registered: 07/18/05
Posts: 3
Last seen: 4 years, 3 months
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: DeQuincy]
#4446802 - 07/24/05 01:00 PM (4 years, 3 months ago) |
|
|
I certainly understand and share many of your same concerns... But this doesn't really curb my interest and I highly doubt there'll be any type of sudden surge in the commercial production of o. I think making these concerns known is the best thing one can do.
So smoking was a waste, but ingestion wasn't. Interesting... How many times did you freeze/filter? What was the consistency?
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: justb]
#4446862 - 07/24/05 01:24 PM (4 years, 3 months ago) |
|
|
foaf, man foaf.
he ice filtered it 3 times. the consitancy at reduction was a dark brown tonic. slightly syruppy the last reduction was in a pan in the oven at 150f
scraped up the product was a shiny black homologous semi-solid tar. quite sticky
theres a picture of it posted earlier in the thread.
the firend that tried it isnt the same person as the guy who made it BTW. the one who tried it is the second "f" in foaF
anywho, it bubbled and burned in the pipe. friend says in retrospect after having ingested a dosage, he can see how smoking it had an effect, now that he knows what the effects are. but just smoking it it was too weak to notice. i was surprised, seriously, he only ate two knifetip thats like, one cc altogether
--------------------
|
justb
Stranger
Registered: 07/18/05
Posts: 3
Last seen: 4 years, 3 months
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4446896 - 07/24/05 01:39 PM (4 years, 3 months ago) |
|
|
My bad, my bad... 
SWIM's gonna experiment with this tek later this week and will post results. He's gonna experiment with multiple freezing as well as complete freezing and dethawing in the fridge.
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: justb]
#4448067 - 07/24/05 07:19 PM (4 years, 3 months ago) |
|
|
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4478958 - 07/31/05 10:26 PM (4 years, 3 months ago) |
|
|
heres several varieties in pod. notice some are squat shaped like pumpkin gourds while others are round and some are tall.
   most of my gigs are lying down, im holding a couple up here to show the size.
|
muidumees
Stranger
Registered: 08/03/05
Posts: 6
Last seen: 4 years, 2 months
|
Re: DUTCH COMMERCIAL POPPY CULTIVATION, a pictorial [Re: Mitchnast]
#4489188 - 08/03/05 10:06 AM (4 years, 3 months ago) |
|
|
can someone determine a poppy species, if I post a picture here?
thanks.
|
Rah


Registered: 09/07/02
Posts: 4,096
Loc: Canadas Field
Last seen: 5 hours, 52 minutes
|
Re: Poppies - from Poppyseed to Opium [Re: Mitchnast]
#4489837 - 08/03/05 12:54 PM (4 years, 3 months ago) |
|
|
Quote:
Mitchnast said: ok let me see if i got this right, like would it work. , you puree frozen, seedless, dry pods in ice old water, then let sit for hours in the fridge, disolving morphine, then you decant the liquid out, and allow the liquid to freze. then remove ie rystals with a seive, and repeat a few times untill muh water has been sooped away. then you put the remaining alkaloid rich liquid into a tray, and then reduce at about 70c untill all that is left is dry residue. and bingo thats good stong-ass opium?
is that it in a nuthell, or am i missing something obvious/
Yea that seems to be it in a nutshell. I did some research after reading about this and it seems to be the best way to get a very pure poppy tea. But what I couldnt find were any "smoke" reports. I dont personaly like the whole day(or 2) getting thrown away drinking poppy tea. But a nice small smoke shure is nice on a friday afternoon. Anyone have experiance smoking "opium" that was Not gathered by cutting the pods? Either acid base extraction or the meathod meantioned?
-------------------- Reflux the Government.
Trade List!
|
namaste
RuNnINg OwL


Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 2 days, 9 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Rah]
#4494874 - 08/04/05 12:06 PM (4 years, 3 months ago) |
|
|
an old post from shaganoz for smokables, the naphta is useless, follow second recipe
I took 5 dried pods, grinded them up to powder Put the powder in a pot Added 2 cups of water added 1/2 cup vinegar Heatet it until it started to boil, turned down heat so it simmered for 10 minutes, stirred alot the whole time Turned off the oven and let the solution steep for 20 minutes Strained the solution with a strainer into a mug to get rid of plant rests (squeeze all juice out of the plant rests inside a t-short or some cloth) Filtered the solution through a fine grade filter (something like coffe filter) to get rid of more plant materials/sludge Added ammonia to the solution until you see a precipitate form in the clear filtered solution, add until it doesnt get cloudier anymore. Filter through a VERY fine filter, i used one from a "Bubble Bag" set. The crystalized alkaloids (morphine etc) will be left in the filter as a sludge, pour some clean water over it while in the filter to wash it and get rid of ammonia etc. Then I poured some naphta over it to convert it into hcl salt (smokeable) and let it dry for a while, scraped off the stuff with a credit card and dried it a bit more before I smoked it.
After you add the ammonia you may heat the solution to boiling point and turn off heat and the alkaloid crystals will coagulate a bit and settle down on bottom. Makes it a bit easier to filter and get rid of liquid and keep the alkaloid crystal sludge.
--------------------
 
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: Poppies - from Poppyseed to Opium [Re: namaste]
#4498098 - 08/05/05 12:35 AM (4 years, 3 months ago) |
|
|
seems harder and requireing of more additives than simply steeping in cold water, pressing, filtering, then re seeping mush, pressing and filtering again, adding filtrates together, half-freezing and removing ice 3 or 4 times, and then reducing syrup in the oven on a tray at 150f
ive now seen that meathod repeatiadly turn out a consistantly powerful black tar when FOAF did it.
the first bulk water, after filtering/combining and before freezing, is an opaque brown tonic.
best results seem to be with 3-4 parts water to 1 part pod flour. this swells up to a semi-liquid paste, about 3 and a half parts of the water can be pressed out, by logic, an additional steep will aquire 7 8ths of what was missed in the first extract. this makes for a more diluted first tonic, but the water is all removable by freezng/seiving and drying anyway.
so basically as long as you have a big enough container, dont worry about using alot of water.
freeze and seive as many times as it takes to get the liquid to fit in your pan.
if somebody has alot of spare pods to grind try this, i can gaurentee they wont regret it.
also im totally starting to frown upon usage of boiling. all that heat is totally killing off a good chunk of the morphine. not to mention disoving fats and sugars.
foaf has used hot water (shy of boiling) instead of cold, and heat reduction instead of ice-o-lateing. this results in a far lighter more putty-like and notably weaker product than that from the meathod above.
if people are afraid to take a chance on cold water, try it and keep the grind. If you dont think you're getting your goodies out withought the heat, you can always put heat to the grinds and try a separate extraction after you did the cold one.
it is really as simple as ive said in the top paragraph.
--------------------
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: Poppies - from Poppyseed to Opium [Re: Mitchnast]
#4498178 - 08/05/05 12:48 AM (4 years, 3 months ago) |
|
|
   these are the giganthemums some are racketball size but most are stunted from being over crowded or in the shade. i put the ornamentals in the good spots, the gigs pretty much all toppled over.
|
stvip
Strange stranger
Registered: 03/21/05
Posts: 195
Loc: Israel
Last seen: 2 years, 10 months
|
Re: Poppies - from Poppyseed to Opium [Re: Mitchnast]
#4498742 - 08/05/05 02:36 AM (4 years, 3 months ago) |
|
|
So, as a proponent of the iceolation method and as the proprietor of an ungodly goodly amount of poppy plants, what are you going to do with all that foliage (or what do you cautiously speculate distant acquaintances might do)? I've been waiting for quite a while for someone to try salvaging leaf opium (it is opium indeed, because the alkaloid mix is the same as the latex, in contrast to roots).
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: Poppies - from Poppyseed to Opium [Re: stvip]
#4499360 - 08/05/05 10:12 AM (4 years, 3 months ago) |
|
|
i like to think the ammount is QUITE godly 
cant contribute to the production of schedule 1 narcotics tho. heads that dry well are added to floral arrangements, left over foliage and matter is compost.
in fact i just dumped out a bucketfull of poppy matter into the compost yesterday.
--------------------
|
muidumees
Stranger
Registered: 08/03/05
Posts: 6
Last seen: 4 years, 2 months
|
|
Can someone tell me if this is somf. and if it should contain any active components:



Thanks a lot. (sorry if I piced the wrong thread)
|
DeQuincy
Paddo hunter

Registered: 03/16/01
Posts: 68
Loc: The Netherlands
Last seen: 1 year, 10 months
|
|
Those are nice pics of Somniferums. So yes, they are the right kind. As to active components, no one can tell from a photo. But i would be surprised if it is devoid of activity. It is like the English say: The proof of pod is in the eating... 
But that would be very dangerous of cause, with all those highly addictive alkaloids. Take care.
-------------------- there's no vestige of a beginning no prospect of an end
(hutton)
if you came to conquer, you'll be king for a day, but you too will deteriorate and quickly fade away...
you have NO CONTROL
(bad religion)
|
muidumees
Stranger
Registered: 08/03/05
Posts: 6
Last seen: 4 years, 2 months
|
Re: poppy pics [Re: DeQuincy]
#4503194 - 08/06/05 04:17 AM (4 years, 3 months ago) |
|
|
ok, what is wrong then ... ? for two years I have been experiencing with them with zero effects.
last year I collected opium and smoked it - nothing. this year I was smarter, collected the pods and made tea. tried first with 5 big ones. nothing. then crushed all 20 (smaller ones) into one tea, nothing.
how is it possible that the potency is that low if this is real somniferum. I have been taking tramadol for a year but hardly my opiat tolerance is that high.
You wouldnt suprise if it is devoid of activity? Why? How to improve this situation for the next year?
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
|
you say you "crush' into tea? did you mean to say 'grind'? because you pretty much gotta grind them to dust. i also find tea to be rather weak as is concentration helps.
--------------------
|
muidumees
Stranger
Registered: 08/03/05
Posts: 6
Last seen: 4 years, 2 months
|
|
yes, grind of course. tried even evaporating the water after making the tea and I was left with a spoonful of sticky stuff.
smoked it and all I got was irritated lungs.
can the growing enviroment (a normal garden) be so hostile that no morphine content is developed? how to improve it? what else to try instead of simple tea? although I am quite sure that there is no alkloid content in them and I was sure that it must have been something else than somniferum.
|
DeQuincy
Paddo hunter

Registered: 03/16/01
Posts: 68
Loc: The Netherlands
Last seen: 1 year, 10 months
|
|
Muid, this is strange. Maybe you boiled you tea. At high temps, above 85 centigrade, morphine starts to be destroyed. A quick boil should be no problem.
You might have a Tasmanian Thebaine strain, which doesn't contain M. But these T-strains are relative rare and are only grown in Tasmania. Do you know the origin of the seeds?
Growing conditions are important for M-production. Pods grown in the shade for example are less potent. Rain after the they have bloomed is bad.
You might want to try making a "slush poppy". That way nothing of your pods is lost. All needed is a blender and some tasty ingredients. My neighbor uses 3 to 5 fresh pods (she has a small habit), a banana, some milk, two ice cubes and lemonade syrup. Cut the pods open and shake out the immature seeds. Best to have no seeds in the slush. If your have a industrial type of blender, you can leave the crowns and knobs in the mix, but my neighbors isn't strong enough for this so she leaves them out. Make to taste with some sugar and enjoy. Success.
-------------------- there's no vestige of a beginning no prospect of an end
(hutton)
if you came to conquer, you'll be king for a day, but you too will deteriorate and quickly fade away...
you have NO CONTROL
(bad religion)
|
muidumees
Stranger
Registered: 08/03/05
Posts: 6
Last seen: 4 years, 2 months
|
Re: poppy pics [Re: DeQuincy]
#4506255 - 08/07/05 05:33 AM (4 years, 3 months ago) |
|
|
this is strange indeed. (taking into count my severe opioid craving = chronic pain syndrome) are you sure they are somniferum?
I have no idea about the origin. my parents bought the house two years ago and the poppies were just there.
I did not boil the tea at all. I put the grinded stuff (used a regular kitchin combine blender) into a cup and poured boiled water on top of it, letting it stir for 15 minutes.
I have tried everything. first collected the milky stuff, out of the pod, eating it, then making tea out of the same pods, drinking it, carfully also rinsing the blender, as it had some milky stuff stuck on the walls. drank this wash-out-water.
the growing conditions should be quite regular. there are other flowers, strawberries and different vegetables growing well in the garden. the climate conditions are similar to england.
would it make more sense to see that the environment is better or plant new seed for next year? (strange enough, my mom has accepted to do that, if I get the seeds)
Can it be me? High doses of codeine dont give me any buzz at all (240mg) while the first time I took tramadol, it was vow. and I have had an obsession with opiates ever since. I have been on tramadol for a year now, averaging 200mg daily. the only thing I can think off, is that the potency is so low that my tolerance from tramadol makes up for it.
I did get a "feeling" out of it once out of the 5 tries, when I made tea from 3 pods,(but i had had a glass of shamphange as well). it sort of made me close my eyes and find the most comfortable position on the couch, but it passed within 15 minutes.
I will, (if there are any pods left ) try eating the whole pod as well.
|
stvip
Strange stranger
Registered: 03/21/05
Posts: 195
Loc: Israel
Last seen: 2 years, 10 months
|
|
Tramadol blocks MOR (it, or metabolites, is probably an agonist-antagonist; there's a warning in the packae insert of Tramadex, a generic, against using while dependent on opioids as it can precipitate withdrawal symptoms, though I haven't encountered this piece information elsewhere). Hence the lack of effects. I don't think it's good to post a personal question in a general thread, especially a stickied one. This is what makes the Shroomery much more of a chit-chat board than a discussion forum.
Edited by stvip (08/07/05 07:17 AM)
|
muidumees
Stranger
Registered: 08/03/05
Posts: 6
Last seen: 4 years, 2 months
|
Re: poppy pics [Re: stvip]
#4506395 - 08/07/05 08:29 AM (4 years, 3 months ago) |
|
|
>I don't think it's good to post a personal question in a general >thread, especially a stickied one. This is what makes the Shroomery >much more of a chit-chat board than a discussion forum.
Sorry, I never really read through the forum but found the thread on a google search.
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
|
 heres what 54 grams of ice-o-late opium looks like
|
flowstone
blustering

Registered: 01/25/05
Posts: 6,485
Loc: precious
|
|
What do you mean " Ice-O-late" is that the process where you freeze the liquid pod extract half way to separate the morphine salts from the other stuff and then discard the ice?
-------------------- these long agonizing months without you...have been long and agonizing..
"War Doesn't Decide Who's Right... It Only Decides Who's Left."
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
|
thats the one
--------------------
|
psilotatsic
useless


Registered: 04/21/05
Posts: 331
Loc: Here
|
|
Damn i bet thats alot of salts too 54 grams.. yummy
-------------------- "Those whoe truely get high never come back"
|
Rah


Registered: 09/07/02
Posts: 4,096
Loc: Canadas Field
Last seen: 5 hours, 52 minutes
|
|

I made that with by letting pods sit in the fridge with water for 12 hours, then filtered(Could have filtered again) Then froze the liquid twice, removing ice and throwing it away both times. Im guessing 1.5-2g of goo
-------------------- Reflux the Government.
Trade List!
|
JaguarWarrior101
ShamanicAlchemist InTraining


Registered: 03/23/05
Posts: 184
Loc: State of Euphoria
Last seen: 3 years, 4 months
|
Re: poppy pics [Re: Rah]
#4523828 - 08/11/05 08:17 PM (4 years, 3 months ago) |
|
|
How many pods is that from?
-------------------- The above post is purely hypothetical, and should not be considered the true thoughts, opinions, or actions of a real life person.
We perceive. This is hard fact. But what we perceive is not a fact of the same kind, because we learn what to perceive.
~Carlos Castaneda
|
Rah


Registered: 09/07/02
Posts: 4,096
Loc: Canadas Field
Last seen: 5 hours, 52 minutes
|
|
10 or so pods, and the roots
-------------------- Reflux the Government.
Trade List!
|
9005
Stranger
Registered: 08/11/05
Posts: 2
Loc: Southern U.S.
Last seen: 3 years, 11 months
|
Red Rock [Re: Rah]
#4544763 - 08/16/05 11:53 PM (4 years, 3 months ago) |
|
|
Hi everyone, I gotta say this is the most informative forum I've ever visited. Thanks for all the enlightened info, kudos!!! The question that I have is this; How does one make "red rock","white rock" and "dragons blood incense"? I've searched all over this site and have found no mention of these products. Years ago a "foaf" had some red rock and said the experience was pheonominal. Are these real products or is my "foaf" "fos"(full of shit)???
-------------------- Gen 1:11 And God said, Let the earth bring forth grass, the herb yielding seed, [and] the fruit tree yielding fruit after his kind, whose seed [is] in itself, upon the earth: and it was so. Gen 1:12 And the earth brought forth grass, [and] herb yielding seed after his kind, and the tree yielding fruit, whose seed [was] in itself, after his kind: and God saw that [it was] good.
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,750
|
Re: Red Rock [Re: 9005]
#4544892 - 08/17/05 12:16 AM (4 years, 3 months ago) |
|
|
Heh.. red rock or dragons blood incense is...
incense! it's the biggest scam in the book. Not sure why its a scam as it resembles opium in no way, but all across the country, if not world, the scam exists. and there will always be the people who swear what they're getting is real (i love the.. "you can tell it's real because it smells like flowers")
You generally won't find real opium for sale. 99% of anything sold will be this fake crap. If its real.. you or someone nearby should know the very pods it came from. Thats not to say there aren't exceptions. Just always assume, if you're offered opium, that it's fake until proven otherwise. If you know what to look for, you probably won't be proven otherwise.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
stvip
Strange stranger
Registered: 03/21/05
Posts: 195
Loc: Israel
Last seen: 2 years, 10 months
|
Re: poppy pics [Re: Rah]
#4545772 - 08/17/05 05:59 AM (4 years, 3 months ago) |
|
|
Quote:
10 or so pods, and the roots
Leaves contain opium. Roots contain undesirable alkaloids, with negligible amounts of morphine.
|
Rah


Registered: 09/07/02
Posts: 4,096
Loc: Canadas Field
Last seen: 5 hours, 52 minutes
|
Re: poppy pics [Re: stvip]
#4549569 - 08/17/05 11:19 PM (4 years, 3 months ago) |
|
|
You sure about that??
-------------------- Reflux the Government.
Trade List!
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: poppy pics [Re: Rah]
#4549704 - 08/17/05 11:53 PM (4 years, 3 months ago) |
|
|
i know for sure that the roots are pretty much bunk. YES they CONTAIN morphine, but they also are exposed to water frequenly and morphine washes away faster than sugar.
--------------------
|
Rah


Registered: 09/07/02
Posts: 4,096
Loc: Canadas Field
Last seen: 5 hours, 52 minutes
|
|
Yea thats a good point, I dont even like opiots. It was just an experiment to see if it realy worked. My friend said the same as your friend, didnt like smokin it, but was amazed by the power of eating a small amount.
Why do you think smoking it didnt work well? Im guessing purity, but due to the dosage of eating it id think its preaty dam pure. A buddy of mine is doing another test batch to see what he can come up with.
-------------------- Reflux the Government.
Trade List!
|
Mitchnast
Volt Delta


Registered: 10/27/99
Posts: 8,213
Loc: Okanagan
Last seen: 1 day, 11 hours
|
Re: poppy pics [Re: Rah]
#4554779 - 08/19/05 08:51 AM (4 years, 3 months ago) |
|
|
most likely because smoking it only managed to singe the outermost layer, subequently trapping the majority of the morphine inside the mass and heat-damaging much of that which burned. direct flame is damaging. vaporizing works better, but still, the mass must be extremely dry (or youre smoking water vapor) and in powdery form (or youre trapping the good stuff in the mass.
if its not dry the water vaporizes first, in the time it takes to vaporize the water, youve heat-killed the chemicals.
so theoretically you can produce a smokable O his way, but you must have it cracker dry, and you must use a hookah or vaporizer. (i sugget not using tinfoil)
--------------------
|
DeQuincy
Paddo hunter

Registered: 03/16/01
Posts: 68
Loc: The Netherlands
Last seen: 1 year, 10 months
|
|
A note on smoking poppy extracts:
Not so long ago I read a report about caffeine being mixed with opiates (heroin nr 3). The conclusion was that hardcore addicts preferred a 70/30 heroin/caffeine mix over a pure h-product. The reason for this was that the temperature at which opiates vaporises is very close to the temperature where it will decompose. Caffeine on the other hand vaporises at a much lower temp. And while it is vaporising, the heroin will, sort of, tag along. Making much more h available to the user. For the chemists: it is like a steam distillation of a non polar. So my point: if you have some caffeine lying around (and doesn't everybody?) you might want to try a mix a little to your extract. Just a thought...
-------------------- there's no vestige of a beginning no prospect of an end
(hutton)
if you came to conquer, you'll be king for a day, but you too will deteriorate and quickly fade away...
you have NO CONTROL
(bad religion)
|
9005
Stranger
Registered: 08/11/05
Posts: 2
Loc: Southern U.S.
Last seen: 3 years, 11 months
|
Whoa is me....but not really [Re: DeQuincy]
#4599325 - 08/30/05 02:40 PM (4 years, 2 months ago) |
|
|
Today as I looked out my window to see a cloudy sky after the remnants of hurricane Katrina passed through, I shuddered to think of my rookie crop of "Tazzies" were doing. So I jumped on the 4-wheeler to trek off to see how they were doing and my worst fears were confirmed. Two acres of tazzies were gone, along with @200 fem Durban Poisons! My first instinct was too pull my hair out or kick something, but then I thought about those poor unfortunate folks along the gulf coast who lost their lives or their homes. My heart immediately went out to them and it made my own problems seem so trivial. This is more proof that mother nature is a beautiful bitch mistress!!! Guess I'll have to wait until next year to try my first smoke of O. Having said all of that I do have one question. I have seen on Ebay that someone is selling pods, 400 for @$250. Is this a decent price and can tea/laudanum be made from these pods??? Thanks, and pm me if anyone would like to send any "O" donations to the less fortunate...lol...
-------------------- Gen 1:11 And God said, Let the earth bring forth grass, the herb yielding seed, [and] the fruit tree yielding fruit after his kind, whose seed [is] in itself, upon the earth: and it was so. Gen 1:12 And the earth brought forth grass, [and] herb yielding seed after his kind, and the tree yielding fruit, whose seed [was] in itself, after his kind: and God saw that [it was] good.
|
Vertigo6911
Entheobotanist



Registered: 12/04/04
Posts: 1,834
Loc: Netherlands
Last seen: 3 years, 8 days
|
Re: Whoa is me....but not really [Re: 9005]
#4600684 - 08/30/05 08:10 PM (4 years, 2 months ago) |
|
|
hey just because al that incence bein sold is crap doesent mean we shouldent be able to make our won 'real opium' incence does it? doesent any1 know a recepie?
-------------------- -Know ye not that ye are gods?-
My homepage
|
Wysefool
Gulden Draak


Registered: 12/26/02
Posts: 6,009
Loc: BC
Last seen: 7 hours, 11 minutes
|
Re: Whoa is me....but not really [Re: Vertigo6911]
#4601525 - 08/30/05 10:38 PM (4 years, 2 months ago) |
|
|
You could take some poppy leaves and roll them up into tubes and then tie them with a string and get them nice and dry. I imagine sticks of dry leaf like this would burn like incense and smell just like the real deal (because it is )
-------------------- Could be condemned to hell for every sin but littering.
|
campinman
Fun-Guy


Registered: 09/01/05
Posts: 396
Loc: SoOn
Last seen: 7 months, 4 days
|
Re: Whoa is me....but not really [Re: Wysefool]
#4715009 - 09/26/05 03:08 PM (4 years, 1 month ago) |
|
|
so ive got china white seeds, purple tazzies, and another type, got em at an organic seed show, anyone know which will give me the more milky pods? the china whites or the tazzies?
-------------------- No statements made in any post or message by myself should be construed to mean that I am now, or have ever been, participating in or considering participation in any activities in violation of any local, state, or federal laws. All posts are works of fiction.
"I wish my lawn was emo, so it would cut itself."
|
Wiccan_Seeker
INFJcounselor-idealist


Registered: 02/06/02
Posts: 20,583
Loc: Virgo Supercluster (or b...
Last seen: 1 hour, 57 minutes
|
Re: Whoa is me....but not really [Re: campinman]
#4744463 - 10/02/05 06:57 AM (4 years, 1 month ago) |
|
|
I think you mean Persian White 
Persian White is the historic "Opium" poppy and its claim to fame is that it can produce *very* much opium per capsule.
Tasmanians are a modern, intensively improved poppy. They are grown for seed primarily so they likely will give more and bigger pods.
If you decide to take on the huge risk and responsibility of poppies I'd say go for Tazmanians and make tea of the dried heads.
|
BobJizze
That

Registered: 08/26/04
Posts: 97
Loc: Further
Last seen: 3 years, 30 days
|
|
My first impression of dried poppy pods: Very pleasant, not exactly what I expected. Figured it would be like codeine or hydrocodone but it really has its own kinda feel. Waves of pleasantness, uplifting, social, heightened music appreciation, itchy, long lasting, VERY VERY ADDICTIVE. I noticed that I was craving it after the first time, and after a week of straight use I had to stop myself. No physical WD symptoms at all, but def mental symptoms.
|
namaste
RuNnINg OwL


Registered: 12/03/02
Posts: 3,788
Loc: Fiddler's Green
Last seen: 2 days, 9 hours
|
|
My impression was very similar (60 grams split five ways). Nice laid-back feel to it. The next morning I had the most intense meditation session of my life; it was ELECTRIC and felt like I had directly plugged in to the collective-consciousness, like I was pulling in all these really great vibes and sending back out even better ones. However, both my wife and I suffered severve constipation for the next five days.
--------------------
 
"The tint it cast was that of a vagina blowing bubble gum." -- Tom Robbins
|
BobJizze
That

Registered: 08/26/04
Posts: 97
Loc: Further
Last seen: 3 years, 30 days
|
|
Quote:
severve constipation for the next five days.
Serious, that stuff really clogs up the system, hehe
|
Tippinthru
contented

Registered: 04/07/05
Posts: 1,129
Loc: "The Garden"...
|
Re: Poppies -- from Poppyseed to Cooked Opium [Re: BobJizze]
#4997641 - 11/30/05 08:19 AM (3 years, 11 months ago) |
|
|
Wow! great, informative, descriptive and let's not leave out the great pics of the growing stages of the poppy! You guys have put some time in this, and it has paid off. Well done!
-------------------- Perfection is attained by slow degrees; it requires the hand of time...
...
Post Extras:
|
|