

Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!
|
mjshroomer
Sage
Registered: 07/21/99
Posts: 13,774
Loc: gone with my shrooms
|
How Hallucinogenic Drugs Work
#2064691 - 11/02/03 09:39 AM (8 years, 3 months ago) |
|
|
Often I am asked this question as are the other moderators on this forum, and also many of those who visit here are constantly asking this question. So I have scanned an old published paper with the reference. This is from 1987 so it is 18-years-old and some of the info may have drastically been rewritten since but this is a standard paper on the subject used by many other articles in their references to how these drugs interrelate with the human condition and mind. How Hallucinogenic Drugs Work Barry L. Jacobs (1987, "How Hallucinogenic Drugs Work", American Scientist vol. 75:386-392) The site of action for hallucinogenic drugs such as LSD has now been identified. They act in the brain at a specific receptor subtype for the chemical neurotransmitter serotonin. My primary purpose here is to summarize the recent data which have led to this conclusion. This article is an update of an article which appeared in American Scientist in 1979 and which should be consulted for detailed background information (1). Hallucinogenic drugs have been revered in many societies for their use in religious rites or as medicinal agents. Their use in modern Western societies has been much more controversial. On the one hand, they are considered to be dangerous drugs: the Federal Bureau of Narcotics and Dangerous Drugs has placed them in Schedule I, the most restrictive class. The general public has also had a negative attitude towards them, in part because of their association with the antiwar and counter cultural movement of the 1960s. On the positive side, hallucinogenic drugs are considered by some to be a liberating vehicle for exploration of the hidden recesses of the mind (Fig. 1). | Figure 1. Hallucinogenic drugs have been both revered and reviled by humans for centuries. Used by primitive societies as medicinal and inspirational agents, they are classified as dangerous drugs by the US government. Their ability to heighten and distort mental processes has made them objects of interest to both artists and scientists. This drawing made by a professional artist after he recovered from LSD intoxication shows how a hallucinogen can alter a person's sense of space and placement of body parts. (From Psychopharmacology, edited by Robert A. Levitt.) | Scientists have been interested in this drug group for several reasons. Because they produce profound changes in perception and affect, hallucinogenic drugs might provide some insight into these basic psychological processes. Similarly, some consider them to be of particular interest form a mental health perspective since they are psychotomimetic - that is, their effects mimic certain aspects of the major psychoses. Finally, because these impressive effects are often produced by minute quantities (microgram amounts in the case of LSD), hallucinogenic drugs are of particular interest to those who study the brain; their potency implies that the drugs act with specificity at particular sites within the brain. Although a large number of drugs may be considered psychoactive (i.e., influencing psychological processes such as perception, emotion, memory and attention), only a small group are generally identified as hallucinogenic: LSD (lysergic acid diethylamide), 2,5-dimethoxy-4-methylamphetamine (DOM), N,N-dimethyltryptamine (DMT), Psilocin, mescaline, and their congeners. The grouping of these drugs is not arbitrary or simply for the sake of convenience. They can be considered members of the same drug class for two important reasons. First, they elicit a common set of effects (2): sensory-perceptual (distorted time sense; altered sensations of colours, sounds, and shapes, ultimately developing into complex, often multimodal hallucinations; and synesthesia, or mixing of senses); psychic (dreamlike feelings; depersonalisation; and rapid and often profound alternations of affects such as depression or elation); and somatic (dizziness, tingling skin, weakness, tremor, nausea, and increased reflexes). Second, and perhaps more important, these drugs display cross-tolerance - that is, a decrease efficacy of one drug taken shortly after another drug (e.g., 3, 4). Thus, if a person has a full-blown hallucinatory experience following ingestion of LSD, the normal hallucinatory response to mescaline of DOM taken the next day will be dramatically blunted or abolished. Therefore, even though it may be argued, and perhaps correctly so, that drugs such as marijuana and phencyclidine (PCP, or "angel dust") should also be classified as hallucinogenic, they do not belong to the class of LSD-like drugs since they show no evidence of cross-tolerance with them. Not only is evidence of cross-tolerance important for grouping drugs, but it provides presumptive evidence for a common biological site of action and encourages the strategy of searching for a single site in the brain shared by all of the drugs in the class. From a strictly molecular point of view, it is not obvious that this should be the case, since the various drugs are structurally dissimilar (fig. 2): LSD is an ergot derivative; mescaline and DOM are phenylethylamines; and Psilocin and DMT are indoleamines. However, as we shall see, evidence from basic biological studies does indeed support a common site of action for all of them. | | Figure 2. Although hallucinogenic drugs are grouped together by their tendency to elicit common psychic, somatic, and sensory-perceptual effects and by their display of cross-tolerance, they differ in molecular structure. Representatives of the three major classes are LSD (lysergic acid diethylamide), an ergot derivative; mescaline and DOM (2,5-dimethoxy-4-methylamphetamine), which are phenylethylamines; and psilocin and DMT (N,N-dimethyltryptamine), which are indoleamines. | Before proceeding, it will be helpful to trace briefly the events which permit brain cells (neurons) to influence each other. Most neurons in the mammalian brain communicate chemically, as shown diagrammatical in figure 3. Chemicals (neurotransmitters) are released from the axon terminals of one neuron and cross a small gap (synapse) between neurons to forum a chemical bond with a protein receptor produces either excitation or inhibition of the target neuron. If all the inputs to the target neuron summate to produce a sufficient level of excitation at the cell body, the neuron fires or discharges an action potential which propagates down tot the axon, repeating the cycle of release of neurotransmitter into the synaptic gap. A surprisingly large number of substances are thought to mediate chemical neurotransmission in the brain (somewhere between 20 and 50), and additional ones are still being discovered. Many of them are relatively simple molecules, either amino acids or derivatives of amino acids, while others are more complex peptides. A major breakthrough took place in the 1960's, when, using an anatomical method called fluorescence histochemistry, a group of Swedish investigators mapped the location of neurons in the brain that utilize norepeniphrine, dopamine, and serotonin for chemical neurotransmission (5,6). Specification of the location of the cell bodies, axon pathways, and terminals of each of these groups of neurons permitted maps based on neurochemical identify to be drawn. No only did this facilitate the development of more meaningful "wiring diagrams" of the brain, but it attorded scientists the opportunity to study and manipulate particular groups of neurons. The neurons that we shall be examining in detail, those containing serotonin (5-hydroxytryptamine, or 5-HT), have their cell bodies (the point where an action potential is initiated) in a primitive part of the brain called the brainstem (Fig. 4)), which is known to control many basic physiological processes such as respiration and functioning of the cardiovascular system. From this site of origin, the axons of serotonergic neurons project to virtually all portions of the brain, including the most recently evolved neocortex. One complication of this simple picture of chemical neurotransmission that is of special relevance to our story is the fact that each neurotransmitter can act at more than one type of receptor. It is assumed that these receptor subtypes exist for the purpose of diversifying the cellular effects of any given neurotransmitter. Thus, serotonin acts as 5-HT1A, 5HT1B, possibly 5-HT1C, and 5-HT2 receptor subtypes in the brain (Fig. 5). Because the protein molecules, which constitute receptor sites, have slightly different conformations for each subtype, drugs can be developed to stimulate (or block) a particular receptor subtype. This preferential action presumably does not occur under normal physiological conditions, since the endogenous neurotransmitter is active at all the receptor subtypes. Hallucinogens and Serotonin Much of the research on hallucinogenic drugs has focussed on brain serotonin. There are two major reasons for this. First it was discovered early on that many of the major hallucinogens had a molecular structure similar to that of serotonin. Second, animal studies examining brain neurochemistry following administration of hallucinogens invariably reported changes in serotonin. It is not surprising that much of the brain and a number of its neurotransmitters react to the administration of these powerful drugs. However, the only reliable and consistent change common to all LSD-like hallucinogens is seen in brain serotonin, manifesting itself as changes in synthesis, release, catabolism, or receptor action (7). It is well known that he hallucinatory experience is a varied and complex one - in fact, this is one of the hallmarks of hallucinations. Therefore, it may appear naive to speak of these effects being mediated by a single specific neurotransmitter system. However, we are talking about the primary (or initiating) site of action of hallucinogenic drugs. Once a drug acts upon the brain and many of its constituent neurochemical systems. Thus the brain serotonin system acts as a trigger for a multitude of changes whose elaboration generates the hallucinatory experience Research on the role of serotonin in the action of hallucinogenic drugs has gone through three distinct phases, The first phase was initiated in the mid-1950s. It was based on the then recently discovered fact that the LSD molecule was structurally similar to that of serotonin. Investigators correctly reasoned that this might imply that l.SD's effects were mediated by an action on the neurotransmission of serotonin in the brain. Unfortunately, the level of technical expertise in the field of brain research was so primitive at that time that this hypothesis had to be tested on peripheral tissue (i.e., outside the brain), Two different groups of scientist reported that LSD exerted a powerful blockade of serotonin's biological action (8, 9). This hypothesis was quickly challenged, however, by studies employing brom-LSD a close structural analogue of LSD with a single bromine atom attached to it (10). Brom-LSD was less potent as LSD in blocking the action of serotonin in the periphery, but it did not cause hallucinogenic activity in humans We now know that the action of a drug at one site in the body does not necessarily generalize to the drug's action at another site, especially when one site is in the brain and the other is not. In the second phase, the action of hallucinogenic drugs on the brain was examined directly. This work was begun by Daniel Freed man at Yale University in the 1960s. In his neurochemical studies he reported that the administration of hallucinogenic drugs to animals increased the level of brain serotonin and decreased the level of serotonin's metabolic by-products (11). This pattern of results implied that neurons utilizing serotonin for neurotransmission were being turned off or inhibited by the drugs. Technical advances in the mid-1960s permitted the direct testing of this hypothesis. As mentioned above, a group of Swedish investigators had mapped the location of the cell bodies, axons and terminals of several neurotransmitter systems in the brain, including serotonin. With this information in hand, the next logical step was to insert a recording microelectrode into the brain- stem areas where serotonin neurons are most densely aggregated and to administer a hallucinogenic drug. When George Aghajanian at Yale University did this in anaesthetized rats, he found that the characteristically slow (1 or 2 action potentials/second) and highly regular pattern of electrical activity of these neurons was dramatically suppressed by injections of LSD(12). This supported the theory that I so and related hallucinogens acted by directly suppressing the activity of serotonin neurons themselves-the so-called presynaptic hypothesis. Although the hypothesis is attractively parsimonious, there are a number of experimental findings at variance with it. For example, our studies of serotonin neurons in awake, freely moving cats have found that the behavioural effects of LSD (e.g., limb flicking, grooming, head shakes, investigatory and play behaviour, and constant eye movements) greatly outlast the suppression of neuronal activity produced by the drug. Furthermore, animals given repeated doses of LSD ultimately develop tolerance, displaying little or no behavioural response, yet the magnitude of the concomitant suppression of serotonin neuronal activity is undiminished (13). Finally, and perhaps most importantly, some of the major hallucinogens, such as mescaline and DOM, produce robust behavioural effects in spite of failure to suppress significantly serotonin neuronal activity (14). Behavioural pharmacology studies by James Appel at the University of South Carolina also question the presynaptic hypothesis. If the hallucinogenic drugs act by suppressing the activity of brain serotonin neurons, then prior destruction of these neurons (or depletion of serotonin from its axon terminal storage sites) should make the drugs behaviourally inactive, because the system is already maximally suppressed. To the contrary, such manipulations if anything enhance, rather than diminish, the behavioural effects of LSD and related hallucinogens in animals (15-17). Similar results have also been reported in studies on humans (18, 19). These enhanced effects in animals and humans are probably attributable to a proliferation of serotonin receptor sites on the target neurons to which serotonin neurons project. This phenomenon, which often follows neuronal destruction or neurotransmitter depletion, is called "denervation supersensitivity," and the increase in the number of receptor sites appears to be a compensatory response to the decreased input. In this way, synaptic homeostasis is maintained. Postsynaptic action of hallucinogens If hallucinogenic drugs do not exert their important action directly on serotonin neurons, is there an alternative hypothesis which still preserves the concept of a serotonin-like effect? The answer is yes, and the data supporting it represent the third (and current) phase of research on serotonin and hallucinogenic drug action. The hypothesis proposes that LSD and related drugs act directly at receptor sites on serotonin target neurons; Serotonin is known to exert both excitatory and inhibitory actions at these sites. One of the most compelling aspects of the data which support this postsynaptic hypothesis is their convergent nature and the number of different laboratories which have contributed to them. A simple behavioral study was one of the first things that suggested to us the importance of the postsynaptic actions of hallucinogenic drugs (20). We found that the administration of lsd to rats elicited a constellation of behavioral effects that had been shown in previous studies to be produced exclusively by the administration of serotonin or drugs that mimicked its action. Furthermore, the fact that ISO could also elicit this "serotonin syndrome" in animals whose brains were depleted of serotonin demonstrated that LSD acted direct-ly upon serotonin receptors, rather than indirectly through the release of axon terminal stores of serotonin. We also found that neurotoxin-induced destruction of serotonin axon terminals enhanced this behavioral response to lsd (denervation supersensitivity, once again attributable to a proliferation of postsynaptic serotonin receptors). An important extension and generalization of these studies demonstrated that both mescaline and pom also produced the serotonin syndrome (21). Studies employing radioactively labeled compounds that bind to particular receptors with great specificity and high affinity also point to the importance of postsynaptic serotonin receptors in hallucinogenic drug action. With repeated administration, we found that LSD became less and less effective in eliciting the behavioral syndrome in rats (20. 22). This change was accompanied by a significant decrease in the number of serotonin binding sites available on postsynaptic neurons. The specificity of the effect is demonstrated by the fact that no change was found in the availability of receptors for dopamine, another brain neurotransmitter. Recently, these results have been confirmed and extended in an important way. Repeated administration of LSD to rats was found to decrease the availability of the 5-HT: receptor subtype. Binding at the 5-HT, subtypes was unchanged (23).  | Figure 4. All of the cell bodies of neurons containing serotonin are found in the brainstem, a primitive part of the brain that controls many basic physiological processes. The cross section shown here is the brain of a monkey. From the brainstem these neurons send their axons great distances to influence virtually all the major areas of the mammalian central nervous system, including the neocortex, the most recently evolved portion of the brain. The enlargement on the right of a section of the visual neocortex displays the extent to which serotonin axon fibers penetrate the various layers of the neocortex. (After refs 37 and 38.) | Additional evidence favoring the postsynaptic hy-(Hypothesis comes from studies employing monoamine oxidase inhibitors (maois), which are widely used to treat depression in humans. One of the changes that prolonged administration of these drugs produces is a decrease in the number of serotonin receptor binding sites in the brain (24). Irwin Lucki and Alan Frazer at the University of Pennsylvania found that when rats were treated for a number of days with maois and then given drugs, independent of their structure, exert their critical action at a 5-HT2 receptor site (36). They took a series of 22 drugs whose potency to elicit hallucinations in humans was known. The drugs were drawn from the three different structural groups of hallucinogenic drugs: ergot, phenyl ethylamine, and indoleamines. Employing radioactively labelled compounds =, they examined the affinity of these drugs for binding to 5-HT2 receptor sites in brain tissue taken from rat cerebral cortex. They found that the correlation coefficient of human hallucinogenic potency and affinity for binding was nearly perfect. This strongly supports the hypothesis that the strength of a drug's action at the 5-HT2 receptor site predicts its potency in evoking hallucinations in humans.  | Figure 3. Hallucinogenic drugs become involved in the processes by which brain cells—neurons—interact. Such an interaction takes place when one neuron contacts another chemically across a minute synaptic gap. There are many neurotransmitters that mediate synaptic transmission in the brain, but the one that hallucinogens seem to affect most readily is serotonin (5-hydroxytryptamine). This drawing shows an axon terminal of a serotonin-containing neuron (presynaptic neuron) contacting the cell body of one of its target neurons (postsynaptic neuron). Tryptophan, the amino acid precursor of serotonin, is brought to the presynaptic neuron through the blood. Serotonin is synthesized from tryptophan inside the axon terminal and stored in vesicles. When an action potential, generated in the cell body of the neuron, invades the axon terminal, the vesicles release their contents into the synaptic gap and interact with receptors embedded within the postsyinaptic neuron to produce either excitation or inhibition. | A critical experiment remains to be carried out as the ultimate test of the hypothesis. Will pre-treatment of human subjects with drugs that are highly specific antagonists of serotonin's action at the 5-HT2 site block, or markedly attenuate, the hallucinogenic effects of LSD, mescaline, DOM, Psilocin, and DMT? We may have to wait a long time for an answer to this question because of federal restrictions on such experiments. | Figure 5. The picture of chemical neurotransmission shown in Figure 3 is complicated by the fact that the receptors in postsynaptic neurons can be of several different types. This schematic representation demonstrates how a molecule or serotonin (5-HT) might interact with three different types of serotonin receptors (5-HTIA, 5-HTIB and 5-HT2). Current research indicates that LSD and other hallucinogenic drugs exercise their critical action on serotonin neurotransmission by binding to the 5-HT2 receptor subtype. |  | Figure 6. The indole nucleus structure of the serotonin molecule is similar to that of the hallucinogenic drugs LSD, psilocin, and DMT shown in Figure 2. It is this similarity that originally led researchers (0 theorize that LSD was involved in the neurotransmission of serotonin in the brain. | Serotonin and the Brain Data from a variety of different sources lead to the conclusion that hallucinogenic drugs exert their critical action at a specific serotonin receptor subtype, 5-HT2. (Depending on the particular brain area, the action may be either excitatory or inhibitory.) This does not preclude the possible involvement of other neurotransmitters in the action of hallucinogenic drugs. In fact, structural differences in the drug molecules are probably responsible for variations in the phenomenological! Effects produced by them, A major remaining issue is how this triggering action of hallucinogenic drugs at 5-HT; receptors evokes the experience we identify as a hallucination-that is, changes the sensory-perceptual, psychic, and somatic domains. As further progress is made in elucidating the neural substrates of emotion, perception, and other processes, we will better understand how a change in the modulatory influence exerted by serotonin at its receptor sites throughout the central nervous system mediates hallucinogenesis. Recent anatomical studies indicate that tilt 3-HT; receptors are abundantly localized in neocortical, limbic, and brainstem sites. In addition, noninvasive scanning techniques for studying brain function in conscious humans, such .is positron emission tomography (PET) and nuclear magnetic resonance (NMR), are proving invaluable to research on psychoactive drugs. Finally, we may ask what functions are subserved by the other receptor sites where serotonin acts. Recent evidence indicates that one of these sites (5-HT1A) may be important in producing anxiety, while another may be critical in the development of migraines. It is important to remember that under normal conditions serotonin exerts an equal action at all of its receptor sites. However, when one site is selectively activated or blocked, whether by drugs, endogenous biological factors, or environmental toxins, it leads to a perturbation which may be manifested as anxiety, migraines, or hallucinations. 
|
Cypher
Shroom of manyfaces

Registered: 11/02/03
Posts: 69
Loc: Northern Ireland
Last seen: 8 years, 2 months
|
Re: How Hallucinogenic Drugs Work [Re: mjshroomer]
#2064723 - 11/02/03 09:53 AM (8 years, 3 months ago) |
|
|
yet another classy sumup by mj thanks man
-------------------- I think i took too much............
|
Osker246
Stranger


Registered: 07/09/03
Posts: 1,479
Loc: Washington
|
Re: How Hallucinogenic Drugs Work [Re: Cypher]
#2064802 - 11/02/03 10:39 AM (8 years, 3 months ago) |
|
|
Thx mj I was just about to look for this info until I saw this thread.
|
shwowsh
growologist

Registered: 07/29/03
Posts: 236
Loc: Deep in the Heart...
Last seen: 2 months, 19 days
|
Re: How Hallucinogenic Drugs Work [Re: Cypher]
#2064804 - 11/02/03 10:40 AM (8 years, 3 months ago) |
|
|
is this book still available, or do you know of better ones that are more current like you've said?
-------------------- -------------------------------------------------
We're all children here, so could we please start acting like it?
|
mjshroomer
Sage
Registered: 07/21/99
Posts: 13,774
Loc: gone with my shrooms
|
Re: How Hallucinogenic Drugs Work [Re: shwowsh]
#2064814 - 11/02/03 10:45 AM (8 years, 3 months ago) |
|
|
This is a monthly journal found in most university and college libraries in the natural sciences sections. Look it up at your local school of higher learning.
mj
I have other similar articles for later.
They have to pertain to questions usually asked in this forum before I can scan and compress them for the site.
mj
Edited by mjshroomer (11/02/03 11:46 AM)
|
stefan
work in progress

Registered: 04/11/01
Posts: 8,919
Loc: The Netherlands
Last seen: 1 day, 5 hours
|
Re: How Hallucinogenic Drugs Work [Re: mjshroomer]
#2064875 - 11/02/03 11:18 AM (8 years, 3 months ago) |
|
|
Good post MJ, I made it sticky. do other mods agree with the stickiness of this post?
-------------------- click for my music First release!
smooth chillout dub Tales of the Green Dragon EP
prog psy and livesets
older music: ambient and psydub
|
monoamine
umask 077(nonefor you)

Registered: 09/06/02
Posts: 3,095
Loc: Jacksonville,FL
Last seen: 6 years, 4 months
|
Re: How Hallucinogenic Drugs Work [Re: mjshroomer]
#2067006 - 11/03/03 12:48 AM (8 years, 3 months ago) |
|
|
Quote:
THis is from 1987 so it is 16-years-old and some of the info may have drastically been rewritten since but this is a standard paper ont he subject used by many other articles in their references to how these drugs interrealte with the m human condition and mind.
I have no formal backround in any of this stuff,but I don't think the theories presented in this paper have drastically changed. It's a great overview of the neurology behind psychedelics.
The only things I can think of that have changed are that more 5-HT (serotonin) receptor sub types have been found since then (in large part do to the research from SSRI antidepressants which indirectly stemmed from early psychedelic research). We are also more aware of the indirect effects these chemicals have on other neurotransmitter systems. Certain 5-HT receptors may be responsible for the release of dopamine and may have feedback with the slower acting glutamate system.
-------------------- People think that if you just say the word "hallucinations" it explains everything you want it to explain and eventually whatever it is you can't explain will just go away.It's just a word,it doesn't explain anything...
Douglas Adams
|
monoamine
umask 077(nonefor you)

Registered: 09/06/02
Posts: 3,095
Loc: Jacksonville,FL
Last seen: 6 years, 4 months
|
Re: How Hallucinogenic Drugs Work [Re: monoamine]
#2069205 - 11/03/03 10:33 PM (8 years, 3 months ago) |
|
|
This has nothing directly to do with psychedelics,but it's a good medical overview of the function of various serotonin receptors: http://www.pharmacology2000.com/Serotonin/sero2.htm
-------------------- People think that if you just say the word "hallucinations" it explains everything you want it to explain and eventually whatever it is you can't explain will just go away.It's just a word,it doesn't explain anything...
Douglas Adams
|
Lawrence
member


Registered: 08/24/03
Posts: 321
Loc: Canada, Qc
Last seen: 11 months, 18 days
|
Re: How Hallucinogenic Drugs Work [Re: monoamine]
#2114858 - 11/17/03 03:02 AM (8 years, 2 months ago) |
|
|
wow awesome
|
MrMaddHatter
Dementia praecox


Registered: 06/07/02
Posts: 1,418
Loc: Nowhere
|
Re: How Hallucinogenic Drugs Work [Re: mjshroomer]
#2121713 - 11/19/03 12:45 AM (8 years, 2 months ago) |
|
|
Very good info! Thanks!
-------------------- I hate to advocate drugs, alcohol, violence, or insanity to anyone, but they've always worked for me.
Hunter S. Thompson
It's always tea-time, and we've no time to wash the things between whiles.
Don't be a fool, this is a war on drugs. Act like. The government sure does!
|
Kremlin
life in E minor


Registered: 06/07/01
Posts: 1,821
Loc: /export/home/Kremlin
Last seen: 3 months, 9 days
|
Re: How Hallucinogenic Drugs Work [Re: MrMaddHatter]
#2132191 - 11/24/03 09:24 AM (8 years, 2 months ago) |
|
|
Heres another good book:
Snyder, Solomon H. Drugs and the Brain. Scientific American Library, New York. 1996.
--Kremlin
--------------------
"Human suffering has been caused because all too many of us cannot grasp that words are only tools for our use, and that the mere presence of a word in the dictionary does not mean it necessarily refers to something definitive in the real world"
--Richard Dawkins, "The Selfish Gene"
"It is the mind which creates the world about us, and even though we stand side by side in the same meadow, my eyes will never see what is beheld by yours."
-George Gissing
"Without a firm idea of himself and the purpose of his life, man cannot live, and would sooner destroy himself than remain on earth, even if he was surrounded by bread."
--Fyodor Dostoevsky
|
Suby
Deadly ViperAssassinationSquad


Registered: 09/05/02
Posts: 159
Loc: I'm over here now.
Last seen: 3 years, 11 months
|
Re: How Hallucinogenic Drugs Work [Re: Kremlin]
#2145410 - 11/29/03 07:29 PM (8 years, 2 months ago) |
|
|
thanks for the re-fresher. read that someplace back in college. but, forgot most of it while studying ancient history. thanks MJ
-------------------- "Why don't they make the whole plane out of that black box stuff."
Steven Wright.
Some say the glass is half empty, some say the glass is half full, I say, are you going to drink that?
"I'm desperately trying to figure out why kamikaze pilots wore helmets."
|
dookie
humungous fungus

Registered: 06/20/03
Posts: 75
Loc: Sydney
Last seen: 7 years, 1 month
|
Re: How Hallucinogenic Drugs Work [Re: mjshroomer]
#2219942 - 01/05/04 04:08 AM (8 years, 1 month ago) |
|
|
damn! that's pretty much an alternative to erowid.org LOL
--------------------
|
Sterile
mushroom lover

Registered: 03/16/01
Posts: 2,429
Loc: under the Amanita
Last seen: 9 days, 15 hours
|
Re: How Hallucinogenic Drugs Work [Re: mjshroomer]
#2278193 - 01/27/04 02:55 PM (8 years, 18 days ago) |
|
|
Thanx!!!
-------------------- The Source Of The Force
Is The Power Of The Mind
"if you don't like what you're doing, you can always pick up your needle and move to another groove." - timothy leary"
Anno: "-I can do anything with those clouds!"
Annos Tek
psy-harmonics
innerrave Enlightenment By Dancing
|
mjshroomer
Sage
Registered: 07/21/99
Posts: 13,774
Loc: gone with my shrooms
|
Re: How Hallucinogenic Drugs Work [Re: Sterile]
#2278763 - 01/27/04 06:00 PM (8 years, 18 days ago) |
|
|
You are all welcome,
mj
|
Anonymous
|
Re: How Hallucinogenic Drugs Work [Re: mjshroomer]
#2295205 - 02/02/04 06:31 PM (8 years, 12 days ago) |
|
|
as long as they work and i know they work..... im satisfied
|
masterg
Stranger
Registered: 05/09/03
Posts: 275
Loc: CA
Last seen: 5 years, 11 months
|
Re: How Hallucinogenic Drugs Work [Re: ]
#2425213 - 03/12/04 06:27 PM (7 years, 10 months ago) |
|
|
Very nice post. Thanks a bunch for taking the time to post it, mang.
-------------------- Peace,
masterg
|
mjshroomer
Sage
Registered: 07/21/99
Posts: 13,774
Loc: gone with my shrooms
|
Re: How Hallucinogenic Drugs Work [Re: masterg]
#2429913 - 03/13/04 10:31 PM (7 years, 10 months ago) |
|
|
Thou art ,pst welcome.
mj
|
Annom
※※※※※※


 Registered: 12/22/02
Posts: 6,228
Loc: Europe
Last seen: 3 hours, 20 minutes
|
Re: How Hallucinogenic Drugs Work [Re: mjshroomer]
#2704763 - 05/20/04 07:03 AM (7 years, 8 months ago) |
|
|
This is one of the best posts here... Thanks MJ.
/bump this sticky
|
mjshroomer
Sage
Registered: 07/21/99
Posts: 13,774
Loc: gone with my shrooms
|
Re: How Hallucinogenic Drugs Work [Re: Annom]
#2704943 - 05/20/04 08:32 AM (7 years, 8 months ago) |
|
|
You asre most graceiously welcomed!
mj
|
z3n
Stranger
Registered: 05/19/04
Posts: 10
Last seen: 6 years, 9 months
|
Re: How Hallucinogenic Drugs Work [Re: mjshroomer]
#2719047 - 05/23/04 02:58 PM (7 years, 8 months ago) |
|
|
do shrooms make your brain bleed?
|
mjshroomer
Sage
Registered: 07/21/99
Posts: 13,774
Loc: gone with my shrooms
|
Re: How Hallucinogenic Drugs Work [Re: z3n]
#2719418 - 05/23/04 04:44 PM (7 years, 8 months ago) |
|
|
No!
Why do you ask?
Are you dripping or letting seep and ooze plasma out your ears and nostrils?
mj
|
redgreenvines
irregular verb


Registered: 04/08/04
Posts: 13,323
|
Re: How Hallucinogenic Drugs Work [Re: mjshroomer]
#2757067 - 06/02/04 01:12 PM (7 years, 8 months ago) |
|
|
I just posted this to the question about poisoning and hallucinations, some poisonings can induce the halucinogenic EFFECT, but the effect is natural and does not require poison - in particular my choice is salvia so the 6 level scale helps resolve my theory, it does not change what is posted about serotonin, but it illustrates macroscopically what legions of synapses firing in this unique way can produce:
OK, here is my theory which is mine
consider a 3-d movie projector - it is your cerebral cortex. all input at all times is comming in to this screen ( the cortex) the input is bioelectronic and we know it is vibratory.
the term to describe the vibratory input is tetany - a series of impulses that gradually fades.
the impulses come from 5 senses and from within the brain (incl memory/thought and feelings - pleasure pain and indifference)
each moment of resonant experiencing involves the tetanic projection energy in vibrations onto the cortex. It is like a discrete layer but the gestalts is more fluid than a cel in an animation film, many things are arising while others are fading, however we do experience out own integration of this as discrete moments, and things that are experienced together are associated in memory by the fixation process.
Now consider the next moment arising and being experienced - a memory trace of the previous pattern is now attached as the FADING LAYER or projection on the cortex.
They blend and overlay like frames of celluloid movie, but 3-d experiencing (I am avoiding the term reality).
entheogen extends the fadeout of tetany and so prolongs the persistence of fading experiencing so you get a thicker now - a sense of more dimensions.
If we allow it, the dimensions blend - partial experiences of one moment are connected to partials of another (impossible? not at all) and we get hybrid experiences or hallucinatory experiences.
we can also get multiple selves, and cascades of fractals if we reflect on seeing our reflected ideas and geometries.
I think that this effect can engage, disengage and re-engage so we can move through the levels of the S-A-L-V-I-A Scale.
The longer the fadeout the more overlapping of input signals and higher on the scale. At the greatest overlapping (about 12-25 layers - tolerance varies per person) one cannot distinguish what is happenning or recall it later - Amnesia. (#6) At high but not extreme overlapping (about 8-17 layers of gestalt) one can easily lose sense of body and place but drift into memory places - Immaterial. (#5) At medium overlapping (about 6-12 layers of gestalt) we get visions with eye open - Vivid. (#4) at modest overlapping( about 4-9 layers of gestalt) we get light vision enhancement -Light visual.(#3) at low overlapping (about 3-6 layers of gestalt) we are altered slightly - Altered (#2) at mere effect (about 2-4 layers of gestalt) we are only subtly altered - Subtle. (#1)
It is still the salvia scale with margin for variance in that some people seem unaffected even though their universe can be heavily layered - maybe it is always ringing for them, maybe they are actually the lucky ones. I am the kind that will collapse in confusion at 12 layers since I escallate by reflection and my take on 6 layers -when noticed- gets retaken 6 times to seem like 36 etc. (You might call that a fractal resonance of reflective experiencing). Anyway I like 6-10 extra potential dimensions. level 4-5.
|
TheHateCamel
Research &Development -DBK
Registered: 01/31/03
Posts: 15,738
|
Re: How Hallucinogenic Drugs Work [Re: mjshroomer]
#2757530 - 06/02/04 03:25 PM (7 years, 8 months ago) |
|
|
THis is something I think trendal posted for me that might belong in this thread, it is a theory about CEVs;
Secrets of an acid head
New Scientist vol 170 issue 2296 - 30 June 2001, page 26
Tripping on hallucinogenic drugs reveals more about our inner selves than the hippies ever bargained for, says Dana Mackenzie
IN A DORM ROOM dimly lit by a lava lamp, a freshman awaits the beginning of his first LSD trip. Slowly, the walls come alive and begin to dance with colour. And then he sees whirling spirals of stars that disappear into the distance. A network of cobwebs that grows across the room. An infinite subway tube, surrounded by fluorescent lights...
Across campus, his science teachers experience their own psychedelic visions?but without resorting to illegal mind-altering substances. Jack Cowan, a mathematician and neuroscientist at the University of Chicago, has built a neural network so powerful it can trip out. His computer's hallucinations match with almost spooky accuracy the visions of acid trippers, shamans and seers?visions that have always been interpreted as revelations from a transcendental consciousness.
Now, after more than two decades, Cowan and his team think they have found where hallucinations really come from. And there's nothing transcendental about it. An LSD trip is really a journey into the brain, says Cowan. "It's just the innate tendency of the brain to make patterns when it goes unstable."
Cowan's goal is to find out how the brain makes sense of the visible world?not when we're tripping, but under ordinary circumstances. In the process, he may learn how it breaks down in other extraordinary conditions, such as migraine headaches. Hallucinations could even offer a route to the more profound depths of the mind, to emotions and conscious thought.
Hallucinations seem to come in an endless variety, as individual as dreams. So it seems improbable that they can even be categorised, never mind calculated by a computer. But in the 1920s, Heinrich Kl?ver, a neuroscientist at the University of Chicago, discovered they did indeed fall into a number of distinct categories. Kl?ver interviewed dozens of people who had taken the drug mescaline, and even took it himself. Keeping a commendably straight head, Kl?ver eventually saw patterns in the patterns.
In the earliest stages of a trip, most subjects reported seeing abstract, geometrical images. Other writers have noted the same thing. "The typical mescaline or lysergic acid experiment begins with perceptions of coloured, moving, living geometrical forms," wrote Aldous Huxley in 1954 in Heaven and hell. "In time, the pure geometry becomes concrete, and the visionary perceives, not patterns, but patterned things, such as carpets, coverings, mosaics." Kl?ver classified these patterns into four types or "form-constants": tunnels, spirals, cobwebs and honeycombs.
Unlike Huxley and Kl?ver, Cowan has never sampled the drugs he studies. "I feel bad about it," he says. "I have to rely on all these reports in the literature." He also hears plenty of personal accounts from students and others who attend his lectures. "Some people see these illusions when they're going to sleep or waking up," Cowan says. "People have seen them after taking anaesthetics. People claim to see them when they meditate, or have so-called near-death experiences." Cowan believes that the "tunnel of light" illusion commonly reported in near-death experiences is simply the first of Kl?ver's four form-constants.
Cowan was turned on to the study of hallucinations from an unexpected direction. In 1977 he was working on pattern formation with graduate student Bard Ermentrout when he stumbled across illustrations of Kl?ver's patterns. "We saw immediately that the hallucination patterns were similar to convection patterns," says Cowan.
The convection of hot water involves a delicate interplay of forces. When a pan of water is heated from below, the hot water at the bottom is more buoyant than the water above, and tries to rise. If the temperature difference is not too great, the lower layer sheds its heat by diffusion before it can rise very far, so the water remains stable. But at a certain critical temperature, diffusion is not enough to cool off the lower layer, so plumes of hot water start to rise. Between each pair of rising plumes, cold water descends, so a pattern spontaneously emerges: rolling tubes of water that form parallel stripes, or square or hexagonal cells. Cowan guessed that hallucinations must also be spontaneous patterns of activity produced by two competing forces?this time in the brain. One, like the water's buoyancy, tends to excite neurons while the other, like the diffusion of heat, tends to calm them down. He speculated that this could happen in the primary visual cortex, sometimes called V1. This is a layer of tissue two to three millimetres thick at the back of the brain which serves as the first layer of processing for images gathered by the retina.
To test their idea, Ermentrout and Cowan developed a mathematical model of V1 and gave it a dose of virtual LSD. Their model reflects the fact that each neuron tends to excite its neighbours and inhibit those a little farther away. Then when the eye sees a large, featureless object, like a big red blob of paint, every neuron in the middle of the image will be excited by nearby neurons and inhibited by those farther away. So it receives no net input from other neurons. It's the brain's way of saying, "There's nothing interesting happening here."
LSD upsets this balance. One of the effects of the drug is to allow neurons to fire when there is nothing in the visual field. Ordinarily, a neuron won't start firing unless the input from the retina and from neighbours exceeds a critical threshold. This ensures that if a neuron fires by mistake, it won't convince its neighbours to fire and the activity dies out. But drugs can lower the threshold?LSD does it by making the brainstem secrete less of the inhibitory chemical serotonin. If the threshold is lowered far enough, then excitation starts to beat inhibition, and spontaneous waves of activity form in the brain. It's like turning up the heat under the pan of water. The first patterns that form will be the same ones that are seen in the water: parallel stripes, checkerboards and hexagons.
So why don't LSD users see parallel stripes across their visual field? Because these patterns are in the cortex, not the retina, Cowan reasoned. A lot of cortical real estate is devoted to objects close to the centre of the field of vision, where our sight is sharp, while relatively little is used for peripheral vision. Mapped onto the cortex, an ordinary scene is grossly distorted: objects near the centre loom large, taking up most of the brain area. When you run this distortion backwards, evenly spaced parallel lines in the cortex appear sucked together into the centre of the visual field, creating the visual impression of either a spiral or a tunnel. The regular checkerboard and hexagon patterns turn into spiralling squares or hexagons.
So more than half a century after Kl?ver set out his form-constants, two of them were finally explained. LSD users see spirals and tunnels because those are the real-world objects that fit the patterns of neural firing in their cortex. Timothy Leary, the guru of "tune in, turn on, drop out" fame, speculated in The Psychedelic Experience, "These visions might be described as pure sensations of cellular and sub-cellular processes." So just as Leary guessed, the spaced-out brain is tuning into its own architecture.
But what about the other two form-constants, the cobweb and honeycomb illusions? These are both lacy, filigree patterns, while water boils in fat rolls, so it's obvious the convection analogy won't work here. Cowan was confidant that his theory would provide the framework to understand these hallucinations, too.
In the 1980s, it became clear that the neurons in V1 are not sensitive simply to the position of an image on the retina. Most of them are sensitive to edges, firing if they sense an edge passing through a particular point in the visual field but remain silent if that point is similar to its surroundings. These cells are arrayed in little patches called hypercolumns that represent a particular part of space (see Diagram). Within the hypercolumn, each neuron responds to an edge at a slightly different orientation.
Edge-detecting neurons in the brain
Instead of signalling to their neighbours in the same hypercolumn, these neurons contact their counterparts in different columns, which represent similar orientations in slightly different parts of space. Then, if there really is an edge, neurons with the right orientation excite each other, so the brain is more likely to detect it.
These long-range connections seemed essential to understanding the last two hallucination types, but they added a new level of complexity to Cowan's mathematical model of the cortex. Hot water was no longer a good analogy, because the forces at work there?buoyancy and viscosity?are all short range. Now equations were needed to describe something long range and direction-sensitive. The maths turned out to be like those of a hot gas in a magnetic field.
Cowan and his graduate student Matthew Wiener programmed in these equations, and found many possible waveforms could result. But they couldn't tell which of these patterns would be the first to appear spontaneously. They needed someone who could combine an expert's understanding of quantum mechanics and neuroscience, and in 1998, Cowan found just the person. Paul Bressloff of Loughborough University in Leicestershire had trained as a specialist in quantum gravity, then taken a detour into neural networks. In a few months of intense work at Chicago, he helped Cowan and Marty Golubitsky of the University of Houston work out the waves of activity that should emerge spontaneously among orientation-sensitive cells. The results appeared earlier this year in Philosophical Transactions of the Royal Society (vol 356, p 1).
The winning patterns were those in which the edges naturally close up into small square or hexagonal cells. Cowan's theory precisely reproduces Kl?ver's two missing form-constants. When the fine-edged squares and hexagons on the cortex are filtered back through the retinal map, they look like lacy cobwebs and honeycombs.
So far so good. But has Cowan done any more than confirm a wiring pattern for the brain that neuroscientists had already worked out? He points out that to understand how the brain works, we need more than wiring: we have to know how these circuits actually behave.
In fact, Cowan's model does hint at this. One unexpected outcome is that subtle changes in the wiring of the model brain can cause significant changes to its preferred hallucination patterns. For example, if the long-range connections in the model always run between edge neurons that represent identical orientations, would generate hallucinations resembling herringbone twill. Clearly our brains are not wired this way; if they were, who knows what effect psychedelic visions of tweed blazers might have had on 1960s fashion. To produce cobwebs and hexagons, we actually need the connections to be a little more slapdash. Perhaps the human edge-detection system is wired this way because it helps us spot small, closed contours.
On the other hand, the herringbone patterns may emerge if the chemical stimulation is changed. Perhaps the theory can explain other kinds of visual disturbances that were thought to be unrelated to LSD hallucinations, such as the auras and zigzag patterns seen by people suffering a migraine attack. If so, it could tell us what changes in the brain cause migraines, and perhaps set us on course for a cure.
Lurking in the background is the much bigger issue of where the mind comes from. To what extent is the mind, and all the rich variety of inner experiences that gives us a sense of self, simply a product of physiological processes in the brain? Hallucinations could be a perfect place to start answering this question.
The apostles of the psychedelic sixties scorned the scientific approach to understanding an LSD trip. "Bobbing around in this brilliant, symphonic sea of imagery is the remnant of the conceptual mind," Leary wrote. "On the endless watery turbulence of the Pacific Ocean bobs a tiny open mouth, shouting (between saline mouthfuls), 'Order! System! Explain all this!'" To appreciate a hallucination, Leary said, you have to let go of the urge to rationalise it.
Tom Wolfe pitched in with The Electric Kool-Aid Acid Test. "The White Smocks liked to put it into words, like hallucination and dissociative phenomena. They could understand the visual skyrockets. Give them a good case of an ashtray turning into a Venus flytrap or eyelid movies of crystal cathedrals, and they could groove on that... That was swell. But don't you see??the visual stuff was just the d?cor with LSD... The whole thing was ... the experience ... this certain indescribable feeling ... The experience of the barrier between the subjective and the objective, the personal and the impersonal, the Iand the not-I disappearing ... that feeling!"
Cowan makes no apologies for being one of the White Smocks. He thinks that the "visual skyrockets" and that "certain indescribable feeling" are part and parcel of the same experience. As the drug penetrates to deeper and deeper areas of the brain?visual layers, cognitive layers, emotional layers and, finally, whatever part of the brain gives us our sense of self-awareness?our subjective experience becomes enormously more complicated and richer. And yet what's going on at the cellular level may not be so different at each layer.
"Does that mean that everything can be observed and described?" Cowan asks. "I happen to believe the answer is yes. I don't think there's anything in the brain that science can't ultimately deal with." But the answers aren't going to come along tomorrow. "There are a hundred vision chips, a hundred sound chips. We now understand a bit more about one of the vision chips," he says. Cowan is already planning to look at other aspects of visual hallucinations, such as texture and size perception.
Journeying deeper still into the mind might not be much harder. The neocortex, the layer of the brain that includes V1, is the part that evolved most recently. It is also the part that supposedly makes humans so intelligent. Because it hasn't been around long, its cells are all structurally quite similar, even if their functions are quite different. "The reason this is a note for optimism," says Gary Blasdel of Harvard University, "is that when you really understand the operations that go on in a particular cortical area, it will generalise to other areas." Cowan's computerised visions might just be the beginning of a really cool trip.
|
stolyj
saying hello is
Registered: 05/08/04
Posts: 18
Last seen: 7 years, 5 months
|
Re: How Hallucinogenic Drugs Work [Re: mjshroomer]
#2762021 - 06/03/04 10:48 PM (7 years, 8 months ago) |
|
|
wellll saiid
-------------------- -stoly-
=sygma=
http://www.chairmanjoe.com
|
redgreenvines
irregular verb


Registered: 04/08/04
Posts: 13,323
|
Re: How Hallucinogenic Drugs Work [Re: TheHateCamel]
#2762817 - 06/04/04 09:11 AM (7 years, 8 months ago) |
|
|
so we can observe and classify the experiences, and we can examine the inter neuronal relationships, but to understand it we need a systems approach: 1. something that accommodates non entheogenic experience 2. something that adjusts to entheogen appropriate to dosage. the system I have suggested does accommodate holographic engram recording and recall (normal function) and explains how entheogens generate their amazing results by simply extending the fadeout of tetany (the vibratory arising and fading away of inputs to the cortex - which is screen of awareness or interactive engram display arena).
The inputs are assembled into pictures of the "real world", but when these partial inputs are compunded as happens under the influence, the "real world" becomes hyperreal or expanded.
After I came up with this model in 1974, (of course after a program in vipassana, LSD and lots of Neurobiology Classes) at York U. in Toronto, I declined an offer from my profs. to go to the states to prove it experimentally.
I was thinking that devices that can extract and impose engrams (to and from peoples minds) might not be good for the world was my thinking at the time.
|
kotik
fuckingsuperhero


 Registered: 06/29/04
Posts: 3,531
Last seen: 2 years, 10 months
|
Re: How Hallucinogenic Drugs Work [Re: mjshroomer]
#2849902 - 07/02/04 12:11 AM (7 years, 7 months ago) |
|
|
in lehmans terms, this is how I understand hallucinogenic drugs in the mind:
the normal senses (smell, taste, touch, etc.) all send signals to the usual spots, but under the influence, some of the signals are not received in full.
This forces the brain to "fill in the blanks," or trip.
The same effects can be achieved with voluntary sleep, food, and sensory deprevation.
It is an interesting ritual in many Asian cultures; they will go off into the woods for 3-4 days, drink nothing but enough water to keep them alive, and enough food to keep them from starving. They will simply stay awake as long as possible (which I imagine takes quite a bit of practice), and on the 3rd day, they will start having lucid visions, and even talk to people that aren't there (or are they???).
Anyways, that's the best way I can think of explaining it to anyone.
-------------------- music: myspace.com/soundscientists
.
I have the heart of a child. I keep it in a jar on my shelf.
No statements made in any post or message by myself should be construed to mean that I am now, or have ever been, participating in or considering participation in any activities in violation of any local, state, or federal laws. All posts are works of fiction.
|
faerieskissV
speaker whore

Registered: 07/11/04
Posts: 22
Loc: Long Beach, Ca.
Last seen: 7 years, 7 months
|
Re: How Hallucinogenic Drugs Work [Re: mjshroomer]
#2879293 - 07/11/04 06:16 PM (7 years, 7 months ago) |
|
|
that was some interesting shit *stores into memory bank*..answered quite a few questions
|
adamole666
The UK sub man

Registered: 08/14/04
Posts: 234
Loc: UK, Yorkshire
Last seen: 7 years, 4 months
|
Re: How Hallucinogenic Drugs Work [Re: faerieskissV]
#3013089 - 08/17/04 10:22 AM (7 years, 5 months ago) |
|
|
False impulses
My opinion, they release your inner demons but we dont reconise it because we are too focused on what is going on around us Also, that is why all the shit about trip settings, and stuff is wrong, because, you can still have a bad trip no matter what, if you are in the most comfortable settings with the best people you know. It depends on what demons are about on the day.
-------------------- Pan subs.........libertys.........UK!
Sub man says: "Always check your balls for cancer"
Sub man also says: "Oh susanna, don`t you cry for me"
Sub man says: "When my datura grew, i grew"
Sub man also says: "I`m singing in the rain"
Sub man says: "I`m standing alone, i`m watching you all, i`m watching you sinking......"
Sub man says: "All those moments, lost, like tears in the rain......."
Sub man says:" for your datura, brugmansia, and liberty cap needs, go to:
http://www.angelfire.com/clone/hallucinogen
|
Fucknuckle
Dog Lover

Registered: 04/24/04
Posts: 6,762
|
Re: How Hallucinogenic Drugs Work [Re: mjshroomer]
#3069621 - 08/30/04 01:42 PM (7 years, 5 months ago) |
|
|
Our eye balls have receptors The psycho active chems interfear with their function
With shrooms you can see the receptors. All those little red,blue and purple dots you see???? Those are the individual receptores.
Our brain is confused and we see the confusion
-------------------- What it is, is what it is my Brother.
It is as it is, so suffer thru it.
|
Mykro_Guy
Myco Student


Registered: 05/08/04
Posts: 317
|
Re: How Hallucinogenic Drugs Work [Re: mjshroomer]
#3181726 - 09/26/04 12:38 AM (7 years, 4 months ago) |
|
|
to bad its just a big blur
|
mjshroomer
Sage
Registered: 07/21/99
Posts: 13,774
Loc: gone with my shrooms
|
Re: How Hallucinogenic Drugs Work [Re: Mykro_Guy]
#3190735 - 09/28/04 07:23 AM (7 years, 4 months ago) |
|
|
Mykro_Guy said:
Quote:
"to bad its just a big blur"
If you click on the image, then put your mouse over the bottom right hand corner of the screen image, there is an icon which appears which allows you to enlarge the posted paper even more so it is readable.
mj
|
police
Stranger
Registered: 11/06/04
Posts: 19
Last seen: 7 years, 3 months
|
Re: How Hallucinogenic Drugs Work [Re: Cypher]
#3326690 - 11/06/04 01:08 AM (7 years, 3 months ago) |
|
|
nice post mj
|
Liquidkick
H2O
Registered: 05/03/02
Posts: 2,635
|
Re: How Hallucinogenic Drugs Work [Re: police]
#3407172 - 11/25/04 02:24 AM (7 years, 2 months ago) |
|
|
The talk about, seritonin reciptors getting destroyed disturbs me(or if its not the receptors, then they were talking about something getting destroyed.).
I thought that nothing gets destroyed in the brain when using "magic mushrooms"
I am confused.
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
|
Re: How Hallucinogenic Drugs Work [Re: Liquidkick]
#3407991 - 11/25/04 11:06 AM (7 years, 2 months ago) |
|
|
Can you quote what part you're talking about? I haven't read this in a while, and can't search the pictures. I don't remember ever reading anything like that.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
entiformatie
EvolutionaryMovements

Registered: 03/06/03
Posts: 1,043
Loc: miami, florida
Last seen: 3 years, 3 months
|
Re: How Hallucinogenic Drugs Work [Re: Koala Koolio]
#3408037 - 11/25/04 11:25 AM (7 years, 2 months ago) |
|
|
mushrooms don't kill serotonin receptors (or any other for that matter).
-------------------- /opinion
.sean
|
AnotherDimension
Wanderer in the Land of the Lost

Registered: 06/14/04
Posts: 533
Loc: USA
Last seen: 3 years, 14 days
|
Re: How Hallucinogenic Drugs Work [Re: entiformatie]
#3409982 - 11/25/04 08:37 PM (7 years, 2 months ago) |
|
|
Good to see you are still here mjshroomer. I've been away a few years for studies... but this community really benefits from people with knowledge such as yourself. Great post.
-------------------- Another Dimension
---------------------------
"Come, and trip it as ye go,
On the light fantastick toe."
|
Habeeb420
Stranger

Registered: 12/08/04
Posts: 9
Loc: colorado
Last seen: 7 years, 1 month
|
|
wow nice info, i plan on reading through that tommorow, dont have time now =/ peace
-------------------- sup brothas
|
SoftRat
Stranger
Registered: 08/28/04
Posts: 293
Last seen: 1 year, 3 months
|
Re: How Hallucinogenic Drugs Work [Re: Liquidkick]
#3472729 - 12/09/04 06:47 PM (7 years, 2 months ago) |
|
|
You need to read more carefully! The decress in seritonin receptor sites is a temporary effect causes by high levels of seritonin/LSD etc. It's why you get a resitance with too frequent a use. But when a person wait a while the brain detects the normal seritonin levels and build more receptors. The article talk about how if seritonin is depelted the seritonin recptor levels go way up and a person becomes more sensitive to LSD/shrooms etc
-------------------- Everything I say in these posts is a made up fiction.
|
Laughingparanoid
Stranger
Registered: 01/03/05
Posts: 2
Last seen: 7 years, 1 month
|
Re: How Hallucinogenic Drugs Work [Re: SoftRat]
#3576522 - 01/03/05 07:02 PM (7 years, 1 month ago) |
|
|
Anyone up to putting all of the text from that article into a post?
|
entiformatie
EvolutionaryMovements

Registered: 03/06/03
Posts: 1,043
Loc: miami, florida
Last seen: 3 years, 3 months
|
|
depends... how much you willin to pay?
-------------------- /opinion
.sean
|
entiformatie
EvolutionaryMovements

Registered: 03/06/03
Posts: 1,043
Loc: miami, florida
Last seen: 3 years, 3 months
|
Re: How Hallucinogenic Drugs Work [Re: entiformatie]
#3577885 - 01/04/05 12:06 AM (7 years, 1 month ago) |
|
|
pffft, just kiddin. maybe a couple people could take on that at once?
-------------------- /opinion
.sean
|
Annom
※※※※※※


 Registered: 12/22/02
Posts: 6,228
Loc: Europe
Last seen: 3 hours, 20 minutes
|
Re: How Hallucinogenic Drugs Work [Re: entiformatie]
#3578060 - 01/04/05 12:49 AM (7 years, 1 month ago) |
|
|
We should do that!
How Hallucinogenic Drugs Work
Barry L. Jacobs (1987, "How Hallucinogenic Drugs Work", American Scientist vol. 75:386-392)
The site of action for hallucinogenic drugs such as LSD has now been identified. They act in the brain at a specific receptor subtype for the chemical neurotransmitter serotonin. My primary purpose here is to summarize the recent data which have led to this conclusion. This article is an update of an article which appeared in American Scientist in 1979 and which should be consulted for detailed background information (1).
Hallucinogenic drugs have been revered in many societies for their use in religious rites or as medicinal agents. Their use in modern Western societies has been much more controversial. On the one hand, they are considered to be dangerous drugs: the Federal Bureau of Narcotics and Dangerous Drugs has placed them in Schedule I, the most restrictive class. The general public has also had a negative attitude towards them, in part because of their association with the antiwar and counter cultural movement of the 1960s. On the positive side, hallucinogenic drugs are considered by some to be a liberating vehicle for exploration of the hidden recesses of the mind (Fig. 1).
Scientists have been interested in this drug group for several reasons. Because they produce profound changes in perception and affect, hallucinogenic drugs might provide some insight into these basic psychological processes. Similarly, some consider them to be of particular interest form a mental health perspective since they are psychotomimetic ? that is, their effects mimic certain aspects of the major psychoses. Finally, because these impressive effects are often produced by minute quantities (microgram amounts in the case of LSD), hallucinogenic drugs are of particular interest to those who study the brain; their potency implies that the drugs act with specificity at particular sites within the brain.
Edited by Annom (01/04/05 05:19 AM)
|
Annom
※※※※※※


 Registered: 12/22/02
Posts: 6,228
Loc: Europe
Last seen: 3 hours, 20 minutes
|
Re: How Hallucinogenic Drugs Work [Re: Annom]
#3578375 - 01/04/05 05:11 AM (7 years, 1 month ago) |
|
|
Although a large number of drugs may be considered psychoactive (i.e., influencing psychological processes such as perception, emotion, memory and attention), only a small group are generally identified as hallucinogenic: LSD (lysergic acid diethylamide), 2,5-dimethoxy-4-methylamphetamine (DOM), N,N-dimethyltryptamine (DMT), Psilocin, mescaline, and their congeners. The grouping of these drugs is not arbitrary or simply for the sake of convenience. They can be considered members of the same drug class for two important reasons. First, they elicit a common set of effects (2): sensory-perceptual (distorted time sense; altered sensations of colours, sounds, and shapes, ultimately developing into complex, often multimodal hallucinations; and synesthesia, or mixing of senses); psychic (dreamlike feelings; depersonalisation; and rapid and often profound alternations of affects such as depression or elation); and somatic (dizziness, tingling skin, weakness, tremor, nausea, and increased reflexes). Second, and perhaps more important, these drugs display cross-tolerance ? that is, a decrease efficacy of one drug taken shortly after another drug (e.g., 3, 4). Thus, if a person has a full-blown hallucinatory experience following ingestion of LSD, the normal hallucinatory response to mescaline of DOM taken the next day will be dramatically blunted or abolished. Therefore, even though it may be argued, and perhaps correctly so, that drugs such as marijuana and phencyclidine (PCP, or ?angel dust?) should also be classified as hallucinogenic, they do not belong to the class of LSD-like drugs since they show no evidence of cross-tolerance with them.
Not only is evidence of cross-tolerence important for grouping drugs, but it provides presumptive evidence for a common biological site of action and encourages the strategy of searching for a single site in the brain shared by all of the drugs in the class. From a strictly molecular point of view, it is not obvious that this should be the case, since the various drugs are structurally dissimilar (fig. 2): LSD is an ergot derivative; mescaline and DOM are phenylethylamines; and Psilocin and DMT are indoleamines. However, as we shall see,
|
mjshroomer
Sage
Registered: 07/21/99
Posts: 13,774
Loc: gone with my shrooms
|
|
You can if you have the time.
mj
|
Annom
※※※※※※


 Registered: 12/22/02
Posts: 6,228
Loc: Europe
Last seen: 3 hours, 20 minutes
|
Re: How Hallucinogenic Drugs Work [Re: Annom]
#3610994 - 01/10/05 11:41 PM (7 years, 1 month ago) |
|
|
evidence from basic biological studies does indeed support a common site of action for all of them.
Before proceeding, it will be helpful to trace briefly the events which permit brain cells (neurons) to influence each other. Most neurons in the mammalian brain communicate chemically, as shown diagrammatically in figure 3. Chemicals (neurotransmitters) are released from the axon terminals of one neuron and cross a small gap (synapse) between neurons to forum a chemical bond with a protein receptor produces either excitation or inhibition of the target neuron. If all the inputs to the target neuron summate to produce a sufficient level of excitation at the cell body, the neuron fires or discharges an action potential which propagates down tot the axon, repeating the cycle of release of neurotransmitter into the synaptic gap.
A surprisingly large number of substances are thought to mediate chemical neurotransmission in the brain (somewhere between 20 and 50), and additional ones are still being discovered. Many of them are relatively simple molecules, either amino acids or derivatives of amino acids, while others are more complex peptides. A major breakthrough took place in the 1960?s, when, using an anatomical method called fluorescence histochemistry, a group of Swedish investigators mapped the location of neurons in the brain that utilize norepeniphrine, dopamine, and serotonin for chemical neurotransmission (5,6).
Specification of the location of the cell bodies, axon pathways, and terminals of each of these groups of neurons permitted maps based on neurochemical identify to be drawn. No only did this facilitate the development of more meaningful ?wiring diagrams? of the brain, but it attorded scientists the opportunity to study and manipulate particular groups of neurons. The neurons that we shall be examining in detail, those containing serotonin (5-hydroxytryptamine, or 5-HT), have their cell bodies (the point where an action potential is initiated) in a primitive part of the brain called the brainstem (Fig. 4)), which is known to control many basic physiological processes such as respiration and functioning of the cardiovascular system. From this site of origin, the axons of serotonergic neurons project to virtually all portions of the brain, including the most recently evolved neocortex.
One complication of this simple picture of chemical neurotransmission that is of special relevance to our story is the fact that each neurotransmitter can act at more than one type of receptor. It is assumed that these receptor subtypes exist for the purpose of diversifying the cellular effects of any given neurotransmitter. Thus, serotonin acts as 5-HT1A, 5HT1B, possibly 5-HT1C, and 5-HT2 receptor subtypes in the brain (Fig. 5). Because the protein molecules, which constitute receptor sites, have slightly different conformations for each subtype, drugs can be developed to stimulate (or block) a particular receptor subtype. This preferential action presumably does not occur under normal physiological conditions, since the endogenous neurotransmitter is active at all the receptor subtypes
Edited by Annom (01/10/05 11:48 PM)
|
Annom
※※※※※※


 Registered: 12/22/02
Posts: 6,228
Loc: Europe
Last seen: 3 hours, 20 minutes
|
Re: How Hallucinogenic Drugs Work [Re: Annom]
#3611031 - 01/10/05 11:50 PM (7 years, 1 month ago) |
|
|
Please help me and put this:

into text!
|
redgreenvines
irregular verb


Registered: 04/08/04
Posts: 13,323
|
Re: How Hallucinogenic Drugs Work [Re: Annom]
#3616735 - 01/12/05 03:43 AM (7 years, 1 month ago) |
|
|
"Much of the research on hallucinogenic drugs has focussed on brain serotonin. there are two major reasons for this. First it was discovered early on that many of the major hallucinogens had a molecular structure similar to that of serotonin. Second, animal studies examining brain neurochemistry following adnimistration of hallucinogens invariably reported changes in serotonin.
It is not surprising that much of the brain and a number of its neurotransmitters react to the administration of these powerful drugs. Howerver, the only reliable and consistent change common to all LSD-like hallucinogens is seen in brain serotonin, manifesting itself as changes in synthesis, release, catabolism, or receptor action.
It is well known that he hallucinatory experience is a varied and complex one - in fact, this is one of the hallmarks of hallucinations. Therefore, it may appear naive to speak of these effects being mediated by a single specific neurotransmitter system. However, we are talking about the primary (or initiating) site of action of hallucinogenic drugs. Once a drug acts upon the brain and many of its constituent neurochemical systems.
thus the brain serotonin system acts as a trigger for a multitude of changes whose elaboration generates the hallucinatory experience"
my take:
serotonin is an alternate neurotransmitter in the brain.BUT WHAT DOES IT DO??? well it facilitates sub threashold multiaxxon transmission to cell bodies largely in midbrain structures. Normally you expect One Shot transmission from one neuron to affect only one other neuron, but many neurons running from the cortex to the basal ganglia have branched axxons and emit sub threashold amounts of neurotransmitter to each cell conntacted. serotonin in the region allows these minor chemical triggers to elicit a full response by the receiving cell.
when it is sucked out of a region or blocked in action it inhibits the lesser potentiated circuits (i.e. the weaker subthreashold transmissions do not succeed to trigger).
the whole brain system runs darker and only the most trained circuits when serotonin is depleated or blocked (hence SSRI's help with depression and obsession)
I gave the rest of my theory above about normal brain function, but I will repeat that any substance that increases the persistence of a moment's neural resonance beyond it's natural duration will establish a condition of layered moments (frame stacking) or being subject to psychedellic enhanced life. Increasing the serotonin is a great way to increase the connections and the feedback or echo-ing of associations and primary signals in a moment in the brain.
-------------------- ~~~~~
|
Annom
※※※※※※


 Registered: 12/22/02
Posts: 6,228
Loc: Europe
Last seen: 3 hours, 20 minutes
|
Re: How Hallucinogenic Drugs Work [Re: redgreenvines]
#3618307 - 01/12/05 12:47 PM (7 years, 1 month ago) |
|
|
Great! Thanks!
I'll do some more if I have some time....
|
Anno
Experimenter


 Registered: 06/17/99
Posts: 24,062
Loc: my room
Last seen: 2 days, 1 hour
|
Re: How Hallucinogenic Drugs Work [Re: Annom]
#3630372 - 01/15/05 06:59 AM (7 years, 30 days ago) |
|
|
Pages 6+8: Research on the role of serotonin in the action of hallucinogenic drugs has gone through three distinct phases, The first phase was initiated in the mid-1950s. It was based on the then recently discovered fact that the LSD molecule was structurally similar to that of serotonin. Investigators correctly reasoned that this might imply that l.SD's effects were mediated by an action on the neurotransmission of serotonin in the brain. Unfortunately, the level of technical expertise in the field of brain research was so primitive at that time that this hypothesis had to be tested on peripheral tissue (i.e., outside the brain), Two different groups of scientist reported that LSD exerted a powerful blockade of serotonin's biological action (8, 9). This hypothesis was quickly challenged, however, by studies employing brom-LSD a close structural analogue of LSD with a single bromine atom attached to it (10). Brom-LSD was less potent as LSD in blocking the action of serotonin in the periphery, but it did not cause hallucinogenic activity in humans We now know that the action of a drug at one site in the body does not necessarily generalize to the drug's action at another site, especially when one site is in the brain and the other is not. In the second phase, the action of hallucinogenic drugs on the brain was examined directly. This work was begun by Daniel Freed man at Yale University in the 1960s. In his neurochemical studies he reported that the administration of hallucinogenic drugs to animals increased the level of brain serotonin and decreased the level of serotonin's metabolic by-products (11). This pattern of results implied that neurons utilizing serotonin for neurotransmission were being turned off or inhibited by the drugs. Technical advances in the mid-1960s permitted the direct testing of this hypothesis. As mentioned above, a group of Swedish investigators had mapped the location of the cell bodies, axons and terminals of several neurotransmitter systems in the brain, including serotonin. With this information in hand, the next logical step was to insert a recording microelectrode into the brain- stem areas where serotonin neurons are most densely aggregated and to administer a hallucinogenic drug. When George Aghajanian at Yale University did this in anesthetized rats, he found that the characteristically slow (1 or 2 action potentials/second) and highly regular pattern of electrical activity of these neurons was dramatically suppressed by injections of LSD(12). This supported the theory that I so and related hallucinogens acted by directly suppressing the activity of serotonin neurons themselves?the so-called presynaptic hypothesis.
?Not only is evidence of cross-tolerance important for grouping drugs, but it encourages the strategy of searching for a single site of action in the brain?
Page 7:
Figure 2. Although hallucinogenic drugs are grouped together by their tendency to elicit common psychic, somatic, and sensory-perceptual effects and by their display of cross-tolerance, they differ in molecular structure. Representatives of the three major classes are LSD (lysergic acid diethylamide), an ergot derivative; mescaline and DOM (2,5-dimethoxy-4-methylamphetamine), which are phenylethylamines; and psilocin and DMT (N,N-dimethyltryptamine), which are indoleamines.
|
Anno
Experimenter


 Registered: 06/17/99
Posts: 24,062
Loc: my room
Last seen: 2 days, 1 hour
|
Re: How Hallucinogenic Drugs Work [Re: Anno]
#3630380 - 01/15/05 07:08 AM (7 years, 30 days ago) |
|
|
Page 9
Although the hypothesis is attractively parsimonious, there are a number of experimental findings at variance with it. For example, our studies of serotonin neurons in awake, freely moving cats have found that the behavioral effects of LSD (e.g., limb flicking, grooming, head shakes, investigatory and play behavior, and constant eye movements) greatly outlast the suppression of neuronal activity produced by the drug. Furthermore, animals given repeated doses of LSD ultimately develop tolerance, displaying little or no behavioral response, yet the magnitude of the concomitant suppression of serotonin neuronal activity is undiminished (13). Finally, and perhaps most importantly, some of the major hallucinogens, such as mescaline and dom, produce robust behavioral effects in spite of a failure to suppress significantly serotonin neuronal activity (14). Behavioral pharmacology studies by James Appel at the University of South Carolina also question the pre-synaptic hypothesis. If the hallucinogenic drugs act by suppressing the activity of brain serotonin neurons, then prior destruction of these neurons (or depletion of serotonin from its axon terminal storage sites) should make the drugs behaviorally inactive, because the system is already maximally suppressed. To the contrary, such manipulations if anything enhance, rather than diminish, the behavioral effects of lsd and related hallucinogens in animals (15-77). Similar results have also been reported in studies on humans {18, 19). These enhanced effects in animals and humans are probably attributable to a proliferation of serotonin receptor sites on the target neurons to which serotonin neurons project. This phenomenon, which often follows neuronal destruction or neurotransmitter depletion, is called "de-
|
Annom
※※※※※※


 Registered: 12/22/02
Posts: 6,228
Loc: Europe
Last seen: 3 hours, 20 minutes
|
Re: How Hallucinogenic Drugs Work [Re: Anno]
#3630389 - 01/15/05 07:22 AM (7 years, 30 days ago) |
|
|
Thanks!!! I'm putting everything together in a word document.
Page 9:
Although the hypothesis is attractively parsimonious, there are a number of experimental findings at variance with it. For example, our studies of serotonin neurons in awake, freely moving cats have found that the behavioral effects of LSD (e.g., limb flicking, grooming, head shakes, investigatory and play behavior, and constant eye movements) greatly outlast the suppression of neuronal activity produced by the drug. Furthermore, animals given repeated doses of LSD ultimately develop tolerance, displaying little or no behavioral response, yet the magnitude of the concomitant suppression of serotonin neuronal activity is undiminished (13). Finally, and perhaps most importantly, some of the major hallucinogens, such as mescaline and DOM, produce robust behavioral effects in spite of failure to suppress significantly serotonin neuronal activity (14).
Behavioral pharmacology studies by James Appel at the University of South Carolina also question the presynaptic hypothesis. If the hallucinogenic drugs act by suppressing the activity of brain serotonin neurons, then prior destruction of these neurons (or depletion of serotonin from its axon terminal storage sites) should make the drugs behaviorally inactive, because the system is already maximally suppressed. To the contrary, such manipulations if anything enhance, rather than diminish, the behavioral effects of LSD and related hallucinogens in animals (15-17). Similar results have also been reported in studies on humans (18, 19). These enhanced effects in animals and humans are probably attributable to a proliferation of serotonin receptor sites on the target neurons to which serotonin neurons project. This phenomenon, which often follows neuronal destruction or neurotransmitter depletion, is called ?denervation supersensitivity,? and the increase in the number of receptor sites appears to be a compensatory response to the decreased input. In this way, synaptic homeostasis is maintained.
|
Annom
※※※※※※


 Registered: 12/22/02
Posts: 6,228
Loc: Europe
Last seen: 3 hours, 20 minutes
|
Re: How Hallucinogenic Drugs Work [Re: Anno]
#3630393 - 01/15/05 07:25 AM (7 years, 30 days ago) |
|
|
I just wasted some time
edit: or you wasted some time
edit2: compromise, WE wasted some time
Edited by Annom (01/15/05 07:36 AM)
|
Annom
※※※※※※


 Registered: 12/22/02
Posts: 6,228
Loc: Europe
Last seen: 3 hours, 20 minutes
|
Re: How Hallucinogenic Drugs Work [Re: Annom]
#3630419 - 01/15/05 07:50 AM (7 years, 30 days ago) |
|
|
page 13:
Drugs, independent of their structure, exert their critical action at a 5-HT2 receptor site (36). They took a series of 22 drugs whose potency to elicit hallucinations in humans was known. The drugs were drawn from the three different structural groups of hallucinogenic drugs: ergot, phenyl ethylamine, and indoleamines. Employing radioactively labelled compounds =, they examined the affinity of these drugs for binding to 5-HT2 receptor sites in brain tissue taken from rat cerebral cortex. They found that the correlation coefficient of human hallucinogenic potency and affinity for binding was nearly perfect. This strongly supports the hypothesis that the strength of a drug?s action at the 5-HT2 receptor site predicts its potency in evoking hallucinations in humans.
A critical experiment remains to be carried out as the ultimate test of the hypothesis. Will pre-treatment of human subjects with drugs that are highly specific antagonists of serotonin?s action at the 5-HT2 site block, or markedly attenuate, the hallucinogenic effects of LSD, mescaline, DOM, Psilocin, and DMT? We may have to wait a long time for an answer to this question because of federal restrictions on such experiments.
Serotonin and the brain
Data from a variety of different sources lead to the conclusion that hallucinogenic drugs exert their critical action at a specific serotonin receptor subtype, 5-HT2. (Depending on the particular brain area, the action may
|
Anno
Experimenter


 Registered: 06/17/99
Posts: 24,062
Loc: my room
Last seen: 2 days, 1 hour
|
Re: How Hallucinogenic Drugs Work [Re: Annom]
#3630465 - 01/15/05 08:30 AM (7 years, 30 days ago) |
|
|
How are you doing the translation, manually?
|
Annom
※※※※※※


 Registered: 12/22/02
Posts: 6,228
Loc: Europe
Last seen: 3 hours, 20 minutes
|
Re: How Hallucinogenic Drugs Work [Re: Anno]
#3630473 - 01/15/05 08:34 AM (7 years, 30 days ago) |
|
|
Yes. Do you have a program for that? I couldn't find a good one.
I type pretty fast: 300hits/min.
This is what I get if I use HP scan software(I need to print and scan it, stupid program and loss of quality):
~either exGt,)?):rv or mhib,tOf'/, ) ThJsd~ notprecjude , .
the()ther ~ the a(tion()t n,11tucjnogenic dru~s! In fact# structural
ble fQr vanati(ms in the effect$ pr~
d..A:.i.Ib" t'h' c c
uCcu y t em"
A major rttm4jnlng issue is how thjs triQ;
genng .';.,'. "';0', C:' :.,Q".r:i.,,'~
actionof rect1ptors evokes '
h'c.J "".'t(, "
ht'i
st e ex~nente we tt;;Aenn{yas a nalc U(.inat1on \; al t:' th,lnge5 th{\ p~'ychic. and somat1C lft.main.'i j\s (urther
p'ro;gessis m1de inetucidattn~ the ,~ ,.,c."".".:~~. , ", , ,.c p c
"euraJ substrates (,t( emQtiQn, ~rception, a"d other
l'rtU.Dsses Wil wiii ~tter underst,tnd huw a ,han
g;e irt rc~'..',.- " -c'c.
etc.....
Edited by Annom (01/15/05 08:42 AM)
|
delta9
Active Ingredient


Registered: 10/28/04
Posts: 5,390
Loc: California
Last seen: 1 year, 3 months
|
Re: How Hallucinogenic Drugs Work [Re: Annom]
#3630504 - 01/15/05 08:48 AM (7 years, 30 days ago) |
|
|
Quote:
Annom said: Thanks!!! I'm putting everything together in a word document.
Please no. Use an open format.
-------------------- delta9
|
Anno
Experimenter


 Registered: 06/17/99
Posts: 24,062
Loc: my room
Last seen: 2 days, 1 hour
|
Re: How Hallucinogenic Drugs Work [Re: Annom]
#3630509 - 01/15/05 08:50 AM (7 years, 30 days ago) |
|
|
I use AbbyFinereader. P preprocess the images by resampling them to 300 dpi and scaling them up double the visible size they are now.
you can download a trial: http://www.abbyy.com/download/?param=28844
Page 10
nervation supersensitivity," and the increase in the number of receptor sites appears to be a compensatory response to the decreased input. In this way, synaptic homeostasis is maintained. Postsynaptic action of hallucinogens If hallucinogenic drugs do not exert their important action directly on serotonin neurons, is there an alternative hypothesis which still preserves the concept of a serotonin-like effect? The answer is yes, and the data supporting it represent the third (and current) phase of research on serotonin and hallucinogenic drug action. The hypothesis proposes that LSD and related drugs act directly at receptor sites on serotonin target neurons; Serotonin is known to exert both excitatory and inhibitory actions at these sites. One of the most compelling aspects of the data which support this postsynaptic hypothesis is their convergent nature and the number of different laboratories which have contributed to them. A simple behavioral study was one of the first things that suggested to us the importance of the postsynaptic actions of hallucinogenic drugs (20). We found that the administration of lsd to rats elicited a constellation of behavioral effects that had been shown in previous studies to be produced exclusively by the administration of serotonin or drugs that mimicked its action. Furthermore, the fact that ISO could also elicit this "serotonin syndrome" in animals whose brains were depleted of serotonin demonstrated that LSD acted direct-ly upon serotonin receptors, rather than indirectly through the release of axon terminal stores of serotonin. We also found that neurotoxin-induced destruction of serotonin axon terminals enhanced this behavioral response to lsd (denervation supersensitivity, once again attributable to a proliferation of postsynaptic serotonin receptors). An important extension and generalization of these studies demonstrated that both mescaline and pom also produced the serotonin syndrome (21). Studies employing radioactively labeled compounds that bind to particular receptors with great specificity and high affinity also point to the importance of postsynaptic serotonin receptors in hallucinogenic drug action. With repeated administration, we found that LSD became less and less effective in eliciting the behavioral syndrome in rats (20. 22). This change was accompanied by a significant decrease in the number of serotonin binding sites available on postsynaptic neurons. The specificity of the effect is demonstrated by the fact that no change was found in the availability of receptors for dopamine, another brain neurotransmitter. Recently, these results have been confirmed and extended in an important way. Repeated administration of LSD to rats was found to decrease the availability of the 5-HT: receptor subtype. Binding at the 5-HT, subtypes was unchanged (23). Additional evidence favoring the postsynaptic hy-(Hypothesis comes from studies employing monoamine oxidase inhibitors (maois), which are widely used to treat depression in humans. One of the changes that prolonged administration of these drugs produces is a decrease in the number of serotonin receptor binding sites in the brain (24). Irwin Lucki and Alan Frazer at the University of Pennsylvania found that when rats were treated for a number of days with maois and then given
?A surprisingly large number of substances are thought to mediate chemical neurotransmission in the brain (somewhere between 20 and 50), and additional ones are still being discovered?
|
Anno
Experimenter


 Registered: 06/17/99
Posts: 24,062
Loc: my room
Last seen: 2 days, 1 hour
|
Re: How Hallucinogenic Drugs Work [Re: Annom]
#3630514 - 01/15/05 08:50 AM (7 years, 30 days ago) |
|
|
>Use an open format.
How about HTML (not word html......)
|
delta9
Active Ingredient


Registered: 10/28/04
Posts: 5,390
Loc: California
Last seen: 1 year, 3 months
|
Re: How Hallucinogenic Drugs Work [Re: Anno]
#3630515 - 01/15/05 08:52 AM (7 years, 30 days ago) |
|
|
Quote:
Anno said: >Use an open format.
How about HTML (not word html......)
That'll do for me. most ANYTHING is better than the idiotic mangling word does to data.
-------------------- delta9
|
Anno
Experimenter


 Registered: 06/17/99
Posts: 24,062
Loc: my room
Last seen: 2 days, 1 hour
|
Re: How Hallucinogenic Drugs Work [Re: delta9]
#3630535 - 01/15/05 09:01 AM (7 years, 30 days ago) |
|
|
Page 11:
Figure 3. Hallucinogenic drugs become involved in the processes by which brain cells?neurons?interact. Such an interaction takes place when one neuron contacts another chemically across a minute synaptic gap. There are many neurotransmitters that mediate synaptic transmission in the brain, but the one that hallucinogens seem to affect most readily is serotonin (5-hydroxytryptamine). This drawing shows an axon terminal of a serotonin-containing neuron (presynaptic neuron) contacting the cell body of one of its target neurons (postsynaptic neuron). Tryptophan, the amino acid precursor of serotonin, is brought to the presynaptic neuron through the blood. Serotonin is synthesized from tryptophan inside the axon terminal and stored in vesicles. When an action potential, generated in the cell body of the neuron, invades the axon terminal, the vesicles release their contents into the synaptic gap and interact with receptors embedded within the postsyinaptic neuron to produce either excitation or inhibition.
Page 12:
Figure 5. The picture of chemical neurotransmission shown in Figure 3 is complicated by the fact that the receptors in postsynaptic neurons can be of several different types. This schematic representation demonstrates how a molecule or serotonin (5-HT) might interact with three different types of serotonin receptors (5-HTIA, 5-HT IB and 5-HT2). Current research indicates that LSD and other hallucinogenic drugs exercise their critical action on serotonin neurotransmission by binding to the 5-HT2 receptor subtype.
Figure 6. The indole nucleus structure of the serotonin molecule is similar to that of the hallucinogenic drugs LSD, psilocin, and DMT shown in Figure 2. It is this similarity that originally led researchers (0 theorize that LSD was involved in the neurotransmission of serotonin in the brain.
|
Annom
※※※※※※


 Registered: 12/22/02
Posts: 6,228
Loc: Europe
Last seen: 3 hours, 20 minutes
|
Re: How Hallucinogenic Drugs Work [Re: delta9]
#3630539 - 01/15/05 09:05 AM (7 years, 30 days ago) |
|
|
Quote:
delta9 said:
Quote:
Anno said: >Use an open format.
How about HTML (not word html......)
That'll do for me. most ANYTHING is better than the idiotic mangling word does to data.
Hehehe, I'm not stupid(not all the time). I just tried to make clear that I put everything together, so you guys don't have to do that. It will be HTML of course. I use word until we have everything. Spelling check is handy!
|
delta9
Active Ingredient


Registered: 10/28/04
Posts: 5,390
Loc: California
Last seen: 1 year, 3 months
|
Re: How Hallucinogenic Drugs Work [Re: Annom]
#3630543 - 01/15/05 09:07 AM (7 years, 30 days ago) |
|
|
*nod* carry on. I am but a benefiting observer, and even if it were a word document, I would be just as happy that you put the effort forth for the community
-------------------- delta9
|
Anno
Experimenter


 Registered: 06/17/99
Posts: 24,062
Loc: my room
Last seen: 2 days, 1 hour
|
Re: How Hallucinogenic Drugs Work [Re: Annom]
#3630549 - 01/15/05 09:10 AM (7 years, 30 days ago) |
|
|
I?ll do the references.
|
Anno
Experimenter


 Registered: 06/17/99
Posts: 24,062
Loc: my room
Last seen: 2 days, 1 hour
|
Re: How Hallucinogenic Drugs Work [Re: Anno]
#3630573 - 01/15/05 09:17 AM (7 years, 30 days ago) |
|
|
Or not, since they are hopelessly unreadable.
|
Annom
※※※※※※


 Registered: 12/22/02
Posts: 6,228
Loc: Europe
Last seen: 3 hours, 20 minutes
|
Re: How Hallucinogenic Drugs Work [Re: Anno]
#3631100 - 01/15/05 11:40 AM (7 years, 30 days ago) |
|
|
How Hallucinogenic Drugs Work
Can someone check it?
Anno, can you replace this article http://www.shroomery.org/index/par/24307 with the new one? Let me know if I can help with anything!
I'll contact mjshroomer and replace this thread with the new one as soon as possbible
|
Anno
Experimenter


 Registered: 06/17/99
Posts: 24,062
Loc: my room
Last seen: 2 days, 1 hour
|
Re: How Hallucinogenic Drugs Work [Re: Annom]
#3631469 - 01/15/05 01:40 PM (7 years, 30 days ago) |
|
|
Done and done.
|
mjshroomer
Sage
Registered: 07/21/99
Posts: 13,774
Loc: gone with my shrooms
|
Re: How Hallucinogenic Drugs Work [Re: Annom]
#3632015 - 01/15/05 03:57 PM (7 years, 29 days ago) |
|
|
HI Annom,
Thanks for the work on the paper. I actually found the journal a few days ago in my file cabinet. What it was doing in there i do not knwo. I had planned on making a better copy.
Anyway. Good job.
Thanks Anno for moving o it to the front to replace the bad jpegs I made form an old xerox copy form a folder in my cabinets.
mj
|
Annom
※※※※※※


 Registered: 12/22/02
Posts: 6,228
Loc: Europe
Last seen: 3 hours, 20 minutes
|
Re: How Hallucinogenic Drugs Work [Re: mjshroomer]
#3634270 - 01/16/05 04:18 AM (7 years, 29 days ago) |
|
|
I think there is one(or more) page missing. There is no figure 4 for example. Can you check that?
|
mjshroomer
Sage
Registered: 07/21/99
Posts: 13,774
Loc: gone with my shrooms
|
Re: How Hallucinogenic Drugs Work [Re: Annom]
#3634465 - 01/16/05 07:52 AM (7 years, 29 days ago) |
|
|
Sorry annom,
My mistake. The Journal I have found is Readings from the Scientific American: Altered States of Awareness and the Article I thou was the above one is actually the Hallucinogenic Drugs by Frank Barron (The man who gave Tim Leary shrooms), Murray Jarvik and Sterling Bunnel and was from the April 1964 uissue of the Scientific American Journal.
I will look for fig. 4 in the files.
mj
|
mjshroomer
Sage
Registered: 07/21/99
Posts: 13,774
Loc: gone with my shrooms
|
Re: How Hallucinogenic Drugs Work [Re: mjshroomer]
#3635043 - 01/16/05 12:23 PM (7 years, 29 days ago) |
|
|
Annom,
Here is the missing figure. It can be reposted int he front of the thread and then you can remove it from here.

Have a shroomy day,
mj
|
Annom
※※※※※※


 Registered: 12/22/02
Posts: 6,228
Loc: Europe
Last seen: 3 hours, 20 minutes
|
Re: How Hallucinogenic Drugs Work [Re: mjshroomer]
#3637542 - 01/16/05 11:54 PM (7 years, 28 days ago) |
|
|
Thank you very much!
How Hallucinogenic Drugs Work
I can't update your post, only admins can post full html codes. Anno? (I added figure 4.)
|
ummikko
sika joka eilenn? on pelkk?sika

Registered: 04/02/03
Posts: 1,222
Loc: Finland
Last seen: 1 year, 8 months
|
Re: How Hallucinogenic Drugs Work [Re: Annom]
#3640660 - 01/17/05 06:15 PM (7 years, 27 days ago) |
|
|
Good work.
If you haven't already, you might want to check a book called 50 years of LSD: Current status and perspectives of hallucinogens, expecially an article 5-HT receptor interactions of D-LSD by S.J.Peroutka. The book is over ten years old, but it's still an excellent collection of hallucinogen-related research articles.
-------------------- "All substances are poisons; there is none which is not a poison. The right dose differentiates a poison and a remedy." -Paracelsius
|
Annom
※※※※※※


 Registered: 12/22/02
Posts: 6,228
Loc: Europe
Last seen: 3 hours, 20 minutes
|
Re: How Hallucinogenic Drugs Work [Re: ummikko]
#3642261 - 01/18/05 03:56 AM (7 years, 27 days ago) |
|
|
Thanks! It's on my Amazon wish list!
Price: $101.40
|
Annom
※※※※※※


 Registered: 12/22/02
Posts: 6,228
Loc: Europe
Last seen: 3 hours, 20 minutes
|
Re: How Hallucinogenic Drugs Work [Re: ummikko]
#3642264 - 01/18/05 03:59 AM (7 years, 27 days ago) |
|
|
My local drugs library has it! It's so amazing that they opened a public drug library in my city with more than 55000 books and articles about drugs and addiction.
|
DadeMurphy
H4x0r

Registered: 01/29/03
Posts: 908
Last seen: 1 year, 11 months
|
Re: How Hallucinogenic Drugs Work [Re: Annom]
#3706273 - 01/31/05 02:58 AM (7 years, 14 days ago) |
|
|
I thought I'd add this link: From 2004. It's an excellent and up-to-date summary of information on the hallucinogens, and how they work. It's by David Nichols, creator of several LSD analogs that are more potent by weight than LSD itself! http://www.erowid.org/references/refs_view.php?A=ShowDoc1&ID=6318
-------------------- --------------------------------------------------
|
shymanta
Mad Scientist


Registered: 01/27/05
Posts: 904
|
Re: How Hallucinogenic Drugs Work [Re: DadeMurphy]
#3728623 - 02/04/05 12:09 AM (7 years, 10 days ago) |
|
|
This seems to be the best string to post this question.
Because of the complex tech-speak, it is difficult to tell exactly what the effects on serotonin are. Do Hallucinogens effect serotonin in a negative or positive way? (i.e. Do they deplete serotonin or act as an SSRI)?
|
ummikko
sika joka eilenn? on pelkk?sika

Registered: 04/02/03
Posts: 1,222
Loc: Finland
Last seen: 1 year, 8 months
|
Re: How Hallucinogenic Drugs Work [Re: shymanta]
#3750116 - 02/08/05 06:44 AM (7 years, 6 days ago) |
|
|
Generally, neither. I will try to explain this with help from googled pictures (sorry, I have nothing better that I can upload now, also sorry for possible bad english, it's not my native language)
When we talk about synaptic transmission/neurotransmitters, we're talking about chemical events between two neurons(nerve cells). The first is called the presynaptic neuron, the other is the postsynaptic neuron.
A single neuron, synapses at "terminal buttons", postsynaptic neuron not shown. The terminal buttons connect to the dendrites of another neuron ("receiving end").

SSRI:s inhibit serotonin from being taken back into the presynaptic neuron.
Some drugs stimulate certain synapses by increasing the release of a neurotransmitter from the presynaptic terminals (for example amphetamine causes dopamine release). If all neurotransmitter stored in an axon terminal is released and used, the presynaptic neuron is depleted(for a while), like you said.
Closeup on a synapse:

Now, hallucinogens don't have an effect on the presynaptic neuron. Instead, they resemble the neurotransmitter serotonin, and produce their effects by attaching to the serotonin reseptors on the postsynaptic neuron, and "activate" the receptor. That is, hallucinogens are serotonin agonists.
I couldn't find a good picture on this, anyway, here you can see the location of receptors on the postsynaptic membrane:

Okay, now contrast this mode of action to that of amphetamine which, as said, acts by releasing norepinephrine and dopamine from the presynaptic neurons. If the neurons have a low supply of these neurotransmitters, amphetamine is ineffective. However, even after the complete removal of the presynaptic neurons that release serotonin, hallucinogens still exert their full effect.
Hopefully this clarified things instead of confusing you more
-------------------- "All substances are poisons; there is none which is not a poison. The right dose differentiates a poison and a remedy." -Paracelsius
Edited by ummikko (02/08/05 07:06 AM)
|
ummikko
sika joka eilenn? on pelkk?sika

Registered: 04/02/03
Posts: 1,222
Loc: Finland
Last seen: 1 year, 8 months
|
Re: How Hallucinogenic Drugs Work [Re: DadeMurphy]
#3750154 - 02/08/05 07:02 AM (7 years, 6 days ago) |
|
|
Excellent article, just what I've been looking for. 5 shrooms!
-------------------- "All substances are poisons; there is none which is not a poison. The right dose differentiates a poison and a remedy." -Paracelsius
|
redgreenvines
irregular verb


Registered: 04/08/04
Posts: 13,323
|
Re: How Hallucinogenic Drugs Work [Re: ummikko]
#3750226 - 02/08/05 07:38 AM (7 years, 6 days ago) |
|
|
all fine, so... then what happens?
I was shocked to hear that once the kappa opiate receptor binding propensity of salvinorin was discovered that scientists said, "this is the psychedellic effect of salvia".
(all they had assembled was the primary binding site and nearly nothing about the real effects that we notice)
the interesting stuff (layering etc.) lies in what happens when the neurons are encouraged to keep firing after the excitatory stimulus has faded.
that applies to both serotoninergic and KOR chemical events which become interesting as the whole brain tissue begins to handle stimuli in a more resonant way.
-------------------- ~~~~~
|
ummikko
sika joka eilenn? on pelkk?sika

Registered: 04/02/03
Posts: 1,222
Loc: Finland
Last seen: 1 year, 8 months
|
|
Quote:
redgreenvines said: all fine, so... then what happens?
There is no short answer to this, and I don't know where to begin. DadeMurphy's link provides a good and detailed explanation. A was merely trying to explain the synaptic mechanism to symanta in a nutshell. 
A short attempt of an answer:
serotonin(5-HT) has several types of receptors, each with slightly different properties and different roles in behaviour. (Note that there is only one type of serotonin, but many receptors for serotonin in different areas of the nervous system) LSD(most hallucinogenic research has been done on LSD, so I'm using it as an example) has a strong affinity for some of these types (5-HT 1A, 5-HT 1D, 5-HT 2, 5-HT 1C, 5-HT 5A, 5-HT 5B and 5-HT 7, according to S.J.Peroutka). By binding to these receptors, LSD stimulates them at abnormal times and blocks serotonin from stimulating it the normal way. Presumably, these receptors contribute to perception and conscious experiences in some way, and an abnormal pattern of stimulation of these receptors leads to abnormal perceptions/experiences.
We know where in the brain LSD exerts its effects, but we don't know why those effects induce hallucinations and alter consciousness. The neural basis of consciousness, consious experiences and the mind is not known (the mind-body problem). The chemistry is easier to explain than the psychology.
-------------------- "All substances are poisons; there is none which is not a poison. The right dose differentiates a poison and a remedy." -Paracelsius
|
curenado
73rd Man


Registered: 04/01/03
Posts: 2,601
Loc: North Central Arkansas
Last seen: 1 year, 3 days
|
Re: How Hallucinogenic Drugs Work [Re: ummikko]
#3750556 - 02/08/05 09:34 AM (7 years, 6 days ago) |
|
|
<<the interesting stuff (layering etc.) lies in what happens when the neurons are encouraged to keep firing after the excitatory stimulus has faded.
that applies to both serotoninergic and KOR chemical events which become interesting as the whole brain tissue begins to handle stimuli in a more resonant way. >>
Absolutely!  It shouldn't be any surprise that too many become obsessed of some minuatae at the expnse of the entire concept - that happens across the disciplines. But will science have struggled, at great cost and labor, up this mountain of knowledge - slashing courageously through theory after theory - only to find at the top a group of old shaman drinking cocoa and saying "We told you. Everybody told you. Want some?"
-------------------- Yours in the Natural State!
"The woods are lovely, dark and deep; but I have patches to keep, and jars to sterilize before I sleep...."
|
shymanta
Mad Scientist


Registered: 01/27/05
Posts: 904
|
Re: How Hallucinogenic Drugs Work [Re: mjshroomer]
#3750674 - 02/08/05 10:12 AM (7 years, 6 days ago) |
|
|
Wow, thanks for the reply. That was very informative.
Just to clarify. You're saying that substances that effect the post synaptic neuron will not effect the production/re-uptake/etc. of serotonin because its associated with the pre synaptic neuron?
Also, what happens to the serotonin when a serotonin agonist activates a receptor cell? Does it (the serotonin) build up or absorb back into the pre synaptic neuron?
|
ummikko
sika joka eilenn? on pelkk?sika

Registered: 04/02/03
Posts: 1,222
Loc: Finland
Last seen: 1 year, 8 months
|
Re: How Hallucinogenic Drugs Work [Re: shymanta]
#3750989 - 02/08/05 11:51 AM (7 years, 6 days ago) |
|
|
Quote:
shymanta said: Wow, thanks for the reply. That was very informative.
Just to clarify. You're saying that substances that effect the post synaptic neuron will not effect the production/re-uptake/etc. of serotonin because its associated with the pre synaptic neuron?
Yes! (at least not directly, there may be feedback mechanisms, but that's off the topic)
Quote:
Also, what happens to the serotonin when a serotonin agonist activates a receptor cell? Does it (the serotonin) build up or absorb back into the pre synaptic neuron?
That depends on several factors...
First, the sequence of (normal)chemical events at a synapse is:
1. The neuron synthesises chemicals that serve as neurotransmitters
2. The neuron transports these chemicals to the axon terminals
3. An axon potential causes the release of the neurotransmitters from the terminals
4. The released molecules attach to receptors on the postsynaptic neuron, and alter the activity of that neuron
5. The molecules separate from the receptors and (in some cases) are converted into inactive chemicals. In the case of serotonin, which is a monoamine, this is done by the enzyme MAO (monoamine oxidase). MAOI drugs work by blocking MAO, so monoamine neurotransmitters remain in the synaptic cleft(the space between the pre- and postsynaptic neurons) longer and can thus stimulate the postsynaptic neuron longer without being inactivated.
6. In some cells, some of the neurotransmitters are taken back into the presynaptic cell for reuse or recycling (SSRI:s work by preventing this reuptake so more serotonin is left in to the synaptic cleft where it can rebind with a receptor)
7. In some cells, empty vesicles return to the cell body.
A chemical that can fit to a receptor and activate that receptor is an agonist. A chemical that can fit to a receptor but doesn't activate the receptor(just blocks it) is an antagonist.
The affinity of a chemical (neurotransmitter,drug,whatever) means how well it fits into a given receptor (or "how badly it wants to bind" with the receptor). If the drug has a higher affinity than the neurotransmitter, it will "override" the receptor and can block the actual neurotransmitter from binding with it (I'm simplifying things). The amounts of the neurotransmitter and the drug in the synapse also matter (For example, 50% of the receptors on a postsynaptic neuron can have serotonin attached to them while 50% have LSD...)
Another factor is HOW the drug binds with the receptor. In most cases the binding is temporary, and the attached molecule will release on its own after a time, or it can be overridden with another chemical that has a higher affinity for the receptor. In some cases, however, the binding is permanent. If the permanent binder is an agonist, it causes permanent activation (for example, choleratoxin does this). A permanent antagonist causes permanent inactivation of the receptor. A permanently attached chemical cannot, of course, be overridden.
Now, if the drug has an effect only on the postsynaptic neuron, it won't affect the serotonin in any way. The serotonin will be partially reuptaken and partially recycled as usual. Because of MAO it cannot build up in the synaptic cleft. If the drug in question is not a permanent binder, the serotonin in the cleft competes with the drug for binding (This is why nonpermanent binders are called competitive agonists/antagonists), and the amounts+affinities determine how many receptors are bound with serotonin and how many with the drug.
-------------------- "All substances are poisons; there is none which is not a poison. The right dose differentiates a poison and a remedy." -Paracelsius
Edited by ummikko (02/09/05 03:26 AM)
|
shymanta
Mad Scientist


Registered: 01/27/05
Posts: 904
|
Re: How Hallucinogenic Drugs Work [Re: mjshroomer]
#3755157 - 02/09/05 07:06 AM (7 years, 5 days ago) |
|
|
Awesome, I think I understood all that.
So, it sounds like substances that bind permanently are to be avoided.
Is that the case and is there a "scientific name" for a permanent binder whether agonists or antagonists?
Thanks, ummikko
|
Psiloman
member

Registered: 04/11/03
Posts: 1,116
Loc: Europe
Last seen: 2 months, 4 hours
|
Re: How Hallucinogenic Drugs Work [Re: shymanta]
#3757819 - 02/09/05 05:06 PM (7 years, 4 days ago) |
|
|
I guess it can be called "irreversible" ("irreversible agonist" or "irreversible antagonist").There are some MAO inhibitors (yes i know,its kind outa of context here) ,usually pharmaceuticals, that bind on the MAO enzyme irreversibly thus killing it.Your body then has to make more of this enzyme which means going through the whole proccess of DNA->RNA->Protein.Certainly an irreversible agonist or antagonist could be bad news if we are talking receptors in the brain..
I do not think irreversible 5HT-2a agonists exists...Or at least i dont know any of them....
Edited by Psiloman (02/09/05 05:10 PM)
|
shymanta
Mad Scientist


Registered: 01/27/05
Posts: 904
|
Re: How Hallucinogenic Drugs Work [Re: mjshroomer]
#3757874 - 02/09/05 05:19 PM (7 years, 4 days ago) |
|
|
That sound like good news. Wow, you've given me so much information. Thank you for this enlightening discussion. I've learned a lot from it.
May your thoughts be positive & productive and joy fill your life.
|
Psiloman
member

Registered: 04/11/03
Posts: 1,116
Loc: Europe
Last seen: 2 months, 4 hours
|
Re: How Hallucinogenic Drugs Work [Re: shymanta]
#3757919 - 02/09/05 05:26 PM (7 years, 4 days ago) |
|
|
Well,rest assured that "classic hallucinogens" such as mescaline,psilocybin and dmt are reversible,they dettach themselves from the receptor.
By the way,here is also a paper on aeruginascin (a component of some Inocybe mushrooms) that is a relative of psilocybin ,i think its trimethylated instead of psilocybin which its dimethylated ( i think we are talking of a 4-phosphoryloxy-TMT). Here is the paper: http://webdoc.sub.gwdg.de/diss/2004/jensen/jensen.pdf
Now,the paper is huuuuuuuuuuuuuuuuuuuuuuuuuuge and so technical ,but please have a look to its contents...You will find a method of action of hallucinogens in it (a chapter) which is data more recent than the ones on the original paper of this thread.A good read all and allo,dont be to intimidated by its size and technical mumbojumbo....Stick to the topics that interest you!
|
ummikko
sika joka eilenn? on pelkk?sika

Registered: 04/02/03
Posts: 1,222
Loc: Finland
Last seen: 1 year, 8 months
|
Re: How Hallucinogenic Drugs Work [Re: shymanta]
#3760527 - 02/10/05 03:58 AM (7 years, 4 days ago) |
|
|
Quote:
shymanta said: So, it sounds like substances that bind permanently are to be avoided.
Is that the case and is there a "scientific name" for a permanent binder whether agonists or antagonists?
I only know the finnish name 
The difference between temporary and permanent binding, on the chemical level, is that temporary binding is usually based on relatively weak physiochamical forces (typically ion bonds, hydrogen bonds, van der Waals bonds, and hydrofobic interactions) and permanent binding is based on covalent bonding, which is much stronger.
Well-known examples of permanent binders are organophosfates, which are used in insecticides and in chemical warfare.
-------------------- "All substances are poisons; there is none which is not a poison. The right dose differentiates a poison and a remedy." -Paracelsius
|
Hermes_br
~~~


Registered: 04/24/01
Posts: 546
|
Re: How Hallucinogenic Drugs Work [Re: ummikko]
#3763210 - 02/10/05 04:25 PM (7 years, 3 days ago) |
|
|
hi, the following is a page a had from the hive.ws
------------------------------------------------- Rhodium (Chief Bee) 04-24-02 21:24 No 300866 LSD and DOB: interaction with 5-HT2A receptors (Rated as: excellent) Reply
LSD and DOB: interaction with 5-HT2A receptors to inhibit NMDA receptor-mediated transmission in the rat prefrontal cortex by Arvanov VL, Liang X, Russo A, Wang RY Department of Psychiatry and Behavioral Science, SUNY at Stony Brook, NY 11794-8790, USA Eur J Neurosci 1999 Sep; 11(9):3064-72
ABSTRACT Both the phenethylamine hallucinogen (-)-1-2, 5-dimethoxy-4-bromophenyl-2-aminopropane (DOB), a selective serotonin 5-HT2A,2C receptor agonist, and the indoleamine hallucinogen D-lysergic acid diethylamide (LSD, which binds to 5-HT1A, 1B, 1D, 1E, 1F, 2A, 2C, 5, 6, 7, dopamine D1 and D2, and alpha1 and alpha2 adrenergic receptors), but not their non-hallucinogenic congeners, inhibited N-methyl-D-aspartate (NMDA)-induced inward current and NMDA receptor-mediated synaptic responses evoked by electrical stimulation of the forceps minor in pyramidal cells of the prefrontal cortical slices. The inhibitory effect of hallucinogens was mimicked by 5-HT in the presence of selective 5-HT1A and 5-HT3 receptor antagonists. The inhibitory action of DOB, LSD and 5-HT on the NMDA transmission was blocked by the 5-HT2A receptor antagonists R-(+)-alpha-(2, 3-dimethoxyphenil)-1-[4-fluorophenylethyl]-4-piperidineme thanol (M100907) and ketanserin. However, at low concentrations, when both LSD and DOB by themselves only partially depressed the NMDA response, they blocked the inhibitory effect of 5-HT, suggesting a partial agonist action. Whereas N-(4-aminobutyl)-5-chloro-2-naphthalenesulphonamide (W-7, a calmodulin antagonist) and N-[2-[[[3-(4'-chlorophenyl)- 2-propenyl]methylamino]methyl]phenyl]-N-(2-hydroxyethyl)-4'-methoxy-b enzenesulphonamide phosphate (KN-93, a Ca2+/CaM-KII inhibitor), but not the negative control 2-[N-4'methoxybenzenesulphonyl]amino-N-(4'-chlorophenyl)-2-propeny l-N -methylbenzylamine phosphate (KN-92), blocked the inhibitory action of LSD and DOB, the selective protein kinase C inhibitor chelerythrine was without any effect. We conclude that phenethylamine and indoleamine hallucinogens may exert their hallucinogenic effect by interacting with 5-HT2A receptors via a Ca2+/CaM-KII-dependent signal transduction pathway as partial agonists and modulating the NMDA receptors-mediated sensory, perceptual, affective and cognitive processes. ----------------------------------------------------------------------- Antoncho (Official Hive Translator) 04-25-02 09:30 No 301160 Interesting... Reply
Makes one wonder if by chance there is any connection between the action of psychedelics and dissociatives (which, as we know, are noncompetitive NMDA antagonists).
Of course, NMDA receptor is so common in the brain that it's hard to associate any particular reaction with its blockade, but maybee thereis some specific network of such neurons that are responsible for "holding the reality intact" or "filtering out the unneeded stimuli" or, in Castanedian terms, "keeping the assemblage point in place" - that, when being gently inhibited (as we see in case of 5HT-2A-mediated action), 'soften' the reality's boundaries and, being rudely turned off by plugging up their NMDA channels (like in case of PCP), result in wild and chaotic experiences.
This is, of course, a very inscientific/far-fetched theory, but still rather cute, IMHO.
Antoncho ------------------------------------------------------
|
eve69
--=..Did Adam and ...?=--


Registered: 04/30/03
Posts: 2,878
Last seen: 2 months, 10 days
|
Re: How Hallucinogenic Drugs Work [Re: Hermes_br]
#3886720 - 03/08/05 09:06 AM (6 years, 11 months ago) |
|
|
Obviously DMT doesn't work merely by affecting serotonin. My guess is also that no group of objective scientists will ever understand the brain as it is its own testing apparatus. I have never believed any scientific conclusion yet, nor will I ever. We hear things today like, the Earth is actually 14 billion years old instead of 6, and that the speed of light may have slowed down since the BB. So there is nothing that doesn't change including theories. It may be that tomorrow the sun goes nova and all of a sudden gravity ceases. Then apples may float up instead of down thus negating Newton's observation of gravity. All science is searching in the dark. I am always leary of pat theorems about things as any theory negates the ever changing and wholistic nature of our universe. Somewhere in another universe non humans are smoking antiweed, and negating the antiserotonin in their clavicals while they float in antigravity in a dark matter antiexistentialistic pond where the goal is to cease instead of to be. There the goal is to snuff awareness and so on. We are anthropods and we see what we are only. To trust science is to step in front of a speeding car. Science has no thought, no morals, and no guidance, and is no guidance to others. It is a bandaid, and not a cure. Life is the source, course and goal, science is merely some dust on someones brain that got shaken free. We think that since the Renaissance humans have gotten more analytical, but that's not true when compared to the population explosion of the Earth. My guess is that there are a lesser percentage of great minds compared to the general population today compared to the Renaissance. So my point is that I argue any specific theory for how hallucinogens work. Because none of those theories take into acount the nature of non hallucinogenic visions, perceived in waking state, ie., paranormal or visionary experiences. My guess from experience is that the serotonin is merely an aspect of brain stem fight or flight sublimation, which preceeds a fierce synaptic cross coordination and new brain pathway perusal. The new synaptic connection falling into disuse after a quick hallucinogen bout but becoming more poignant in daily life as those pathways are repeatedly used, like learning anything the psychedelic also can become incorporated into the material world. Similar to training the mind through yoga and meditation or other religious triggers. I can tell you that I can easily know what tripping would be like in any situation, even when straight due to repeated experience over the course of my life. this training.Gotta go score. Ciaoders.
--------------------

|
badchad
Mad Scientist

Registered: 03/02/05
Posts: 7,505
|
Re: How Hallucinogenic Drugs Work [Re: eve69]
#3893028 - 03/09/05 01:26 PM (6 years, 11 months ago) |
|
|
Quote:
eve69 said: Obviously DMT doesn't work merely by affecting serotonin.
This certainly seems to be true, although the it is thought to work primarily via the serotonin system. It's my opinion that the current research is focuing on these "other" neurotransmitters, and the downstream effects of disrupting the serotonin system.
Quote:
eve69 said: My guess is also that no group of objective scientists will ever understand the brain as it is its own testing apparatus.
I tend to agree, but we are continuing to learn at a very fast rate. How much we understand about the brain depends on how you look at it. Is the glass half full or half empty? even if we never "understand" the brain, does this mean we should give up?
Quote:
eve69 said:I have never believed any scientific conclusion yet, nor will I ever.
What about that guy who said the earth was round? What about scientific conclusions regarding DNA? There are many scientific achievements that have stood the test of time.
Quote:
eve69 said:We hear things today like, the Earth is actually 14 billion years old instead of 6, and that the speed of light may have slowed down since the BB. So there is nothing that doesn't change including theories.It may be that tomorrow the sun goes nova and all of a sudden gravity ceases. Then apples may float up instead of down thus negating Newton's observation of gravity..
Which is exactly why science should continue and we should challenge oursleves to learn.
Quote:
eve69 said:All science is searching in the dark.
Nothing could be further from the truth. While some discoveries are Serendipitous the nature of science is to build upon what others have discovered. For instance, while LSD was discovered "by accident", it's structure led scientists to believe it acted via a serotonergic mechanism. This was by no means a "shot in the dark" it was a good hypothesis. Obtaining grants and federal funding to perform science is by no means an easy task. It would be impossible to get funded without a strong hypothesis and previous work to back up your claims.
Quote:
eve69 said: I am always leary of pat theorems about things as any theory negates the ever changing and wholistic nature of our universe. Somewhere in another universe non humans are smoking antiweed, and negating the antiserotonin in their clavicals while they float in antigravity in a dark matter antiexistentialistic pond where the goal is to cease instead of to be. There the goal is to snuff awareness and so on.
Do you realize that your logic follows scientific theory (antimatter, dark matter etc) which are scientific theories, which you initially stated you would never believe?
Quote:
eve69 said: To trust science is to step in front of a speeding car. Science has no thought, no morals, and no guidance, and is no guidance to others. It is a bandaid, and not a cure.
Smallpox has been eradicated from this world, polio is soon to follow. Excellent examples of science "curing" ailments. If we cannot trust science, What should we trust? (perhaps your local religious diety who would tell us as long as we believe in god everything will be allright?) And there are obvious morals within science. Try writing an experimental protocol using animals, strict guidelines must be followed.
Quote:
eve69 said:Life is the source, course and goal, science is merely some dust on someones brain that got shaken free. We think that since the Renaissance humans have gotten more analytical, but that's not true when compared to the population explosion of the Earth. My guess is that there are a lesser percentage of great minds compared to the general population today compared to the Renaissance.
I'm not sure whether I agree or not. Think back to the Renaissance. I don't have figures for the literacy rate, I would assume there was no formal, standardized system of education. On the contrary compared to the renaissance, I think there sre still plenty of great minds because the process of learning has been facilitated and accelerated.
Quote:
eve69 said:So my point is that I argue any specific theory for how hallucinogens work. Because none of those theories take into acount the nature of non hallucinogenic visions, perceived in waking state, ie., paranormal or visionary experiences. My guess from experience is that the serotonin is merely an aspect of brain stem fight or flight sublimation, which preceeds a fierce synaptic cross coordination and new brain pathway perusal. The new synaptic connection falling into disuse after a quick hallucinogen bout but becoming more poignant in daily life as those pathways are repeatedly used, like learning anything the psychedelic also can become incorporated into the material world. Similar to training the mind through yoga and meditation or other religious triggers. I can tell you that I can easily know what tripping would be like in any situation, even when straight due to repeated experience over the course of my life. this training.Gotta go score. Ciaoders.
One aspect of hallucinogen study is relating their effects to what is going on normally within the brain. Indeed there have been several papers comparing the effects of hallucinogens to those experienced by religious leaders.
Anywho in an effort to keep the thread slightly on track I tend to think that newer studies of hallucinogenesis are focusing on interactions amongst neurotransmitters rather than a single type in isolation. As stated in the Arvanov and Wang article someone posted previously (Eur J Neurosci 1999 Sep; 11(9):3064-72) glutamate has come into the spotlight recently. This specific paper refutes some of the theories by Aghajanian and colleagues that 5-HT2A stimulation causes a focal release of glutamate. The laboratory I work in has recently decreased the effects of LSD (in rats) by administering ligands which indirectly decrease glutamate.
Somewhat related along these lines is a article by Nichols (whom was mentioned earlier in this thread and has published an excellent review as of late) Where he attributes the temporal phases of LSD to different neurotransmitters.
All in all we're making progress but theres plenty more to be done!
|
ambros
Stranger
Registered: 09/09/03
Posts: 79
|
Re: How Hallucinogenic Drugs Work [Re: badchad]
#3915763 - 03/14/05 09:21 AM (6 years, 10 months ago) |
|
|
i dont if they are interesting, they are taken from nature.com where you cant see if a file is downloadable or not.
Serotonin and Hallucinogens http://www.myfilestash.com/userfiles/sympetrum/Serotonin%20and%20Hallucinogens.pdf
a single dose of lsd influences gene expression patterns within the mammalian brain (can someone comment this one) http://www.myfilestash.com/userfiles/sym...ian%20Brain.pdf
Agonist-Directed Signaling of Serotonin 5-HT2C Receptors, Differences Between Serotonin and LSD http://www.myfilestash.com/userfiles/sym...20and%20LSD.pdf
Neurometabolic Effects of Psilocybin, 3,4-Methylenedioxyethylamphetamine (MDE) and d-Methamphetamine http://www.myfilestash.com/userfiles/sympetrum/Neurometabolic%20Effects%20of%20Psilocybin.pdf
Serotonin Neurons, Neuroplasticity, and Homeostasis of Neural Tissue http://www.myfilestash.com/userfiles/sym...al%20Tissue.pdf
Modulating the Rate and Rhythmicity of Perceptual Rivalry Alternations with the Mixed 5-HT2A and 5-HT1A Agonist Psilocybin http://www.myfilestash.com/userfiles/sym...0Psilocybin.pdf
http://www.myfilestash.com/userfiles/sym...20variasjon.pdf
|
badchad
Mad Scientist

Registered: 03/02/05
Posts: 7,505
|
Re: How Hallucinogenic Drugs Work [Re: ambros]
#3930236 - 03/17/05 10:49 AM (6 years, 10 months ago) |
|
|
What a nice blast from the past!, I read the first three articles when they were first published, however it?s been a few years since I dug them out of my files.
The first three are by reputable authors whom are respected in the field. I wasn?t familiar with the last 4 articles or their authors (not to say they were ?bad?, I?m just not familiar with the investigators and the quality of their work).
As far as comments are concerned, there are multiple aspects of each paper that can be criticized/commented on. Since you asked about the second paper I?ll offer my opinion and others are free to expand/comment/agree/disagree on what I?ve said.
?A Single dose of Lysergic Acid Diethylamide Influences Gene Expression Patterns Within the mammalian Brain? Nichols, C.D. and Sanders-Bush, E. Neuropschopharmacology 26(5):634-642
A nicely written paper looking at the transient effects of LSD on gene expression patterns within the brain of rats. Essentially, the paper used a very unique approach to study the effects of LSD, although the reality is that this paper produced very little useful knowledge.
The authors made use of gene chip technology which allowed them to screen approximately 8800 genes simultaneously and determine relative upregulations/downregulations of protein products in response to LSD. Considering the amount of genes screened the results seemed rather disappointing. Changes were seen in about 7 gene products.
While gene chip technology allows for analysis of a large amount of gene products, the technology has significant drawbacks, all of which undermined the usefulness of this paper: 1. First off it is very difficult to quantitate absolute changes in expression levels using this method. 2. In a similar manner how does one define what magnitude of change is needed for a significant change to occur?
Even with these factors accounted for (which the authors did to a small extent) the actual results weren?t impressive. Of the gene products affected most were immediate early genes and known to be affected by multiple stimuli, making questionable their relevance to LSD. For instance, one gene that was upregulated in response to LSD was c-fos. If you look at the literature, c-fos is upregulated in response to almost anything and is often used as a marker for neuronal firing. If I squeeze a rat, scare him or otherwise expose him to stress, you?ll find c-fos is upregulated. If I administer an antidepressant, such as an SSRI, c-fos may be upregulated. In a similar manner cocaine can upregulate the NOR1 gene (which was also upregulated by LSD).
Since all these ?other things? can result in upregulation of the same genes as LSD they do not seem unique to LSD. For instance, if LSD and cocaine both upregulate NOR1, how can we say NOR1 is involved in the effects of LSD, as cocaine and LSD are clearly different from one another. This same story holds true for the other genes, none seem specific to LSD.
Finally, (and most importantly) look at the dose of LSD used in the study. 1.0mg/kg. That is an enormous does in terms of human consumption, imagine what it does to a small rat?
All in all the paper demonstrated promise by using a new technique but the results were less than interesting. If someone were to find a gene that is upregulated ONLY in response to a behaviorally relevant dose of LSD, one may begin to speculate on its role in hallucinogenesis, unfortunately, that didn?t happen.
-------------------- ...the whole experience is (and is as) a profound piece of knowledge. It is an indellible experience; it is forever known. I have known myself in a way I doubt I would have ever occurred except as it did.
Smith, P. Bull. Menninger Clinic (1959) 23:20-27; p. 27.
...most subjects find the experience valuable, some find it frightening, and many say that is it uniquely lovely.
Osmond, H. Annals, NY Acad Science (1957) 66:418-434; p.436
|
Psiloman
member

Registered: 04/11/03
Posts: 1,116
Loc: Europe
Last seen: 2 months, 4 hours
|
Re: How Hallucinogenic Drugs Work [Re: badchad]
#3967909 - 03/25/05 07:39 AM (6 years, 10 months ago) |
|
|
I hope im not off topic but i would liek to comment on some practical implications for they layman of the discovery of the glutame role in the mediation of 5HT-2a agonist halucinogens effects..
Badchad has said :" Anywho in an effort to keep the thread slightly on track I tend to think that newer studies of hallucinogenesis are focusing on interactions amongst neurotransmitters rather than a single type in isolation. As stated in the Arvanov and Wang article someone posted previously (Eur J Neurosci 1999 Sep; 11(9):3064-72) glutamate has come into the spotlight recently. This specific paper refutes some of the theories by Aghajanian and colleagues that 5-HT2A stimulation causes a focal release of glutamate. The laboratory I work in has recently decreased the effects of LSD (in rats) by administering ligands which indirectly decrease glutamate. "
So it makes me wonder...So far for modifying the experience from serotoninergic hallucinogens we have utuilized different administration routes (IV,IM,per os) ,played with the pharmackinetics (full stomach,liquid infusion,empty stomach),and also with metabolism (MAOinhibitors...).These laymans experiments have brought forth some conclusion on how these factors modify experience...
Now...How about glutame? Could glutamate release be facilitated by another agent co-administered with a hallucinogen? Im not talking merely about "potentiation",but talking about alteration of different stages of the experience...
Any thoughts on that?
|
badchad
Mad Scientist

Registered: 03/02/05
Posts: 7,505
|
Re: How Hallucinogenic Drugs Work [Re: Psiloman]
#3968067 - 03/25/05 08:51 AM (6 years, 10 months ago) |
|
|
Quote:
Psiloman said: Now...How about glutame? Could glutamate release be facilitated by another agent co-administered with a hallucinogen? Im not talking merely about "potentiation",but talking about alteration of different stages of the experience...
Any thoughts on that?
Well, in my opinion, the simple answer is "yes". As you may know, NMDA antagonists (PCP, ketamine, etc.) are thought to work by increasing glutamate release. Thus, it seems to me that if you combined a hallucinogen and an NMDA antagonist, you would get some sort of effect. I would think this would result in the "potentiation" you spoke of (or perhaps an attenuation), however you may get some interesting effects (which might be described simply as "different").
In a similar manner, there has been an increased interest glutamate ligands recently. Two new "mglu" ligands have been introduced (mglu2 and 3), which are purpoted to selectively bind to metabotropic glutamate receptors. Supposedly these ligands modify glutamate release (with the mglu2 agonist decreasing glutamate release). These compounds contributed to the hypothesis of glutamate being involved in the effects of PCP, when they were found to decrease some of the effects of PCP in rats (reference:Moghaddam, B and Adams, A: Reversal of Phencyclidine Effects by a Group II Metabotropic Glutamate Receptor Agonist in Rats. SCIENCE: V. 281, issue 5381, 1349-1352, 2000).
Recently, another paper was published exploring the effects of these mglu ligands on LSD, an obviously "more serotonergic" compound, and they were found to decrease the effects of LSD in rats. So it seems that there is at least a modest contribution of glutamate to the effects of hallucinogens. How large of a "contribution" glutamate makes however, is still being explored.
Now, to make it even more confusing, note that Nichols (as I said a couple posts up) just published a hypothesis of the involvement of dopamine during the latter stages of LSD. So, in the context of modifying glutamate this would have to be taken into account as well (e.g. modifying glutamate may have different effects on hallucinogenesis, depending on WHEN it is modified). In short (as I've said before) now that serotonin is predominantly been implicated in the mechanism of action of hallucinogens, its interactions with additional (or "secondary) neurotransmitters seems to tbe the focus of current research.
-------------------- ...the whole experience is (and is as) a profound piece of knowledge. It is an indellible experience; it is forever known. I have known myself in a way I doubt I would have ever occurred except as it did.
Smith, P. Bull. Menninger Clinic (1959) 23:20-27; p. 27.
...most subjects find the experience valuable, some find it frightening, and many say that is it uniquely lovely.
Osmond, H. Annals, NY Acad Science (1957) 66:418-434; p.436
|
Psiloman
member

Registered: 04/11/03
Posts: 1,116
Loc: Europe
Last seen: 2 months, 4 hours
|
Re: How Hallucinogenic Drugs Work [Re: badchad]
#3968222 - 03/25/05 09:27 AM (6 years, 10 months ago) |
|
|
Ah Doctor Nichols...If im correct the study you mention shows an increase of dopamine release in the "comedown" period of LSD administration,right? (Ny the way i think this man has a lot of aces up his sleeve but he is smart and knows how to keep quiet...Think of bromodragonfly!)
Of course timing is crucial and this is such an interesting field of research,because many variables come into play...
I may want to research the glutamate hypothesis (and yes,i mean research as in reading not as in "gulping down" ) and find out many substances that can enhance glutamate release or increase glutamate content in the brain,if possible others than PCP and Ketamine (have you heard of Memantine by the way? Thats an interesting compound...) .Monosodium Glutamate keeps coming into mind (yes,the "unami" taste) but i havent found any data on what exactly it does on the brain and if indeed it reaches the brain...Maybe Pubmed can help here
From what i gather glutamate release in big quantities can cause exitatory apoptosis in some brain cells...Am i correct? I think some "antialzheimer" medications aim at its modulation...Death of neural tissue by overstimulation is not something desired...
By the way do you know if ibotenic acid and muscimol of the species Amanita Muscaria modulate in any way glutamate "stock" of the brain or glutamate release? Maybe you are going to laugh here but the taste of this mushroom is close to the one of monosodium glutamate...I dont know if it contains any or if those compounds give it the nice taste,but i "smell" exitatory compounds of the glutamate kind to be responsible for the flavor..It oculd be completely unrelated it could also be of importance...
EDIT: On the MSG issue look at this paper http://www.ncbi.nlm.nih.gov/entrez/query...t_uids=15047981
Edited by Psiloman (03/25/05 09:32 AM)
|
redgreenvines
irregular verb


Registered: 04/08/04
Posts: 13,323
|
Re: How Hallucinogenic Drugs Work [Re: ambros]
#3968311 - 03/25/05 10:00 AM (6 years, 10 months ago) |
|
|
Quote:
ambros said: i dont if they are interesting, they are taken from nature.com where you cant see if a file is downloadable or not.
Serotonin and Hallucinogens http://www.myfilestash.com/userfiles/sympetrum/Serotonin%20and%20Hallucinogens.pdf
in the first document, figure 2 shows a nice chart of what I call the primary effect of halucinogen. - postsynaptic potentiation.
We experience much more vibrance from each sensory input and memory. we even may experience a stacking of full gestalts of experience as things fade more slowly.
they call it the "nonsynchronous component of the EPSCs " specifically they show some extended electrical activity after synaptic excitation for more than 0.25 second (I think the full extension of that chart would be interesting.)
I will reply to each one in sequence WRT what I find interesting. (my computer is crashing a lot today)
-------------------- ~~~~~
|
redgreenvines
irregular verb


Registered: 04/08/04
Posts: 13,323
|
Re: How Hallucinogenic Drugs Work [Re: ambros]
#3968328 - 03/25/05 10:05 AM (6 years, 10 months ago) |
|
|
Quote:
ambros said: a single dose of lsd influences gene expression patterns within the mammalian brain (can someone comment this one) http://www.myfilestash.com/userfiles/sym...ian%20Brain.pdf
this study relates to growth and adaptation to the environmental influence of LSD over the short term of exposure.
it is inconclusive but seems to highlight the thalamus and the cortex in the fixation of new memory, and may only indicate that the LSD is stimulating activity/learning/adaptation over a resting state.
-------------------- ~~~~~
|
redgreenvines
irregular verb


Registered: 04/08/04
Posts: 13,323
|
Re: How Hallucinogenic Drugs Work [Re: ambros]
#3968341 - 03/25/05 10:10 AM (6 years, 10 months ago) |
|
|
Quote:
ambros said:
Agonist-Directed Signaling of Serotonin 5-HT2C Receptors, Differences Between Serotonin and LSD http://www.myfilestash.com/userfiles/sym...20and%20LSD.pdf
again RNA level molecular biological analyses are being used to evaluate a snapshot of chemical behaviour during an environmental exposure that may not be entirely relevent to what we experience, but they are learning more and more about serotonin and lsd WRT to phoshphorous movement and electrical potential of the neurons.
-------------------- ~~~~~
|
redgreenvines
irregular verb


Registered: 04/08/04
Posts: 13,323
|
Re: How Hallucinogenic Drugs Work [Re: ambros]
#3968378 - 03/25/05 10:21 AM (6 years, 10 months ago) |
|
|
http://www.myfilestash.com/userfiles/sympetrum/Neurometabolic%20Effects%20of%20Psilocybin.pdf regional brain center analysis of activiy from different psycho active compounds quite interesting to me. figure 4 especially shows that the timing circuitry of cerebellum is way enhanced during methamphetamine and MDE, while the cognitive regions are depressed, psilocybin, provides a full spectrum enhancement.
-------------------- ~~~~~
|
redgreenvines
irregular verb


Registered: 04/08/04
Posts: 13,323
|
Re: How Hallucinogenic Drugs Work [Re: ambros]
#3969177 - 03/25/05 01:31 PM (6 years, 10 months ago) |
|
|
http://www.myfilestash.com/userfiles/sym...al%20Tissue.pdf Serotonin Neurons, Neuroplasticity, and Homeostasis of Neural Tissue
the serotonin pathways are depicted as "along the gateway from the body to the cortex" and penetrating basalganglia and the timing circuitry in the cerebellum, but not in the cortex itself, so it is more involved with the circuitry of recognition, memory fixation, and control of processing.
neuroplasticity relates to chageable morphology or growth which is observed in this type of cell and that is also consistent with models of learning or adaptability and memory.
this article is not about psychedellic but about the serotonergic neurons and their place in brain function.
-------------------- ~~~~~
|
Hermes_br
~~~


Registered: 04/24/01
Posts: 546
|
Re: How Hallucinogenic Drugs Work [Re: redgreenvines]
#4053726 - 04/14/05 06:48 AM (6 years, 9 months ago) |
|
|
hey,
this book is probably a good read "Psychedelic Information Theory" by James Kent
from: http://www.tripzine.com/pit.asp?id=pit_toc -Table of Contents --with some chapters online.
'This is not a book about drugs, it is about experience, for what are drugs if not a means to experience? Each encounter with a psychoactive substance is a gateway into another world of unique moods, thoughts, feelings, sensations, and perceptions that would be otherwise inaccessible along this strange and twisted journey we call life. Much has been written about the many types of experiences one might encounter under the influence of a psychedelic drug, but very little has been written about how these drugs actually produce the phenomena they do, or why we react so strongly to them at such deep emotional levels. This is the primary reason I have written this book, to address the issue of how psychedelic drugs work, and why the affect us the way they do.'
"We are currently accepting donations for the Psychedelic Information Theory publishing fund. All donations will go directly towards the editing, public review, and publication of this landmark text. Collecting donations directly from individuals will allow us to publish this work independently and provide a final copy of the entire text free of charge online.Please show your support by making a donation today. Everyone who donates $5.00 or more will receive a full online preview of chapters as they become available. Donations of $50.00 or more will receive a numbered copy of the limited first edition of this landmark text signed by the author, sure to be a collector's item. The publication date for this limited first edition is still unknown, but this offer will be extended to the first 100 respondents only, so act now to reserve your copy today!" http://www.tripzine.com/pit.asp?id=donate
Edited by Hermes_br (04/14/05 07:41 AM)
|
Bongwater8890
Uhhhh
Registered: 04/24/05
Posts: 9
Loc: Oxford/P.A/U.S
Last seen: 6 years, 9 months
|
Re: How Hallucinogenic Drugs Work [Re: Hermes_br]
#4096587 - 04/25/05 05:48 PM (6 years, 9 months ago) |
|
|
Great information thx
|
Psiloman
member

Registered: 04/11/03
Posts: 1,116
Loc: Europe
Last seen: 2 months, 4 hours
|
Re: How Hallucinogenic Drugs Work [Re: Bongwater8890]
#4467838 - 07/29/05 02:21 AM (6 years, 6 months ago) |
|
|
A more revised article by erowid on Halucinogen action in the brain is released today. Have a look here : http://www.erowid.org/psychoactives/pharmacology/pharmacology_article2.php
|
PerfectlyDefectd
Dr. Pedro

Registered: 08/03/05
Posts: 617
Loc: Columbus, Ohio
Last seen: 6 years, 4 months
|
Re: How Hallucinogenic Drugs Work [Re: mjshroomer]
#4496336 - 08/04/05 05:39 PM (6 years, 6 months ago) |
|
|
thanks a lot for that info.. a rumor that many people say is that eating shrooms causes ur brain to bleed... is this true?
|
Psiloman
member

Registered: 04/11/03
Posts: 1,116
Loc: Europe
Last seen: 2 months, 4 hours
|
|
Quote:
PerfectlyDefectd said: thanks a lot for that info.. a rumor that many people say is that eating shrooms causes ur brain to bleed... is this true?
Try debunking it yourself!
1)Read the articles posted here (did you read them?) 2)Ask people stating this HOW do they make your brain bleed.Press them for information.If this happened it would have a mechanism of happening ,wouldnt it? 3)Do you,from what you know so far in your stay in planet Earth, believe that "brain bleeding would result in tripping"? Try to find out what does brain bleeding means medically.Ponder if it is dangerous (yes,you will be amazed to find its a lethal condition).Now think ,lets say,of your friend thats has tripped 5 times or others in here that have been tripping on and off for the past 5 years.Do you think that they could "escape alive" 5 "brain bleeds" or 5 years of on and of "brain bleeding"?
|
Psilo707
Entheonaut

Registered: 07/17/03
Posts: 68
Loc: Bay Area, California
Last seen: 18 days, 18 hours
|
Re: How Hallucinogenic Drugs Work [Re: Psiloman]
#4642906 - 09/10/05 03:40 PM (6 years, 5 months ago) |
|
|
NICE POST!!!
|
Ars vitae
Stranger



Registered: 04/20/10
Posts: 80
Loc: The Netherlands
Last seen: 2 months, 1 day
|
Re: How Hallucinogenic Drugs Work [Re: Psilo707]
#12777430 - 06/21/10 04:50 AM (1 year, 7 months ago) |
|
|
very informative! tnx!
-------------------- Cheers Ars Vitae
|
deep_child
Stranger

Registered: 05/19/10
Posts: 22
Last seen: 1 year, 4 months
|
Re: How Hallucinogenic Drugs Work [Re: Ars vitae]
#12777762 - 06/21/10 07:53 AM (1 year, 7 months ago) |
|
|
Pardon me for introducing what may be perceived as some irrationality into this thread, but "Tonight, for your edification, and amusement" I would like to offer some thoughts that I have evolved over the last 20 years of experience with altered mind states that might fly in the face of the current Neurochemical trends.
Some time ago (in the early 90's) I spent quite a bit of time reading up the then-current theories of mechanisms of psychedelic substance actions, I pondered Serotonin agonists, selective reuptake inhibitors and many of the theories of the day regarding "brain function".
Unlike most peoples initial reasoning (very little) before deciding to try mind altering chemicals, I was doing my best by researching to make sure I wasnt about to do anything that could be definitely called monumentally ignorant or stupid.
After spending a good 6 months first reading and absorbing as much as I could find in the early days of the internet, much of the information when taken in context of the whole field, gave me the feeling that the researchers seemed a lot like the pre-periodic table chemists must have felt - recording, cataloging, making endless notes on "substance x when subjected to action y in the prescence of environment Z causes A, B and C to happen", with very little understanding of why, or what A B C meant in terms of actual effect when applied to an entire brain as a whole system.
One comment I read was that each generation of "psychologists" have done their best to understand brain function by comparing it to the most complicated machine system that they know of at that time.
The Greeks believed mood and temperament to be controlled by the "four humours", bile (black and yellow), choler and blood. The personality was determined by the ratio mix of these substances. Melancholic, Phlegmatic etc
In the late 1800's it was steam engines with freudian "build up of pressure", "Blowing off steam", "Sublimation of Urges" and so on...
In the early-to-mid 1900, the new electrical paradigm was applied with nervous systems being "Wires", Nerve "sensors", the brain being a "switching system", Muscle "actuators" and the Frankenstein "electricity bring dead flesh to life" story. Axons, Dendrites and Synapses appeared to be the "new hotness"
In the mid-to-late '1900's, as our chemical engineering prowess developed, neurologists and psychiatrists started pushing the electro-chemical model of the brain, throwing neurotransmitters, histamines and receptors into the pot as well. complicating things further.
Now, with our computer technology, Neural Networks, Fuzzy Logic, and Chaos mathematical principles such as recombinant and emergent behaviour are being jiggled about trying to fit the old gray matter's methods.
Each generation makes its best guess, only for their analogy to be understood as being hopelessly naive by later "better educated" researchers..
It seems to me, that despite centuries of unending speculation, we *still* havent got a very good handle on just how that cubic foot of puzzlingly enigmatic flesh does its thing. I wonder what the *next* model will be ?
Some question whether it is even possible (philosophically) for any intelligence to understand its own method of function. In order to build a watch, you need watchmakers tools and what watch could understand their application and use ?
My own education is in the area of Electronics, and naturally it occured to me that the brain could possibly be a form of biological "Antenna" - receiving the signals from a form of bio-field not yet fully recognised.
Some (some admittedly fringe, but others reasonably well performed from what I have read) research supports this. eg.
Two colonies of genetically near-twin mice were kept on different islands - Over a period of months, one group were trained to navigate mazes, the ones on the other island were not. After some time, it was shown that the untrained mice twins, when exposed to mazes for their first time, solved them in far shorter time than a control group of mice without the tight genetic relation to the remote "taught" mice could. Apparently, learning/information was being passed between the genetically similair mice somehow without any known form of communication taking place.
This experiment was advanced as a point of support for the many "supernatural" communication that is well-known between Human Twins - feeling each others pains, pleasures and so on across huge distances.
Other things I have read about Spiders knowing how to spin-webs, mosquitos knowing how to fly and other "innate" complex behaviours that seem to improbable to be able to be contained purely within the limited chemical storage of DNA and other physical biogenetic transmission methods.
It seems quite likely to me, that there is some form of *presently imperceptible* "field" generated by living things - perhaps a similair phenomenon to the fuzzy "morphogenetic field" - http://en.wikipedia.org/wiki/Morphogenetic_fields - concept, but based on cognition generated waves rather than biological form differentiation..
A "Noosphere" - http://en.wikipedia.org/wiki/Noosphere - of a sort, although that term has been used by too many mystics for my liking, having undesired connotations and history of quackery.
While this may seem like hopeful whistling in the dark, the mathematical principles of simple rules producing inctricate emergent behaviours are reasonably well understood.
Why then, can there not be something like an underlying "patterning force" driving the organisation of matter into ever-complexifying forms ?
A simple magnet underneath a piece of paper will create amazing patterns in iron filings on the surface of the paper due to the invisible magnetic fields. The Mandelbrot Set - http://en.wikipedia.org/wiki/Mandelbrot_set - when derived and illuminated by the power of our gigahertz computers produce Fractal patterns that appear, move and flex in rhythms that are quite familair to any connosieurs of the psychedelic experience.
Also, many forms of historic traditional native art suggest their knowledge and appreciation of there being *recursive* patterns to reality that only appear when perception is broadened beyond the mundane.
The swirl in your coffee cup is exactly the same structure as the swirl of the stars in the galaxy. The human circulatory system, the veins of a leaf, the structure of a tree, and a bolt of lightning all follow the same basic branching pattern.
Do these similarities not suggest to you the existence of emergent patterns derived from underlying forces ? It would seem so to me..
Some might call it "God", but that usually implies a human ego attached in a painfully immature Human self-centered fashion and I dont think that is the case.
As Arthur C Clarke once said.. "The rash assertion that 'God made man in His own image' is ticking like a time bomb at the foundation of many faiths, and as the hierarchy of the universe is disclosed to us, we may have to recognize this chilling truth: if there are any gods whose chief concern is man, they cannot be very important gods."
Perhaps the Star Wars concept of "The Force" is more applicable to the concept I am trying to convey here.. a non-ego based field associated with all living things - or to Quote Obi-Wan "It's an energy field created by all living things. It surrounds us, penetrates us, and binds the galaxy together."
It is most likely *not* a bearded guy with a list of rules for us to follow in life if we want admission to his cool place afterwards.
Soooooo.. (back to the original point after that *rather large* philosophical discourse).
If as I suspect, the Human brain is more of bio-antenna for whatever such a force may turn out to be, then..
For humans to be intensely studying the interplay of neuro-chemicals within the structure of the brain, and theorising as to their operation, relationships, and cause and effects strikes me as being as entertainly futile as pre-radio engineers studying the molecular metal structure and surging electrical currents of a Television Antenna, wondering why sometimes the signals look like *this* (The Late Show), sometimes like *that* (The News), and sometimes like the *other* (perhaps a cartoon or simply static) - The answers are not *in* the Antenna guys.. they are many miles away at the studio sending the signals. You just arent going to find Oprah hiding amongst the atoms.
They seem to me to be peering at the intricacies of the fractal structures, without really thinking about what formatitive forces, equations or rules might have given rise to those structures in the first place. And as many will know, one can zoom in on a Fractal *Forever*, endlessly finding new levels of detail.. The closer you look, the more you will find. Ad Infinitum..
But, the simple mechanical alteration of an Antennas physical construction will majorly affect its Bandwidth (frequency reception range), Directionality, Gain Factor and other characteristics, determining quite sharply just what it will and wont receive.
Applying psychedelic drugs to the brain is simply altering the Antenna of the mind, and hence "changing the channel" (or possibly tuning the bandpass filters) causing reception of different bio-field "programs" than one normally perceives.
The whole Neuro research industry seems to me to have somewhere along the way gotten distracted by and stuck chasing its own tail and hasnt yet figured out why its objective seems to constantly elude its grasp. Perhaps they need to look *around* a bit more, and maybe even behind them, instead of plodding forward chasing the carrot 
I think its time to put away the Electron Microscopes, get out the "Macro-scopes" (so to speak) and start looking broadly across the present field of results for the equivalent of "The Periodic Table" for Neurochem instead (or at least before) delving ever-deeper into the rabbit hole as the neuro/psych guys seem to be doing.
Some food for thought anyway.. What do you think ? (apart from the thought that I think (and type) too much 
respecfully Deep Child.
|
Xog
Jumpgate Pilot


 Registered: 10/01/08
Posts: 852
Loc: NY
Last seen: 14 days, 21 hours
|
Re: How Hallucinogenic Drugs Work [Re: deep_child]
#12778422 - 06/21/10 11:21 AM (1 year, 7 months ago) |
|
|
That's some crazy shit, man. +5 for u deep child
-------------------- We are all one but not really
|
OverallRealitivity


Registered: 01/26/10
Posts: 55
Last seen: 1 year, 7 months
|
Re: How Hallucinogenic Drugs Work [Re: Xog]
#12778833 - 06/21/10 12:54 PM (1 year, 7 months ago) |
|
|
" Repeated administration of LSD to rats was found to decrease the availability of the 5-HT: receptor subtype. Binding at the 5-HT, subtypes was unchanged (23)."
Would it be possible for someone to further explain this statement to me? I am not very knowledgeable about this topic but I know that decreased amounts of serotonin can lead to depression in certain cases. This statement sounds like its saying that it is lowering the amount of serotonin at a certain receptor type. Couldn't this have possibly negative long lasting effects on a persons emotions?
|
Smeeeeg
Entheogenic Philosopher



Registered: 01/03/09
Posts: 232
Last seen: 2 months, 16 days
|
|
Well....what does this mean in laymans terms? are there any severe adverse physical effects as a result of their usage whether it be emotional, physical, (mental obv).
|
Ars vitae
Stranger



Registered: 04/20/10
Posts: 80
Loc: The Netherlands
Last seen: 2 months, 1 day
|
Re: How Hallucinogenic Drugs Work [Re: deep_child]
#12780023 - 06/21/10 04:49 PM (1 year, 7 months ago) |
|
|
wow dude, awesome!
I was having a very philosophical evening, still re-assessing and emotionally recovering from my last trip, and along came you posting this marvelous piece of your mind. Just what the doctor ordered. Some of teh stuff you have written had never occured to me, those reapparing patterns for instance.
I am by experience a believer of the telepathics you bring up.
Also I firmly believe that there is some deeper universally connection in the way our brains works, and psychedelics just give as hints of what there is yet to be discovered or maybe forever hidden.
I truly hope, that our capitalist structure will slowly crumble down, and people start focusing more on the self, instead of their attributes in life.
What also tickles my brain (figurative and literary) is what our soul is, we have a delicate balance in our brain, which creates 'one' reality but there might be several others, I mean the human race is kinda funny in a way that as long as a lot of people believe in something it will actually work at least for a while (our western monetary system). There is no guarantee for truth or reality. Our reality is now being controlled by certain neuro Physiological activities in our brain.. So yeah, what the hell is reality anyway, and what the hell is our soul?..
Now this is just something I was thinking about, yet I have very limited knowledge about the synapses and neurotransmitters..
he part about the researchers, There is a quote by Abraham Lincoln "The dogmas of the quiet past, are inadequate to the stormy present. The occasion is piled high with difficulty, and we must rise -- with the occasion. As our case is new, so we must think anew, and act anew. We must dis-enthrall ourselves, and then we shall save our country."
Dis-enthrall is what the researches need to do, they are caught by their own dogma, which is exactly what you said.
-------------------- Cheers Ars Vitae
|
Evolution



Registered: 02/27/10
Posts: 282
Loc: Somewhere in time and spa...
Last seen: 4 months, 1 day
|
Re: How Hallucinogenic Drugs Work [Re: mjshroomer]
#12788951 - 06/23/10 05:18 AM (1 year, 7 months ago) |
|
|
I this thread!
-------------------- - Convictions are more dangerous enemies of truth than lies - F.W. Nietzche
|
TenaciousE
Let There Be More Light


Registered: 06/18/09
Posts: 257
Loc: Finnnlaaaaand
Last seen: 2 months, 2 days
|
Re: How Hallucinogenic Drugs Work [Re: Evolution]
#12788996 - 06/23/10 05:44 AM (1 year, 7 months ago) |
|
|
Some well put thinking right there, deepchild Even though I don't have much experience with Psychedelics, that was really interesting.
--------------------
| |
|
|
|
|