Home | Community | Message Board


Please support our sponsors.

Feedback and Administration >> Shroomery Polls

Welcome to the Shroomery Message Board! Please login or register to post messages and view our members-only content. You'll gain access to additional forums, encrypted messages, file attachments, board customizations, and much more!

Pages: < Back | 1 | 2  [ show all ]
OfflineAnnomM
※※※※※※
 User Gallery

Folding@home Statistics
Registered: 12/22/02
Posts: 5,261
Loc: sdnalrehteN ehT
Last seen: 20 hours, 14 minutes
Re: Your/You're [Re: Koala Koolio]
    #6589756 - 02/20/07 03:16 PM (1 year, 6 months ago)

English is not my first language, but I learned that at school when I was 11.


Post Extras: Print Post  Remind Me!  Notify Moderator    
InvisibleBoom
analyst/therapist

Registered: 06/16/04
Posts: 10,497
Loc: US and A
Re: Your/You're [Re: Annom]
    #6589862 - 02/20/07 03:40 PM (1 year, 6 months ago)

Contractions are soo confusing to people :lol: :wtf:


Post Extras: Print Post  Remind Me!  Notify Moderator   Ignore User 
OfflineMeedio
Stranger

Registered: 03/05/07
Posts: 10
Last seen: 1 year, 5 months
Re: Your/You're [Re: Boom]
    #6690986 - 03/20/07 10:40 AM (1 year, 5 months ago)

It all the same to me


Post Extras: Print Post  Remind Me!  Notify Moderator   Ignore User 
OfflineRogerRabbitM
Bans forPleasure
 User Gallery

Registered: 03/26/03
Posts: 16,735
Loc: Pacific Northwest
Last seen: 1 hour, 19 minutes
Re: Your/You're [Re: Meedio]
    #6714045 - 03/26/07 07:45 PM (1 year, 5 months ago)

It's not just your vs. you're. I once needed to get a letter typed from my bank manager to the credit bureau after they accidentally bounced one of my checks so I could clear my credit rating. The letter was so full of errors that I was afraid to even send it, thinking they'd think it was a forgery.

'There' was used instead of 'their' twice, and in place of 'they're' once. 'It's' was used four times, when twice it should have been 'its'.

Another time, when my son was in 9th grade, his history teacher sent home a letter for me to read and sign, saying that he was tired of kids misspelling words, and turning in work that wasn't typed, therefore he was going to take off 5 points or something like that for every spelling or grammatical error, and an additional 5 points if the paper wasn't either typed or very easy to read. All of this was understandable to me, but the bastard had five misspelled words in the letter, several grammar errors, and used 'there' when referring to 'their' homework assignments.

Needless to say, I was in the principals office at 9AM the next morning to demand either the teacher be fired, or forced into remedial education classes, or I was going to the news media with the letter. Shortly afterward, I received a letter from the teacher in question that he had decided to accept at job in Arkansas, and was leaving the district. :lol:
RR


--------------------
www.mushroomvideos.com



"I wouldn't want to belong to any club that would have me as a member".
Mark Twain, Woody Allen, Groucho Marx, and anyone else who wishes to claim credit for the quote.


Post Extras: Print Post  Remind Me!  Notify Moderator    
InvisibleKoala KoolioS
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,727
Re: Your/You're [Re: RogerRabbit]
    #6715023 - 03/26/07 11:42 PM (1 year, 5 months ago)

"Needless to say, I was in the principals office at 9AM the next morning to demand either the teacher be fired, or forced into remedial education classes, or I was going to the news media with the letter. Shortly afterward, I received a letter from the teacher in question that he had decided to accept at job in Arkansas, and was leaving the district."

That's the coolest thing I've read all day. :laugh:


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me!  Notify Moderator   Ignore User 
Offlinesoundtrance
mushmuncher
Male


Registered: 08/05/07
Posts: 691
Loc: Maryland
Last seen: 11 minutes, 28 seconds
Re: Your/You're [Re: Koala Koolio]
    #8168306 - 03/19/08 06:04 PM (5 months, 8 days ago)

i know how to use the words right i jsut use your most of the time cus its easier.


--------------------
"Our parents found themselves, we are finding each other"



:scaryshroom: :xtc:  :scaryshroom:


Post Extras: Print Post  Remind Me!  Notify Moderator   Ignore User 
OfflineCureCatM
Strangest
 User Gallery

Registered: 04/19/06
Posts: 8,883
Loc: clawing your furniture
Last seen: 7 days, 6 hours
Re: Your/You're [Re: soundtrance]
    #8168351 - 03/19/08 06:12 PM (5 months, 8 days ago)

Easier for you, more difficult and annoying for everyone trying to understand you.

But it's okay, the reader is not the one that comes off sounding uneducated and/or unintelligent.

And again, "cus" means nothing to me. In context it seems you mean " 'cause" or "because". Without context, I wouldn't be sure whether you are trying to spell "cuss" and accidentally left out an "s", or if you mean " 'cause".

Enough of these misspellings, slang terms, and words with vague or multiple interpretations, and it can be incredibly difficult to understand a message. I usually just skip over those posts.


--------------------


Wish is very sweet, obviously, but curecat is roughly as sweet as an unripe lemon.

drrrrr ddd..dd. like I'm curecat and I'm a spastic retard
:slug:


Post Extras: Print Post  Remind Me!  Notify Moderator    
Offlinesoundtrance
mushmuncher
Male


Registered: 08/05/07
Posts: 691
Loc: Maryland
Last seen: 11 minutes, 28 seconds
Re: Your/You're [Re: CureCat]
    #8168403 - 03/19/08 06:23 PM (5 months, 8 days ago)

hahah. ok I'll start typing better just for you Curecat. I didn't know it bothered people that much.


--------------------
"Our parents found themselves, we are finding each other"



:scaryshroom: :xtc:  :scaryshroom:


Post Extras: Print Post  Remind Me!  Notify Moderator   Ignore User 
OfflineCureCatM
Strangest
 User Gallery

Registered: 04/19/06
Posts: 8,883
Loc: clawing your furniture
Last seen: 7 days, 6 hours
Re: Your/You're [Re: soundtrance]
    #8168572 - 03/19/08 07:04 PM (5 months, 8 days ago)

Quote:

soundtrance said:
I didn't know it bothered people that much.



Oh, but it does!!

Read the other posts in this thread! It's actually pretty amusing/annoying depending on your mood or which side of the conversation you're on. Hehehe.


--------------------


Wish is very sweet, obviously, but curecat is roughly as sweet as an unripe lemon.

drrrrr ddd..dd. like I'm curecat and I'm a spastic retard
:slug:


Post Extras: Print Post  Remind Me!  Notify Moderator    
OfflineLegend9123
Male

Registered: 09/24/06
Posts: 2,051
Last seen: 9 hours, 30 seconds
Re: Your/You're [Re: soundtrance]
    #8169971 - 03/19/08 11:47 PM (5 months, 8 days ago)

Quote:

soundtrance said:
hahah. ok I'll start typing better just for you Curecat. I didn't know it bothered people that much.




It really is rather bothersome to try and interpret what a person means when they use slang and internet speak. Not only that, but it also makes the person appear considerably less informed no matter what they say. You will always earn more respect by taking the time to write out a grammatically correct post.


--------------------
Those who would give up a little freedom to get a little security shall soon have neither.
-Benjamin Franklin


Post Extras: Print Post  Remind Me!  Notify Moderator   Ignore User 
InvisibleCameron
Male


Registered: 10/31/07
Posts: 1,935
Loc: Canada
Re: Your/You're [Re: Koala Koolio]
    #8170485 - 03/20/08 05:28 AM (5 months, 8 days ago)

Great poll :rofl2:


Post Extras: Print Post  Remind Me!  Notify Moderator   Ignore User 
InvisibleItchycooGirl
Muse
Female


Registered: 05/24/08
Posts: 4
Loc: California
Re: Your/You're [Re: Cameron]
    #8440889 - 05/24/08 04:21 PM (3 months, 4 days ago)

Sometimes things like your/you're and its/it's are what I think of as 'phonetic typos'. It's not like I don't know the difference, but when I'm in the rush of typing, sometimes my fingers answer to my ear more readily than to my meaning and grammatical sense. By/buy/bye/bi... there/their... two/to/too... there are others like that. I always correct them if I catch them before I post something. And I'll fix them in a post if I see them after I post. Usually it's not important. But sometimes they can temporarily throw off the meaning of what you're trying to say. Like, in the previous sentence, I might have said it can "throw off the meaning of what you're thought actually is."

Ya no? :tongue2:


Post Extras: Print Post  Remind Me!  Notify Moderator   Ignore User 
Jump to top. Pages: < Back | 1 | 2  [ show all ]

Feedback and Administration >> Shroomery Polls

Similar ThreadsPosterViewsRepliesLast post
* Personality Test
( 1 2 3 all )
TODAY
2,093 42 07/16/06 12:06 PM
by musicturkey
* Who is God?
( 1 2 all )
Demotriton
1,336 24 04/14/07 10:02 AM
by Colonel Kurtz Ph.D
* How many times do you masturbate in 1 day?
( 1 2 all )
p4kSouL
1,260 22 03/04/05 03:09 PM
by Locus
* Would you eat these?
Sneakyt33
702 15 07/29/08 07:45 AM
by fapjack
* Should rapists be castrated?
( 1 2 3 4 all )
GumbyS
3,845 61 03/03/05 04:27 AM
by Locus
* What level do you like to trip on dried mushrooms?
Psilocybin_monkey
1,627 16 07/07/04 02:34 PM
by
* Are you open to the idea of love?
Enter
690 11 11/25/04 11:08 PM
by Gumby
* The great potency debate
( 1 2 all )
DreaMaTrix
6,304 39 07/17/05 12:08 PM
by GNIOM1498

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / UBBCode is enabled
Moderator:  Colonel Kurtz Ph.D 
2,770 topic views. 0 registered and 1 anonymous users are browsing this forum.
[ Toggle Favorite | Print Topic ]

del.icio.us del.icio.us Digg digg Furl Furl MyWeb MyWeb Reddit reddit StumbleUpon StumbleUpon
Search this thread:
AzariusPlease support our sponsors.

Copyright 1997-2008 Mind Media. Some rights reserved.

Generated in 0.146 seconds spending 0.041 seconds on 17 queries.