|
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
|
Nickster_154371
entheogen enthusiast
Registered: 01/01/04
Posts: 469
Last seen: 6 years, 8 months
|
How to test if DMT is legit?...with out trying it first!
#6621445 - 02/28/07 06:01 PM (17 years, 1 month ago) |
|
|
A friend of a friend (literally), a chemist major, claimed to have synthesized dmt. He gave some to my other friend to try, however, my friend would prefer to test the powder given to him somehow before trying it. He has no experience with dmt whatsoever.
What type of field tests, besides trying it, can this friend of mine do to try to determine that what he has is legit dmt and not something that could potentially be harmful?
Cheers,
-N
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG
Registered: 01/07/04
Posts: 7,752
|
Re: How to test if DMT is legit?...with out trying it first! [Re: Nickster_154371]
#6621468 - 02/28/07 06:06 PM (17 years, 1 month ago) |
|
|
A chemist major? What year? How much experience does he have?
There's no way to tell based on this information. It's certainly not impossible for a chem major to make it. But it's unlikely a freshman who has taken one class has done it. If he has, the fact that he's a chem major isn't what proves it.
He could also be a chem major who's about to graduate and just isn't an honest person, and did a simple extraction and tried to make himself sound more professional, or maybe even just ordered 5-meo-dmt on the internet?
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
Drewwyann
Slayer of ticks
Registered: 10/30/06
Posts: 4,077
Loc: Atlantis
Last seen: 10 years, 5 months
|
Re: How to test if DMT is legit?...with out trying it first! [Re: Koala Koolio]
#6621488 - 02/28/07 06:10 PM (17 years, 1 month ago) |
|
|
i dunno if theres a way to test for it. i think the best way to test is just to smoke it =P.
-------------------- Anyone need a glass pipe? : http://www.facebook.com/profile.php?id=100002435158931 Love powerfully
|
AlCapwn
ID Reset, take that subpoena
Registered: 02/03/07
Posts: 2,957
Loc: Canada
Last seen: 2 years, 9 months
|
Re: How to test if DMT is legit?...with out trying it first! [Re: Drewwyann]
#6621509 - 02/28/07 06:17 PM (17 years, 1 month ago) |
|
|
Yeah, but what if it turns out it's something fucking crazy.
-------------------- Huuuuurrrrrr!
|
EllisDSox
King Hella!
Registered: 01/22/07
Posts: 25,730
|
Re: How to test if DMT is legit?...with out trying it first! [Re: AlCapwn]
#6621524 - 02/28/07 06:20 PM (17 years, 1 month ago) |
|
|
Compare it to photographs of known pure DMT, or just smoke a tiny bit. There's not much else that will do anything smoked at the same low quantities as DMT.
-------------------- Disclaimer: If you have any kind of heart condition, my posts are not for you. You could literally die from reading the first couple of words in any one of them. Scroll down the page, live your life and prosper, but don't read my posts because your heart will probably explode. I am not joking.
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG
Registered: 01/07/04
Posts: 7,752
|
Re: How to test if DMT is legit?...with out trying it first! [Re: EllisDSox]
#6621559 - 02/28/07 06:32 PM (17 years, 1 month ago) |
|
|
If it's 5-MeO-DMT and he smokes an n,n-DMT sized dose he's going to be *very* sorry.
DMT dosages aren't that low.
-------------------- You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
|
Chesh
道
Registered: 01/21/07
Posts: 107
Loc: bardo
Last seen: 11 years, 11 months
|
Re: How to test if DMT is legit?...with out trying it first! [Re: Nickster_154371]
#6621597 - 02/28/07 06:42 PM (17 years, 1 month ago) |
|
|
You could do a melting point test; pure DMT melts between 64 and 67C, but anything that melts above sixty should be reasonably pure.
It's also an aromatic amine, and as such should make a grain alcohol/water mixture slightly basic (around 8.7pH).
Those aren't the best tests, but they're better than saying 'yup, that looks like a white power.'
*the bp is from TiHKAL
Edited by Chesh (02/28/07 06:51 PM)
|
Hanky
wiffle bat.
Registered: 08/30/03
Posts: 56,993
Loc: Great Southern Land.
|
Re: How to test if DMT is legit?...with out trying it first! [Re: Nickster_154371]
#6621611 - 02/28/07 06:47 PM (17 years, 1 month ago) |
|
|
It should smell like very stinky burned plastic.
-------------------- Coaster is an idiot... [quote]Coaster said: but i thnk everything thats pure is white? [/quote]
|
confusion
ProfessionalNovice
Registered: 10/28/06
Posts: 400
Last seen: 3 years, 6 months
|
Re: How to test if DMT is legit?...with out trying it first! [Re: Chesh]
#6621616 - 02/28/07 06:49 PM (17 years, 1 month ago) |
|
|
Isn't DMT an orange powder?
|
DeathCompany
Oneironaut
Registered: 03/16/05
Posts: 12,662
Loc: Somewhere in my head
Last seen: 1 year, 2 days
|
Re: How to test if DMT is legit?...with out trying it first! [Re: confusion]
#6621627 - 02/28/07 06:52 PM (17 years, 1 month ago) |
|
|
if its not pure and its not always powder
--------------------
|
Mezcal
Registered: 08/11/05
Posts: 1,980
|
Re: How to test if DMT is legit?...with out trying it first! [Re: confusion]
#6621628 - 02/28/07 06:52 PM (17 years, 1 month ago) |
|
|
No, poorly extracted DMT typically contains tannins from the dissolved particles of the organic phase within the non-polar.
|
|