Home | Community | Message Board


This site includes paid links. Please support our sponsors.


Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Shop: Kraken Kratom Red Vein Kratom   Left Coast Kratom Kratom Powder For Sale   North Spore Injection Grain Bag, North Spore Mushroom Grow Kits & Cultivation Supplies

Jump to first unread post Pages: 1
Some of these posts are very old and might contain outdated information. You may wish to search for newer posts instead.
OfflineNickster_154371
entheogen enthusiast
Male
Registered: 01/01/04
Posts: 469
Last seen: 6 years, 8 months
How to test if DMT is legit?...with out trying it first!
    #6621445 - 02/28/07 06:01 PM (17 years, 1 month ago)

A friend of a friend (literally), a chemist major, claimed to have synthesized dmt. He gave some to my other friend to try, however, my friend would prefer to test the powder given to him somehow before trying it. He has no experience with dmt whatsoever.

What type of field tests, besides trying it, can this friend of mine do to try to determine that what he has is legit dmt and not something that could potentially be harmful?

Cheers,

-N

Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: How to test if DMT is legit?...with out trying it first! [Re: Nickster_154371]
    #6621468 - 02/28/07 06:06 PM (17 years, 1 month ago)

A chemist major? What year? How much experience does he have?

There's no way to tell based on this information. It's certainly not impossible for a chem major to make it. But it's unlikely a freshman who has taken one class has done it. If he has, the fact that he's a chem major isn't what proves it.

He could also be a chem major who's about to graduate and just isn't an honest person, and did a simple extraction and tried to make himself sound more professional, or maybe even just ordered 5-meo-dmt on the internet?


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!

Extras: Filter Print Post Top
OfflineDrewwyann
Slayer of ticks
Male User Gallery

Registered: 10/30/06
Posts: 4,077
Loc: Atlantis
Last seen: 10 years, 5 months
Re: How to test if DMT is legit?...with out trying it first! [Re: Koala Koolio]
    #6621488 - 02/28/07 06:10 PM (17 years, 1 month ago)

i dunno if theres a way to test for it. i think the best way to test is just to smoke it =P.


--------------------


Anyone need a glass pipe? : http://www.facebook.com/profile.php?id=100002435158931

Love powerfully :peace::heart::peace:

Extras: Filter Print Post Top
OfflineAlCapwn
ID Reset, take that subpoena

Registered: 02/03/07
Posts: 2,957
Loc: Canada
Last seen: 2 years, 9 months
Re: How to test if DMT is legit?...with out trying it first! [Re: Drewwyann]
    #6621509 - 02/28/07 06:17 PM (17 years, 1 month ago)

Yeah, but what if it turns out it's something fucking crazy.


--------------------
Huuuuurrrrrr!

Extras: Filter Print Post Top
InvisibleEllisDSox
King Hella!

Registered: 01/22/07
Posts: 25,730
Re: How to test if DMT is legit?...with out trying it first! [Re: AlCapwn]
    #6621524 - 02/28/07 06:20 PM (17 years, 1 month ago)

Compare it to photographs of known pure DMT, or just smoke a tiny bit. There's not much else that will do anything smoked at the same low quantities as DMT.


--------------------
Disclaimer: If you have any kind of heart condition, my posts are not for you. You could literally die from reading the first couple of words in any one of them. Scroll down the page, live your life and prosper, but don't read my posts because your heart will probably explode. I am not joking.

Extras: Filter Print Post Top
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: How to test if DMT is legit?...with out trying it first! [Re: EllisDSox]
    #6621559 - 02/28/07 06:32 PM (17 years, 1 month ago)

If it's 5-MeO-DMT and he smokes an n,n-DMT sized dose he's going to be *very* sorry.

DMT dosages aren't that low.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!

Extras: Filter Print Post Top
OfflineChesh


Registered: 01/21/07
Posts: 107
Loc: bardo
Last seen: 11 years, 11 months
Re: How to test if DMT is legit?...with out trying it first! [Re: Nickster_154371]
    #6621597 - 02/28/07 06:42 PM (17 years, 1 month ago)

You could do a melting point test; pure DMT melts between 64 and 67C, but anything that melts above sixty should be reasonably pure.

It's also an aromatic amine, and as such should make a grain alcohol/water mixture slightly basic (around 8.7pH).

Those aren't the best tests, but they're better than saying 'yup, that looks like a white power.'

*the bp is from TiHKAL

Edited by Chesh (02/28/07 06:51 PM)

Extras: Filter Print Post Top
InvisibleHanky
wiffle bat.
Male User Gallery
Registered: 08/30/03
Posts: 56,993
Loc: Great Southern Land.
Re: How to test if DMT is legit?...with out trying it first! [Re: Nickster_154371]
    #6621611 - 02/28/07 06:47 PM (17 years, 1 month ago)

It should smell like very stinky burned plastic.


--------------------
Coaster is an idiot...
[quote]Coaster said:
but i thnk everything thats pure is white?
[/quote]



Extras: Filter Print Post Top
Offlineconfusion
ProfessionalNovice
Male User Gallery

Registered: 10/28/06
Posts: 400
Last seen: 3 years, 6 months
Re: How to test if DMT is legit?...with out trying it first! [Re: Chesh]
    #6621616 - 02/28/07 06:49 PM (17 years, 1 month ago)

Isn't DMT an orange powder?

Extras: Filter Print Post Top
OfflineDeathCompany
Oneironaut
Male User Gallery

Registered: 03/16/05
Posts: 12,662
Loc: Somewhere in my head
Last seen: 1 year, 2 days
Re: How to test if DMT is legit?...with out trying it first! [Re: confusion]
    #6621627 - 02/28/07 06:52 PM (17 years, 1 month ago)

if its not pure and its not always powder


--------------------

Extras: Filter Print Post Top
InvisibleMezcal
Registered: 08/11/05
Posts: 1,980
Re: How to test if DMT is legit?...with out trying it first! [Re: confusion]
    #6621628 - 02/28/07 06:52 PM (17 years, 1 month ago)

No, poorly extracted DMT typically contains tannins from the dissolved particles of the organic phase within the non-polar.

Extras: Filter Print Post Top
Jump to top Pages: 1

Shop: Kraken Kratom Red Vein Kratom   Left Coast Kratom Kratom Powder For Sale   North Spore Injection Grain Bag, North Spore Mushroom Grow Kits & Cultivation Supplies


Similar ThreadsPosterViewsRepliesLast post
* Another Drug Test Question....sorry....but its a quick one Mr. Faggot 1,577 6 03/26/04 08:43 PM
by whiterabbit13
* My friend needs info on a piss test...... LearyfanS 2,410 9 05/01/02 01:38 AM
by DaMigraine
* drug tests - urin exp. date growin 1,501 9 12/05/02 03:19 AM
by growin
* do they test shrooms on Drug Tests? DeadPhan 9,047 19 07/30/04 12:50 PM
by masterg
* DMT in fetuses.
( 1 2 all )
HidingInPlainSight 7,509 29 09/19/03 01:35 PM
by Twirling
* DMT USERS please - + -
( 1 2 all )
YellowSubmarine 4,995 20 02/11/04 05:15 AM
by butterflydawn
* Drug test Tokabol 1,060 10 03/29/04 09:41 PM
by Ravus
* Easier to produce...Shrooms Or DMT?
( 1 2 all )
orizon 14,036 34 07/23/08 04:23 AM
by shroomzey

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: psilocybinjunkie, Rose, mushboy, LogicaL Chaos, Northerner, bodhisatta
14,388 topic views. 2 members, 46 guests and 31 web crawlers are browsing this forum.
[ Show Images Only | Sort by Score | Print Topic ]
Search this thread:

Copyright 1997-2024 Mind Media. Some rights reserved.

Generated in 0.03 seconds spending 0.009 seconds on 14 queries.