Home | Community | Message Board


Please support our sponsors.

Feedback and Administration >> Shroomery Polls

Welcome to the Shroomery Message Board! Please login or register to post messages and view our members-only content. You'll gain access to additional forums, encrypted messages, file attachments, board customizations, and much more!

Pages: 1 | 2 | Next >  [ show all ]
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,734
Your/You're
    #6535236 - 02/05/07 10:21 PM (1 year, 9 months ago)

When browsing the internet, one can't help but notice the overwhelming amount of people who clearly have no idea what the difference between these two words is. The shroomery is better than many places, but hey... here's a poll.
The You(')r(e) poll.
You may choose only one
I correctly use the words, but I have to think about it briefly each time.
I couldn't care less, and I post whichever my hands are in the mood to type at that particular moment. I can't be bothered with such details, and am a true child of the internet, u know.
I'm a big boy/girl. I don't need to think about such details because, as my paperwork will show you , I have met or exceeded all necessary requirements needed to pass the 6th grade.


Votes accepted from (02/05/07 10:19 PM) to (No end specified)
View the results of this poll



--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me!  Notify Moderator   Ignore User 
InvisibleMikeyyork
A+ Moron
Male User Gallery

Folding@home Statistics
Registered: 10/28/05
Posts: 3,347
Loc: Yorkshire, England
Re: Your/You're [Re: Koala Koolio]
    #6539590 - 02/07/07 08:41 AM (1 year, 9 months ago)

It's quite simple really,, :smile:.


--------------------
" mongle mongle "
.........---:toomuchacid:---..........


Post Extras: Print Post  Remind Me!  Notify Moderator   Ignore User 
Offlineivi
 User Gallery

Registered: 01/30/03
Posts: 8,763
Last seen: 23 hours, 23 minutes
Re: Your/You're [Re: Koala Koolio]
    #6540249 - 02/07/07 12:41 PM (1 year, 9 months ago)

Don't be rediculous.


--------------------
Cornell Mushroom Blog
Introduction  to Fungal Biology
Micro and Macro Photography
Boards of Canada
Lingua Latina
Chess


Post Extras: Print Post  Remind Me!  Notify Moderator   Ignore User 
Offlinebarfightlard
tales of theinexpressible
Male

Folding@home Statistics
Registered: 01/29/03
Posts: 8,659
Loc: Canoodia
Last seen: 3 months, 1 day
Re: Your/You're [Re: Koala Koolio]
    #6540355 - 02/07/07 01:07 PM (1 year, 9 months ago)

Your dumb:wink:


--------------------

"What business is it of yours what I do, read, buy, see, say, think, who I fuck, what I take into my body - as long as I do not harm another human being on this planet?" - Bill Hicks


Post Extras: Print Post  Remind Me!  Notify Moderator   Ignore User 
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,734
Re: Your/You're [Re: ivi]
    #6542538 - 02/07/07 10:28 PM (1 year, 9 months ago)

Quote:

barfightlard said:
Your dumb;)




Isn't it great when someone replies to you with this, or leaves feedback like this? No response necessary, they've done all the work! :smile:

Quote:

ivi said:
Don't be rediculous.




:laugh:

I've seen that one spelled all sorts of ways, and that one can be fixed with spell check.. What is it with some people? They're grammar is neither here nor their, and it seems like there getting dumber by the day!


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me!  Notify Moderator   Ignore User 
OfflineSofaKingGood
That's stupidman, that'suniversallystupid.
Male User Gallery

Folding@home Statistics
Registered: 06/23/06
Posts: 536
Loc: Orlando Florida
Last seen: 4 months, 4 days
Re: Your/You're [Re: Koala Koolio]
    #6543293 - 02/08/07 04:33 AM (1 year, 9 months ago)

Wow nice use of they're their and there, I take it that was done purposely. I don't have to think about it because like the option said, my paperwork speaks for itself.


--------------------
Hate me? Take a number.
“No drug, not even alcohol, causes the fundamental ills of society. If we're looking for the source of our troubles, we shouldn't test people for drugs, we should test them for stupidity, ignorance, greed and love of power.”


[quote]I8thesh400m said:
he-has-as-have-i-chek-My-ratings:thumbup:
to-the-post-origionator-5-to-you
there-are-nice-people-but-be-smart
my-spacebar-is-broke:p [/quote]
"Of all the things I've lost, I miss my mind the most."


Post Extras: Print Post  Remind Me!  Notify Moderator   Ignore User 
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,734
Re: Your/You're [Re: SofaKingGood]
    #6543830 - 02/08/07 11:20 AM (1 year, 9 months ago)

It actually took a bit of thinking to use all three improperly. Much more so than doing it correctly at least.

Also considered spelling grammar "grammer", but figured people might have found it unintentional.

You're grammer sucks!


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me!  Notify Moderator   Ignore User 
OfflineCureCatM
Strangest
 User Gallery

Registered: 04/19/06
Posts: 9,341
Loc: clawing your furniture
Last seen: 7 hours, 9 minutes
Re: Your/You're [Re: Koala Koolio]
    #6546628 - 02/09/07 01:44 AM (1 year, 9 months ago)

I peeve over this sort of thing...


--------------------


Wish is very sweet, obviously, but curecat is roughly as sweet as an unripe lemon.

drrrrr ddd..dd. like I'm curecat and I'm a spastic retard
:slug:


Post Extras: Print Post  Remind Me!  Notify Moderator    
OfflineEquilibriuM
dream stalker

Registered: 07/17/05
Posts: 2,323
Last seen: 1 year, 5 months
Re: Your/You're [Re: Koala Koolio]
    #6548514 - 02/09/07 07:03 PM (1 year, 9 months ago)

Doesn't bother me one bit. I often spell "you're" as "your" because, well... its just less letters. Besides, if you can't tell the meaning by reading the context, maybe it's you who should go back to school...

What bothers me is when people don't use any kind of punctuation or paragraphing.


--------------------
HELP!!!!!!!!!


Post Extras: Print Post  Remind Me!  Notify Moderator   Ignore User 
OfflineDieCommie
Ally

Registered: 12/11/03
Posts: 7,653
Loc: The Union
Last seen: 5 hours, 1 minute
Re: Your/You're [Re: EquilibriuM]
    #6548593 - 02/09/07 07:29 PM (1 year, 9 months ago)

Much to do about nothing. As long as the idea is communicated properly, what is the problem? Words are here to serve our needs of communication/expression, let us not start serving them by trite, old traditions. If the grammar/spelling is so bad that communication is inhibited, then I can agree.

disclosure- I am horrid at spelling and grammar, so Im sure that why I feel this way :smile:


--------------------
Behold yon miserable creature. That Point is a Being like ourselves, but confined to the non-dimensional Gulf. He is himself his own World, his own Universe; of any other than himself he can form no conception; he knows not Length, nor Breadth, nor Height, for he has had no experience of them; he has no cognizance even of the number Two; nor has he a thought of Plurality; for he is himself his One and All, being really Nothing. Yet mark his perfect self-contentment, and hence learn his lesson, that to be self-contented is to be vile and ignorant, and that to aspire is better than to be blindly and impotently happy.


Post Extras: Print Post  Remind Me!  Notify Moderator   Ignore User 
InvisibleSilversoul
PleromaticExplorer
Male User Gallery

Registered: 01/01/05
Posts: 15,297
Loc: Mostly harmless
Re: Your/You're [Re: Koala Koolio]
    #6548825 - 02/09/07 09:16 PM (1 year, 9 months ago)

My dad was always correcting my grammar when I was growing up, and it's really rubbed off on me. As such, I have excellent grammar, although sometimes I still make typos.


--------------------

"I happen to be the CEO of the Committee for Surrealist Investigation of Claims of the Normal, and we actually are offering $10,000 to anybody who can produce anything that is totally normal in all respects, or even average." -- Robert Anton Wilson


Post Extras: Print Post  Remind Me!  Notify Moderator   Ignore User 
OfflineNalimM
Registered: 01/13/06
Posts: 11,256
Last seen: 10 hours, 15 minutes
Re: Your/You're [Re: Koala Koolio]
    #6571226 - 02/15/07 03:43 PM (1 year, 9 months ago)

The funniest thing about this that this is my second language and I get it. Still there seems to be a lot of you real English speaking folks that don't know how to use it..


Post Extras: Print Post  Remind Me!  Notify Moderator    
OfflineUndercoverCop
Stranger

Registered: 02/15/07
Posts: 75
Last seen: 2 months, 14 days
Re: Your/You're [Re: Nalim]
    #6577382 - 02/17/07 07:25 AM (1 year, 9 months ago)

I hate it t when people use it the wrong way. I usually just be a dick and act like I don't understand what they are talking about.


Post Extras: Print Post  Remind Me!  Notify Moderator   Ignore User 
Offlinebarfightlard
tales of theinexpressible
Male

Folding@home Statistics
Registered: 01/29/03
Posts: 8,659
Loc: Canoodia
Last seen: 3 months, 1 day
Re: Your/You're [Re: UndercoverCop]
    #6577442 - 02/17/07 08:22 AM (1 year, 9 months ago)

Quote:

UndercoverCop said:
I hate it t when people use it the wrong way. I usually just be a dick and act like I don't understand what they are talking about.




thats why you have no friends


--------------------

"What business is it of yours what I do, read, buy, see, say, think, who I fuck, what I take into my body - as long as I do not harm another human being on this planet?" - Bill Hicks


Post Extras: Print Post  Remind Me!  Notify Moderator   Ignore User 
OfflineUndercoverCop
Stranger

Registered: 02/15/07
Posts: 75
Last seen: 2 months, 14 days
Re: Your/You're [Re: barfightlard]
    #6578210 - 02/17/07 12:55 PM (1 year, 9 months ago)

Quote:

barfightlard said:
Quote:

UndercoverCop said:
I hate it t when people use it the wrong way. I usually just be a dick and act like I don't understand what they are talking about.




thats why you have no friends




I'm sorry, do you know me? There's no way, or you would know that I have plenty of very close freinds. Nice try.


Post Extras: Print Post  Remind Me!  Notify Moderator   Ignore User 
InvisibleBoom
analyst/therapist

Registered: 06/16/04
Posts: 10,628
Loc: US and A
Re: Your/You're [Re: UndercoverCop]
    #6578212 - 02/17/07 12:57 PM (1 year, 9 months ago)

Your lying


Post Extras: Print Post  Remind Me!  Notify Moderator   Ignore User 
Offlinebarfightlard
tales of theinexpressible
Male

Folding@home Statistics
Registered: 01/29/03
Posts: 8,659
Loc: Canoodia
Last seen: 3 months, 1 day
Re: Your/You're [Re: UndercoverCop]
    #6578431 - 02/17/07 01:54 PM (1 year, 9 months ago)

WoW doesn't count.


--------------------

"What business is it of yours what I do, read, buy, see, say, think, who I fuck, what I take into my body - as long as I do not harm another human being on this planet?" - Bill Hicks


Post Extras: Print Post  Remind Me!  Notify Moderator   Ignore User 
OfflineUndercoverCop
Stranger

Registered: 02/15/07
Posts: 75
Last seen: 2 months, 14 days
Re: Your/You're [Re: barfightlard]
    #6578782 - 02/17/07 03:39 PM (1 year, 9 months ago)

I'm not going to argue with a bunch of ignorant people who for some reason think they are physic. I guess I have more freinds then you guys or I would be attacking random people claiming that they have no freinds. LOL


Post Extras: Print Post  Remind Me!  Notify Moderator   Ignore User 
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,734
Re: Your/You're [Re: barfightlard]
    #6580354 - 02/18/07 01:43 AM (1 year, 9 months ago)

Quote:

barfightlard said:
WoW doesn't count.




Now, is that 'white on white' or 'World of Warcraft'? This is the only where that could ever be confusing. :laugh:

"The funniest thing about this that this is my second language and I get it. Still there seems to be a lot of you real English speaking folks that don't know how to use it.. "

I'd actually make the assumption that one would be less likely to make that kind of mistake if he or she had properly learned English as a second language, especially in a school-type setting. Teachers can be hard asses about little details like that.

People have made this mistake for ages, and it doesn't usually get to me. But I think the age of relaxed internet speech has made it worse. I'll take a misused 'your' over an 'ur' any day. And if you rely on 'ur' for both words in your online chatting when you're young, you might just start to lose your grip of which one is right.

'ur' will always read as "err" or "urr" to me. And 'u' will always read as "ew" or "oo". Can't seem to force myself around it. oo went to the store today and bought urr mom some candies!


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me!  Notify Moderator   Ignore User 
Invisibledemius
heeeeeeehaaaaaw!
 User Gallery

Registered: 08/18/05
Posts: 26,478
Loc: Earth
Re: Your/You're [Re: Koala Koolio]
    #6589030 - 02/20/07 10:54 AM (1 year, 9 months ago)

It's the worst when you find these grammar errors in text books or literature


Post Extras: Print Post  Remind Me!  Notify Moderator   Ignore User 
Jump to top. Pages: 1 | 2 | Next >  [ show all ]

Feedback and Administration >> Shroomery Polls

Similar ThreadsPosterViewsRepliesLast post
* Personality Test
( 1 2 3 all )
TODAY
2,326 42 07/16/06 12:06 PM
by musicturkey
* Who is God?
( 1 2 all )
Demotriton
1,551 24 04/14/07 10:02 AM
by Colonel Kurtz Ph.D
* How many times do you masturbate in 1 day?
( 1 2 all )
p4kSouL
1,356 22 03/04/05 03:09 PM
by Locus
* Would you eat these?
Sneakyt33
931 15 07/29/08 07:45 AM
by fapjack
* Should rapists be castrated?
( 1 2 3 4 all )
GumbyS
4,011 61 03/03/05 04:27 AM
by Locus
* What level do you like to trip on dried mushrooms?
Psilocybin_monkey
1,759 16 07/07/04 02:34 PM
by
* Are you open to the idea of love?
Enter
731 11 11/25/04 11:08 PM
by Gumby
* The great potency debate
( 1 2 all )
DreaMaTrix
6,565 39 07/17/05 12:08 PM
by GNIOM1498

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / UBBCode is enabled
Moderator:  Colonel Kurtz Ph.D 
3,154 topic views. 0 registered and 0 anonymous users are browsing this forum.
[ Toggle Favorite | Print Topic ]

del.icio.us del.icio.us Digg digg Furl Furl MyWeb MyWeb Reddit reddit StumbleUpon StumbleUpon
Search this thread:
SporeworksPlease support our sponsors.

Copyright 1997-2008 Mind Media. Some rights reserved.

Generated in 0.171 seconds spending 0.02 seconds on 21 queries.