Home | Community | Message Board


Out-Grow.com - Mushroom Growing Kits & Supplies
Please support our sponsors.

Mushrooms, Mycology and Psychedelics >> The Ethnobotanical Garden

Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

Amazon Shop for: San Pedro

Jump to first unread post. Pages: < Back | 1 | 2  [ show all ]
Offlinemr_minds_eye
Disposable Wage Whore
Male User Gallery
Registered: 01/22/02
Posts: 1,948
Loc: Samsara
Last seen: 4 months, 29 days
Re: Is mescaline content in lophs a funtion of age or size? [Re: Brewmaster]
    #6157973 - 10/11/06 02:12 PM (6 years, 8 months ago)

Would giving the cactus L-Dopa do anything?


--------------------
Our quest for discovery fuels our creativity in all fields, not just science. If we reached the end of the line, the human spirit would shrivel and die. But I don't think we will ever stand still: we shall increase in complexity, if not in depth, and shall always be the center on an expanding horizon of possibilities.
-Stephen Hawking


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleBrewmaster
Stranger
Male User Gallery

Registered: 09/27/06
Posts: 1,097
Re: Is mescaline content in lophs a funtion of age or size? [Re: mr_minds_eye]
    #6158914 - 10/11/06 05:43 PM (6 years, 8 months ago)

Dopamine is a precursor to mescaline. Schultes has proclaimed that injecting a cactus w/ dopamine 4 weeks prior to harvesting can increase mesc content. However, there is no scientific evidence to prove that a cactus actually has the ability to convert dopamine into mescaline.

Mr. Mind, Are you by chance the proprietor of a certain website that bears a resemblance to that name?


--------------------
On storing pedro tea...

Brewmaster: Well, the mescaline will still be in there, but I'd be afraid of it conjealing and trying to escape after it grew in size from eating all the other shit in my fridge, and possibly my dogs if it got out.

Pithlit: sentient drugs, now thats is an idea ...

OneMoreRobot: Idea? It's a fuckin' reality. You know Salvia? Nigga stole my TV.


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Is mescaline content in lophs a funtion of age or size? [Re: Brewmaster]
    #6159028 - 10/11/06 06:14 PM (6 years, 8 months ago)

Actually, I believe that's not him. I think I messaged him when he joined, and the person you're looking for is Rabbit or something.

Indeed, the dopamine thing is questionable.

I think Ekstaza summed up my opinion on the subject perfectly.

brewmaster makes a good point that the composition isn't the same as a root grown one of that size. You've got more water, simply because the peyote root isn't designed to absorb water at an incredible speed. It needs to be so long to even find water.

But, I do think a grafted 3 year old (which could be baseball sized) would have more than a nickle sized 3 year old on roots. With grafted buttons, you have more cells, faster growth not only in plumping up, but as far as areoles go. Although it doesn't compare to a root grown one of the same size, I think there is likely more alkaloids than one of the same age. There was study conducted which suggests that grafted cacti don't suffer alkaloid loss. But, I don't remember if it was in terms of age or size. Age, I assume.

Well, a grafted button will certainly flower much sooner than a root grown button. I wonder what triggers this? I also wonder what triggers alkaloid production, since there's more to it than just a slow build up (it will vary by time of year). I've seen pictures of grafts flowering in less than a year, though that's way better than average.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleBlueDruid
Stranger
 User Gallery
Registered: 06/27/06
Posts: 807
Re: Is mescaline content in lophs a funtion of age or size? [Re: Koala Koolio]
    #6161106 - 10/12/06 08:07 AM (6 years, 8 months ago)

It seems obvious from reading this thread that no one has any definitive answers. Neither do I.

That established we ought to turn now to the question how do we get a definitive answer on the relative rates of mescaline production in grafted & seed grown Lophophoras. The best solution to my mind would be to actually do the experiment.

Anyone have a few lophos grown from seeds from the same plant (or at least 2 pups from the same lopho) who is willing to graft one & grow one normally for a year+ before doing a mescaline extraction & comparison?


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleBrewmaster
Stranger
Male User Gallery

Registered: 09/27/06
Posts: 1,097
Re: Is mescaline content in lophs a funtion of age or size? [Re: BlueDruid]
    #6161426 - 10/12/06 11:27 AM (6 years, 8 months ago)

I'm not going to go through the trouble of doing mesc extractions with the relatively few "hard grown" peyotes that I have but I'll tell you one thing. I have eaten a 15 year old button a little larger than a soft ball which came from the same farm as all of mine and ( as expected ) it tasted like ass. Very bitter, almost exactly like san pedro. I had a great time and tripped face for 18 hours.

I have also eaten a button of the same size that I grew from seed ( from the same source ) and grafted onto a myrtillo and then to a pedro. It was then allowed to root and spent a year in the dirt. This cactus had no taste. This is a sure sign of a lack of alkaloids. I followed this one with a second hoping for some weak effects but none were to be had. That's all the research I need.


--------------------
On storing pedro tea...

Brewmaster: Well, the mescaline will still be in there, but I'd be afraid of it conjealing and trying to escape after it grew in size from eating all the other shit in my fridge, and possibly my dogs if it got out.

Pithlit: sentient drugs, now thats is an idea ...

OneMoreRobot: Idea? It's a fuckin' reality. You know Salvia? Nigga stole my TV.


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Is mescaline content in lophs a funtion of age or size? [Re: Brewmaster]
    #6161597 - 10/12/06 12:29 PM (6 years, 8 months ago)

"Anyone have a few lophos grown from seeds from the same plant (or at least 2 pups from the same lopho) who is willing to graft one & grow one normally for a year+ before doing a mescaline extraction & comparison?"

This is much more of a sacrifice than it sounds. You would need to be a professional to get anything measurable from a year old or two year old loph button. Most people wouldn't want to spare their babies for something that likely won't yield any real results. 5+ year buttons, maybe. But you're not going to get all the glorious alkaloids that exist in the species when you extract it. Most who have a grown button or two would much rather either keep growing it, or eat a couple with some trichocereus for the interesting extra alks they provide.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinehooksbooks
Fun Guy
Male

Registered: 06/26/06
Posts: 417
Loc: Central, TX
Last seen: 1 year, 6 months
Re: Is mescaline content in lophs a funtion of age or size? [Re: Koala Koolio]
    #6168955 - 10/14/06 02:45 PM (6 years, 8 months ago)

A few things. Im pretty sure wild peyote is the strongest. A shaman in mexico once squeezed one of the bottons I had picked. HE explained that the firmness had a lot to do with potency. I would imagine that a grafted loph, esp one from a pereskiopsis, would possibly burst in your hand. Second, i think light periods, shading, and watering has a lot to do with it as well. its wierd to think that an abused cactus could be better, but it doesnt sound that far off. Oh yeah, and i have mine grafted to pereskiopsis, and one sprouted a baby in less than a month. i have williamsii and w v. texensis. can anybody tell me the difference between these? as i pretty much planted the seeds, grafted, and theyre now all mixed up.


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Is mescaline content in lophs a funtion of age or size? [Re: hooksbooks]
    #6168983 - 10/14/06 03:00 PM (6 years, 8 months ago)

"A few things. Im pretty sure wild peyote is the strongest."

Oh, I'm sure. But not by age, is my understanding. Nor is the growth as fast as cultivated ones. But, a button the size of a cultivated one could've been building alkaloids up for 30 years.

"HE explained that the firmness had a lot to do with potency."

Maybe the firmness is an indication of age?

"Second, i think light periods, shading, and watering has a lot to do with it as well."

As well as time of year harvested. Some even suggest that time of day may be a factor.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleVirgilKane
Miner for truth and delusion
 User Gallery

Registered: 05/17/05
Posts: 1,131
Loc: lowdown
Re: Is mescaline content in lophs a funtion of age or size? [Re: Koala Koolio]
    #6169041 - 10/14/06 03:26 PM (6 years, 8 months ago)

"Maybe the firmness is an indication of age?"

Or water content....


--------------------
Absense of evidence is not evidence of absense...

"Religion is a defense against a religious experience"
              Carl G. Jung

 
"So really, ordinary reality is a kind of chemical habit, sanctioned by culture, which says it's okay to use certain drugs, eat certain foods, and have certain sexual behaviors. However, when you transcend all this pre-conditioning by returning to the original wisdom of the animal body, then you discover this immense dimension of opportunity. For some people, it is a frightening risk. To me, that's the psychedelic experience."
Terence McKenna


Post Extras: Print Post  Remind Me! Notify Moderator
Invisiblezee_werp
a fractalcreature
 User Gallery

Registered: 03/25/03
Posts: 1,026
Loc: Aotearoa
Re: Is mescaline content in lophs a funtion of age or size? [Re: hooksbooks]
    #6169688 - 10/14/06 08:19 PM (6 years, 8 months ago)

Quote:

hooksbooks said:
HE explained that the firmness had a lot to do with potency.




So what firmness has the highest potency?


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinepod3
Stranger
 User Gallery
Registered: 12/22/04
Posts: 362
Last seen: 6 years, 5 months
- [Re: zee_werp]
    #6173107 - 10/15/06 09:43 PM (6 years, 7 months ago)

-


Edited by pod3 (10/26/06 11:20 AM)


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleBlueDruid
Stranger
 User Gallery
Registered: 06/27/06
Posts: 807
Re: Is mescaline content in lophs a funtion of age or size? [Re: pod3]
    #6174300 - 10/16/06 07:43 AM (6 years, 7 months ago)

"HE explained that the firmness had a lot to do with potency. I would imagine that a grafted loph, esp one from a pereskiopsis, would possibly burst in your hand. "

Actually, going by my only pereskiopsis grafted Lophophora to take, they are very firm, at least at the size mine is.


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleBrewmaster
Stranger
Male User Gallery

Registered: 09/27/06
Posts: 1,097
Re: Is mescaline content in lophs a funtion of age or size? [Re: BlueDruid]
    #6175454 - 10/16/06 05:11 PM (6 years, 7 months ago)

Firmness, as with all cacti, is an indication of water content. That is all. The time of day and/or year makes no difference. Once a given amount of mescaline has been produced, it cannot be "un-produced". If the mesc content at 6:00 am = x, the mescaline is not going to be x-1 at 6:00 pm.

Some say that stressing a cactus will increase mesc content but there is no way to prove this because you can't extract the mescaline from the same raw source twice to compare results. I do have a little faith in this theory though. I grow alot of cacti, mainly pedro and peruvian and I find that a cutting that has been left in the dark, unrooted for a year or more to be much more potent than one right off the plant. This is by personal "taste tests" only, not extractions. Yes, a cutting can live in the dark for a year with no water if it's large enough. Amazing little fuckers they are.


--------------------
On storing pedro tea...

Brewmaster: Well, the mescaline will still be in there, but I'd be afraid of it conjealing and trying to escape after it grew in size from eating all the other shit in my fridge, and possibly my dogs if it got out.

Pithlit: sentient drugs, now thats is an idea ...

OneMoreRobot: Idea? It's a fuckin' reality. You know Salvia? Nigga stole my TV.


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: Is mescaline content in lophs a funtion of age or size? [Re: Brewmaster]
    #6176826 - 10/16/06 11:56 PM (6 years, 7 months ago)

"The time of day and/or year makes no difference."

There are people native to the regions in which the cacti grow who tend to think differently as far as the time of year goes.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me! Notify Moderator
Jump to top. Pages: < Back | 1 | 2  [ show all ]

Amazon Shop for: San Pedro

Mushrooms, Mycology and Psychedelics >> The Ethnobotanical Garden

Similar ThreadsPosterViewsRepliesLast post
* Increasing the mescaline content of cacti, zomg, evidence :) johnm214M 1,575 2 04/23/08 05:57 AM
by johnm214
* Upping San Pedro mescaline content trouted 1,442 2 05/15/03 10:58 PM
by Young_but_cool
* Are these also lophs? Ledd 279 13 02/12/09 10:53 PM
by teefizzle
* Loph onto non cactaceae stock!?
( 1 2 all )
spong 653 23 02/11/09 05:33 AM
by terra408
* Mescaline Salting dblaney 1,089 17 02/02/05 01:15 AM
by neuro
* mescaline cacti
( 1 2 all )
Locus 1,582 24 05/03/08 01:46 PM
by namaste
* Legality Of Trichocereus And Other Mescaline Containing Cacti.
( 1 2 3 4 all )
Dr. uarewotueat 3,367 65 04/14/09 03:45 AM
by Dr. uarewotueat
* Opuntia scpecies contains mescaline? ApacheShaman 2,364 2 09/29/07 07:56 PM
by ApacheShaman

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: Magash, karode13, naum, Mostly_Harmless
1,964 topic views. 2 members, 18 guests and 0 web crawlers are browsing this forum.
[ Toggle Favorite | Print Topic ]
Search this thread:
The Spore Depot
Please support our sponsors.

Copyright 1997-2013 Mind Media. Some rights reserved.

Generated in 0.054 seconds spending 0.003 seconds on 18 queries.