Home | Community | Message Board


The Hawk's Eye
Please support our sponsors.

Mushrooms, Mycology and Psychedelics >> The Psychedelic Experience

Welcome to the Shroomery Message Board! You are experiencing a small sample of what the site has to offer. Please login or register to post messages and view our exclusive members-only content. You'll gain access to additional forums, file attachments, board customizations, encrypted private messages, and much more!

eBay Shop for: Incense, San Pedro

Jump to first unread post. Pages: < Back | 1 | 2 | 3  [ show all ]
OfflineRemainRandom50
Do You Need ToKnow Me?
Registered: 01/15/06
Posts: 1,695
Last seen: 3 years, 1 month
Re: My 1st Mescaline Trip [Re: Divided_Sky]
    #5358197 - 03/02/06 03:22 PM (6 years, 2 months ago)

Quote:

Divided_Sky said:
Also, if I am not mistaken sulfate and hcl dosages are a little different. I hope I don't have it backwards but I believe 500mgs of hcl equals about 300mgs or so of sulfate?




QUOTED FROM EROWID:
"The two most commonly produced synthetic forms of mescaline are mescaline hydrochloride and mescaline sulfate which have very similar dosages. Mescaline sulfate is 11% heavier than mescaline hydrochloride, meaning it takes 11% _more_ mescaline sulfate by weight to get the same effects as a certain amount of mescaline hydrochloride.

If an acid--base--solvent extraction is done on the plant material the result is freebase mescaline. Freebase mescaline is 15% lighter than mescaline hydrochloride (and 25% lighter than mescaline sulfate), thereby requiring 15% _less_ material by weight for the same dose as mescaline hydrochloride."




And yes - ekstaza is right - everything works differently for each individual...you have to expierement to see where you feel youve reach your high.  260mg (1st dose) was good, but i need more of a kick.  next will be 450mg.  But im thinking maybe 600 is the area that will do me good :smile:

well see :smile:


--------------------
At times I get consumed by my everyday life and will leave the Shroomery. Yet, every time drugs come falling into my life for fun.....I always think about the Shroomery and then I'm back!


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineDivided_Sky
Ten ThousandThings

Registered: 11/02/03
Posts: 3,171
Loc: The Shining Void
Last seen: 3 years, 11 months
Re: My 1st Mescaline Trip [Re: Koala Koolio]
    #5359955 - 03/02/06 09:59 PM (6 years, 2 months ago)

Quote:

Koala Koolio said:
Ask the vendor how much of a schedule I substance that they sold you to take? No.




I always ask them how much incense they recommend for an average smudging ceremony.


--------------------
1. "After an hour I wasn't feeling anything so I decided to take another..."
2. "We were feeling pretty good so we decided to smoke a few bowls..."
3. "I had to be real quiet because my parents were asleep upstairs..."


Post Extras: Print Post  Remind Me! Notify Moderator
OfflineDivided_Sky
Ten ThousandThings

Registered: 11/02/03
Posts: 3,171
Loc: The Shining Void
Last seen: 3 years, 11 months
Re: My 1st Mescaline Trip [Re: RemainRandom50]
    #5359963 - 03/02/06 10:01 PM (6 years, 2 months ago)

Quote:

RemainRandom50 said:
Quote:

Divided_Sky said:
Also, if I am not mistaken sulfate and hcl dosages are a little different. I hope I don't have it backwards but I believe 500mgs of hcl equals about 300mgs or so of sulfate?




QUOTED FROM EROWID:
"The two most commonly produced synthetic forms of mescaline are mescaline hydrochloride and mescaline sulfate which have very similar dosages. Mescaline sulfate is 11% heavier than mescaline hydrochloride, meaning it takes 11% _more_ mescaline sulfate by weight to get the same effects as a certain amount of mescaline hydrochloride.

If an acid--base--solvent extraction is done on the plant material the result is freebase mescaline. Freebase mescaline is 15% lighter than mescaline hydrochloride (and 25% lighter than mescaline sulfate), thereby requiring 15% _less_ material by weight for the same dose as mescaline hydrochloride."




And yes - ekstaza is right - everything works differently for each individual...you have to expierement to see where you feel youve reach your high.  260mg (1st dose) was good, but i need more of a kick.  next will be 450mg.  But im thinking maybe 600 is the area that will do me good :smile:

well see :smile:




I guess I am a lightweight but 300-400mg does me really good. Too good at times...


--------------------
1. "After an hour I wasn't feeling anything so I decided to take another..."
2. "We were feeling pretty good so we decided to smoke a few bowls..."
3. "I had to be real quiet because my parents were asleep upstairs..."


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: My 1st Mescaline Trip [Re: Divided_Sky]
    #5359970 - 03/02/06 10:03 PM (6 years, 2 months ago)

"I always ask them how much incense they recommend for an average smudging ceremony."

Yeah, I didn't assume you meant to ask directly how much to eat. But still, vendors aren't stupid, and a lot of them don't like walking this thin of a line. I've been told by a few vendors not to push it, and others warned before hand not to even come close to some questions.

I guess just analyze the situation as best you can.


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinepantsboy
I troll because I care.
Female User Gallery
Registered: 10/28/04
Posts: 12,901
Loc: 8====D ~o
Last seen: 5 days, 22 hours
Re: My 1st Mescaline Trip [Re: RemainRandom50]
    #5359984 - 03/02/06 10:09 PM (6 years, 2 months ago)

That's great to here man!  I'm glad the mescaline came out good.  I'm very eager to try mescaline myself.  From what I've read about it, I'm actually pretty confident that it will be my favorite drug that I have done and will be even better than acid or shrooms.

:peyotespectrum:


--------------------
Acid doesn't hurt when you're on fire. :frown:




"Mushrooms are only similar to penises in their appearance." - Joseph Kony (2012)

ToiletDuk said:
"Bus squelching is not to be laughed at."


Post Extras: Print Post  Remind Me! Notify Moderator
InvisibleKoala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG

Registered: 01/07/04
Posts: 7,752
Re: My 1st Mescaline Trip [Re: pantsboy]
    #5359987 - 03/02/06 10:11 PM (6 years, 2 months ago)

You're probably right. But I think someone like you might be among the "needs a bunch of it to be really impressed" crowd.

Make your first dose 600mg. No less! :smile:


--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!


Post Extras: Print Post  Remind Me! Notify Moderator
Offlinepantsboy
I troll because I care.
Female User Gallery
Registered: 10/28/04
Posts: 12,901
Loc: 8====D ~o
Last seen: 5 days, 22 hours
Re: My 1st Mescaline Trip [Re: RemainRandom50]
    #5360001 - 03/02/06 10:15 PM (6 years, 2 months ago)

Quote:

RemainRandom50 said:
i would NEVER eat the powder, from here on out i would need to eat only crystal form or an end result of an a/b extraction.  i have never tried just the torch powder, looks WAY to nasty and just from expierence on the a/b extractions taste....i COULDNT imagine the taste of pure torch powder.





It must feel hella rewarding being able to dose on a drug that you are responsible for extracting.  That would pretty much guarantee a good trip for me at least.  I'm glad to hear you are doing extractions too.  I wish I knew how.  I've read so much about that shit, but it still is all way too much for me.  ican;t follow simple procedures and have clue where to get any of the needed supplies.  It's shame too because I'm growing like three really healthy peruvian torches and san pedros in my backyard.  They'd totally be ready for extraction if I only knew how to do it. :frown:

:pantsfase:


--------------------
Acid doesn't hurt when you're on fire. :frown:




"Mushrooms are only similar to penises in their appearance." - Joseph Kony (2012)

ToiletDuk said:
"Bus squelching is not to be laughed at."


Post Extras: Print Post  Remind Me! Notify Moderator
Jump to top. Pages: < Back | 1 | 2 | 3  [ show all ]

eBay Shop for: Incense, San Pedro

Mushrooms, Mycology and Psychedelics >> The Psychedelic Experience

Similar ThreadsPosterViewsRepliesLast post
* 1st Mescaline Trip Locus 420 12 10/28/07 04:48 PM
by Ombient
* San pedro mescaline trip
( 1 2 all )
Cognitive_Shift 1,722 20 01/25/09 04:22 PM
by travelleler
* Peruvian Torch preparation, and some general questions about mescaline trip alphaone 7,007 14 08/14/05 01:50 PM
by Ekstaza
* Basic characteristics of mescaline trip alphaone 1,359 4 11/21/04 02:29 PM
by deathcapcubensis
* Mescaline Trip Tomorrow! Any Suggestions?
( 1 2 all )
Helge 1,336 22 08/01/07 10:07 AM
by S.T.Icarus
* First Mescaline Trip Report / Can anyone help me with extraction? Helge 1,443 18 05/23/07 06:00 PM
by Grok
* Mescaline Trip! pong 890 18 12/03/07 09:54 AM
by thedudenj
* first time mescaline trip - questions PilzeEssen 451 10 08/07/08 11:22 PM
by fallenlsd

Extra information
You cannot start new topics / You cannot reply to topics
HTML is disabled / BBCode is enabled
Moderator: psilocybinjunkie, Wiccan_Seeker, notapillow, sui, karode13, naum, LSDreamer
4,644 topic views. 14 members, 132 guests and 0 web crawlers are browsing this forum.
[ Toggle Favorite | Print Topic ]
Search this thread:
FreeSpores.com
Please support our sponsors.

Copyright 1997-2012 Mind Media. Some rights reserved.

Generated in 2.058 seconds spending 1.969 seconds on 18 queries.