|
FeedingMyDreams
King of Cartoons


Registered: 08/30/08
Posts: 4,525
Loc: tabb, va
Last seen: 5 days, 15 hours
|
Post your rating comments.
#10924367 - 08/24/09 03:29 AM (3 years, 9 months ago) |
|
|
Mine aren't very interesting though. I'd rather stay away from saying who said what. But for the most part it looks like people enjoy my company on the shroomery and two not so much.
"i-60 was great dude" 5/5
"that was a surprisingly good flick" 5/5
"." 5/5
"Coach McGuirk is awesome. You win at life." 5/5
"bitch" 0/5
"Good poster and likes Home Movies and the Safety dance vid." 5/5
"vid" 5/5
"Win. thanks dude." 5/5
"ironic douche bag impression" 5/5
"the funnies!" 5/5
"........and jerk it...jerk it" 5/5
"thanks" 5/5
"looks like i have some competition." 5/5
"Coach McGuirk is the greatest character in television history. I look to his words of wisdom ofter in my own life when facing trials and tribulations." 5/5
"for your help and support during this time of trouble for me. You're a great member of the shroomery." 5/5
"FUCK YOU edit: lol i already rated ur faggot ass" 0/5
"Is the shit. Ibso facto so are you" 5/5
"LOL" 5/5
"To the only guy on here I know in real life." 5/5
--------------------
"It's spaghetti time."
|
FreedomForAll
One Step Ahead



Registered: 11/30/08
Posts: 2,105
Last seen: 11 days, 22 hours
|
|
Viewing FreedomForAll's Ratings (General: 3.9 4/22) Display: [ All | General | Trade ] Sort: [ Rating | User | Date ] [ Add Rating ] [ See Ratings by FreedomForAll ] [ Rating Stats ] [ Opt Out ] Pages: 1 | 2 | Next > [show all] lsatrap Thanks 08/21/09 11:03 AM
And a master commands
013akilper yay 07/26/09 10:48 AM
The Ginger Ninja Gnubobo is mypoppet!
- 07/26/09 05:22 AM
-
StevenMichael BAN LOTTO 07/26/09 04:09 AM
ToiletDuk Beastly Troll #47
So you won the ban lotto.... 07/26/09 02:26 AM
....now you can rest in the womb of your mother.
King Koopa I'm a PC.
Congrats 07/26/09 02:05 AM
DUDE
Hanky NOM NOM NOM'er.
Ban lotto winner! 07/26/09 02:05 AM
CONGRATULATIONS.
Afro Canadian
thank you sir 07/15/09 02:52 AM
right back at you!
the bizzle doin' thangs
YOU DA MAN 07/13/09 08:41 PM
. . . . -O U DIDNT KNOW?
hockeyplyr1057 Music Lover
5 shrooms 07/11/09 10:19 PM
for being a fan of devin!!
Geometry Let the hate flow through you.
theist! 07/09/09 03:43 AM
jk
but not really lol.
thank you for joining in, our duel threads have entertained the masses.
novumorganum swimming in a sea of sin
hello 07/06/09 03:18 PM
grewya20 Gone Fishin'
Good luck... 06/30/09 07:49 PM
learning to play the guitar. 54U.
skatealex2 Mariguanja
H~E~Y~ 06/24/09 07:11 PM
You're a good poster on the shroomery and I'm sure you're cool outside the boards too
Last Edited 06/24/09 07:12 PM
Muppet Nomadic Jester
one +rep deserves another 06/13/09 11:54 AM
and, you know, yer a pretty cool cat on these boards too slick
mockingbird It Goes Round And Round
I want to be Wine-o-bot 05/23/09 03:54 PM
When i grow up
MFDoom666 trash hoarder
fritata! 04/25/09 12:04 AM
This rating contains no text.
CokedUpHobit64 Spiral Out
Kratom 04/13/09 06:53 PM
Thanks for the suggestion.
skin_ d^_^b
I fink 03/30/09 06:29 PM
you have me confused with someone else, but I'll still take your love, and even give you some back!
HellDragon Nobody
hi 02/14/09 08:41 PM
hi
|
DNKYD
Turtle!

Registered: 09/24/04
Posts: 12,209
|
|
You know... we can all look at your ratings and see exactly who gave you what rating and what their comment was.
I think this thread tops the Retarded Thread of the Week list.
|
FeedingMyDreams
King of Cartoons


Registered: 08/30/08
Posts: 4,525
Loc: tabb, va
Last seen: 5 days, 15 hours
|
|
By far my favorite comment: "FUCK YOU edit: lol i already rated ur faggot ass" 0/5
lol
--------------------
"It's spaghetti time."
|
UpSwell
Stranger


Registered: 11/01/04
Posts: 436
Last seen: 3 years, 8 months
|
|
_Aegis_ 3\_/0|_G|-|0$-|-
you're that guy huh 08/18/09 10:18 PM
I heard about you. You threatened to call the police on a guy that you ripped off if he left you a negative rating. He might be too scared to rate you but old Aeg isn't. You're a thief and a narc.
GeoMcCheeseburgers one-eyed willie
- 08/18/09 09:49 PM
This guy ripped off a couple shroomery members for over $300 and then threatened to call the police on them if they gave him a negative trade rating.
|
FeedingMyDreams
King of Cartoons


Registered: 08/30/08
Posts: 4,525
Loc: tabb, va
Last seen: 5 days, 15 hours
|
Re: Post your rating comments. [Re: DNKYD]
#10924389 - 08/24/09 03:33 AM (3 years, 9 months ago) |
|
|
Quote:
DNKYD said: You know... we can all look at your ratings and see exactly who gave you what rating and what their comment was.
I think this thread tops the Retarded Thread of the Week list.
Ehh, go ahead then.
--------------------
"It's spaghetti time."
|
Idiot
I Am Moron!


Registered: 11/27/05
Posts: 6,444
Loc: 41.90231, 12.45390
Last seen: 23 hours, 18 minutes
|
|
Its fun to browse through the ratings system.
I never noticed the 'opt out' thing before, that hilarious.
--------------------
Customize your Shroomery experience!
Do not argue with an idiot. He will drag you down to his level and beat you with experience.
|
DNKYD
Turtle!

Registered: 09/24/04
Posts: 12,209
|
|
I just don't understand the point of the thread. If I want to see ratings and comments for you or anybody else, I'll look at them. No need to make a thread about it.
|
skatealex2
/////////////////////////////


Registered: 07/04/08
Posts: 17,514
Last seen: 4 days, 9 hours
|
|
AquaKet Energy Shrooms, LSD, KETAMINE 08/08/09 08:13 PM
And you're the only person I know that listens to Panda Bear. Kickass!
Plus, you bring up some good questions/experiences about weed. I don't smoke it myself, gives me anxiety, but some of the things you have said about it have paralleled my ideas about it.
You seem like a cool guy, keep rockin' on! 
grewya20 Gone Fishin' Informative Poaster. 08/06/09 10:19 PM
54U. 
csrpj no one's a stranger yayay! 08/05/09 04:17 AM
like your style, man
desant ~Sensei~ legalize! 08/04/09 07:27 AM
good stuff
mikeisapro Pro I haven't rated you yet? 08/02/09 01:01 PM
Love your posts, love ganja.

Dr. Siekadellyk "Void" Explorer +5 07/30/09 09:31 PM
 
Last Edited 07/30/09 09:33 PM
Coaster Ånŧhřøpomǿrphižəď u and i think so fucking alike 12/13/08 08:57 PM
if any1 would b my twin it would b u u should take that as a massive compliment 
    
Last Edited 07/28/09 05:48 PM
StrandedVoyager The People's Champ +5 07/24/09 01:46 PM
You're a pretty chill guy and I like how you're all about legalization and doing something about it. 
biff no title cheers 07/23/09 11:22 AM
to 6000 posts!    
Shad0w In trouble again. U R OK. 07/22/09 02:44 PM
You always have such interesting topics in your threads.
    
Helpme1 freak good guy! 07/16/09 11:58 AM
good dude that knows whats up!   
dr_gonz cool kid 07/10/09 12:07 PM
take 5
Mr_Insidious Stranger Cool dude 07/04/09 06:04 PM
I like your posts and you aren't a prick. 


Mataspore mc²=E Leary-Os 06/30/09 09:07 PM
must dai! 
The Professional Corporate Thuggin' Hello 06/30/09 08:16 PM

KetamineKatalyst Skyhighatrist ! 06/20/09 11:33 PM
I think you're funny as shit man. Don't become jaded like the rest!

Last Edited 06/21/09 02:59 PM
Ima Trooper Nigga done got TOLE! have 5 06/17/09 06:04 PM
courtesy of the Hamncheese Ratings Nullification Project. 
hamandcheese Sandwich 5 white shrooms 4u 06/17/09 04:01 PM

Last Edited 06/17/09 05:04 PM
shivas.wisdom psybaba a full 5 06/17/09 12:27 AM
to a fellow pot enthusiast. Keep on smoking that kush.
 
I AM SWIM doin' thangs Nice goal 06/16/09 11:20 PM
Money isn't happiness but I would like to buy an abundance of g00d dr00gz, music steeZ and m o v e out of my house " I 
mockingbird It Goes Round And Round how i have not rated you 06/16/09 12:03 AM
wonderful member... love his use of graemilns
edit:I could only wish to be that dashing
Last Edited 06/16/09 06:20 PM
justinsanity Advice 06/13/09 11:36 PM
Thanks!  Who knew you could vaporize with a bong!
enjoy my ratingZ
|
sui
I love you.



Registered: 08/20/04
Posts: 18,164
Loc: Cali, Contra Costa Co.
|
Re: Post your rating comments. [Re: Idiot]
#10924428 - 08/24/09 03:43 AM (3 years, 9 months ago) |
|
|
Viewing suimush's Ratings (General: 4.6 5/129 | Trade: 5.0/5) Display: [ All | General | Trade ] Sort: [ Rating | User | Date ] [ Add Rating ] [ See Ratings by suimush ] [ Rating Stats ] [ Opt Out ] Pages: 1 | 2 | Next > [show all] dr_gonz california love Fri Aug 21 2009 01:35 PM
5
Ythan ٩(●̮̮̃•̃)۶ Thanks Fri Aug 21 2009 12:43 PM
Re: Re: Ythan
I appreciate the kind words, and all you do for the site.
GTFO Official CIA Drugwhore + Fri Aug 21 2009 01:38 AM
quality.
ShroomlessInOkla The Governator Sayz Go Chagaz RE:Ratings rapes and you. Thu Aug 20 2009 10:36 PM
w0rd!
sucklesworth Lick me where Ipee nom Fri Dec 09 2005 02:09 PM
nom nom
Last Edited Thu Jul 30 2009 08:33 AM
Burke Dennings tron as fuck . Thu Jul 30 2009 07:31 AM
,
makaveli8x8 Stranger Party up in hear! Thu Jul 30 2009 12:32 AM
Last Edited Thu Jul 30 2009 12:33 AM
Hanky NOM NOM NOM'er. No reason. Thu Jul 30 2009 12:29 AM
Just for fun.
hamandcheese Sandwich nothing personal Wed Jul 29 2009 11:55 PM
you just need more balance in your ratings. too much yin not enough yang or too much yang not enough yin but whatever i think you get the point :rainbow:
TrancedShroom Speaker of the House Good guy Wed Jul 29 2009 11:33 PM
Very logical.
PolkAudio2 "Swisher Sweets" + Fri Jun 12 2009 09:33 PM
5
the bizzle doin' thangs for courtesy Thu Jun 11 2009 07:19 PM
brainsOplenty myconut whatever Mon May 25 2009 03:53 PM
Cubie Moderator Thanks Mon May 25 2009 01:41 AM
For the introduction to Oaksterdam.
Poid Sigmund Poid It was nice meeting you... Sun Apr 12 2009 08:02 PM
We should jam some day!
Kamek Voiced Velar Fricative +5 Sat Apr 04 2009 08:17 PM
You earned them.
CptnGarden fuck this site wtf Sat Apr 04 2009 04:52 PM
could have sworn i rated u before
oh well
heres 5 for rockstarjesus
desant ~Sensei~ Sat Apr 04 2009 04:34 AM
thanks
PyroBurns душа кофе Enjoy Thu Feb 19 2009 08:14 PM
your drank.
unretarded Tick and poisionoak collector . Fri Feb 13 2009 09:30 PM
.
Toad_Stool Sloth Nation pub Tue Dec 16 2008 05:25 PM
weak
shroomzey Humble Student For... Sun Sep 21 2008 05:37 PM
Owning a bad-ass base pipe! DMT ftw.
never.never.land Pirate Great Help Mon Aug 11 2008 08:20 PM
Great help in Nitrous Oxide thread, all around amazing poster.
Brugman Alcohologist hey Sun Aug 10 2008 11:11 PM
you're neat and I haven't rated you yet.
Chemy Jesus is Lord Lucky Thu Jul 10 2008 07:34 PM
Re: Re: Im legal now.
drok creep WE NEED ORDER Tue Jul 08 2008 04:33 PM
& your the one to give it to us
BUST A MOVE
Irishdrunk Democracy? We Deliver! I wov you Sat Jul 05 2008 03:14 AM
We cannot proceed. You have been temporarily banned from this forum.
Please use your back button to return to the previous page.
Hehehhee, I deserved it though.
Peace my bro, sorry to cause ya any work
Hightimes joshua YOUR a .......... Mon Jun 23 2008 10:30 PM
funny cunt! +5
kriminalelement giant flamingrobots 5 shrooms Fri Jun 20 2008 01:53 PM
For caring about your girlfriend enough to ask people about birth control. You're a good man.
ShROoMiNnBOOMiN psychoactive ginnie pig bay area love Mon Jun 16 2008 10:51 PM
love where we stay. thanx man
haymaker Mr Psychonaut HAPPY BIRTHDAY Wed Jun 11 2008 06:51 AM
plus i've always liked your posts.
b0b gnarley Hold my beer and watch this! - Sun Jun 08 2008 03:52 PM
LOL
Edited Jun 11, 2008 at 3:14:00 pm by b0b gnarley
Ripple Tangled up inBlue I can't believe Thu Jun 05 2008 05:07 PM
I never rated a great contributor to the pub forum like you!
Anyway here you go five fatties to you and thanks for your commitment and service!
TheCow fag Wed Jun 04 2008 09:34 PM
.
The_Red_Crayon Exposer of Truth god bless you sir Wed Jun 04 2008 09:12 PM
http://www.shroomery.org/forums/showflat.php/Cat/0/Number/8485536/an/0/page/0
razmablues Biologist congrats Sun Jun 01 2008 02:32 AM
on becoming a mod, great guy too!
SeattleLove Life's too short Musicians Sat May 31 2008 08:21 AM
Are the spice of life!
Rock on!
Shroomeup Just Cause Mon Mar 31 2008 05:44 AM
Cause why?
coda Banjo Goiter thanks! Mon Feb 25 2008 02:24 PM
for the choco link, should make my life tons easier now!
reeferaddict69 Self-TransformingMachine Elves Ima going Mon Feb 25 2008 01:01 AM
to nigga ass magic mushroom mountain!
smily Sham Wow. ha ha Wed Feb 06 2008 09:10 PM
YUP a bit wed. fun thanks for stoppin bye
Vanguard Camping Trip Sat Jan 05 2008 02:52 PM
You and Laska are awsome people!!! I hope to meet you again someday!
Oh and that laugh of yours makes me laugh too!!!
LosAngelesGraff Dose me! Sweet Deal Tue Jan 01 2008 11:16 PM
i love this little glass nug jug haha. we get medical plastic cantainers here.
scout24 Hallelujah! Cool Sun Dec 09 2007 01:47 AM
Good to see everyone knows it.
Fahkface Mufti SAME TO YOU Thu Nov 29 2007 08:51 AM
Thanks for the prints
iwasaClown You already knowme 50 posts for me, Wed Oct 17 2007 12:07 PM
5 shrooms for you.
ShiVersblood Stranger hi Sun Oct 07 2007 01:54 PM
Your a good guy
Locus Playing With Fire i like Sat Oct 06 2007 04:04 PM
this guy... cool dude!
Diploid Cuban Thanks! Sat Sep 29 2007 01:27 AM
For finding this: http://www.pandora.com/
undergrounder no Sun Sep 23 2007 04:16 AM
probs
http://www.shroomery.org/forums/showflat.php/Number/7205358#7205358
FreakQlibrium Serpent of God It's GR8 to see somone here with a sense of humour Thu Sep 13 2007 01:22 AM
You rawk gurl
whattheheck Chief Love Lover For the Avatar help Wed Sep 12 2007 11:53 PM
Thanks!!
FondaCox Ms. I'llhavemycakeandeatittoo Cyan Hunters Unite - Nice Pics! Mon Aug 13 2007 10:38 AM
I am guessing it will be a late summer, so I am betting first find this fall will be close to halloween....I just used up the last of my 06' cyans in a batch of cyan tea jello shooters for the meteor shower.
Dety Old No.7 I got made a Mod Fri Aug 03 2007 06:14 PM
Congrats!
GWAR Scumdog of theUniverse SyrianRue Wed Aug 01 2007 11:33 AM
Here's 5 shrooms for you because SyrianRue is an ignorant fuck.
yageman already dead dont Tue Jul 31 2007 02:33 AM
like ya............
I dont rate people often.
I just think you jump on all the wrong people. You say some stupid shit too.
So, sorry for the rating.
Last Edited Tue Jul 31 2007 03:19 AM
theorganicdomino Psychedelic ZenBuddhist Passing the karma around Mon Jul 30 2007 02:22 AM
Passing the karma around
onlynow transformativeinformativeenergy useless thread? Sun Jul 29 2007 05:50 PM
i disagree
suimush called me a retard in his rating to me because i didn't find my thread useless. he may find no use in humor, but i and others sure do. suimush can continue being a serious puppet and hopefully people will love him because of that. or maybe not, since nobody loves a serious downer with no sense of humor. fool.
Last Edited Mon Jul 30 2007 01:00 AM
blackroselove Just.. Mon Jul 30 2007 12:41 AM
..to get your goat.
BlackieRL
Muppet Nomadic Jester happy 6000 Sun Jul 29 2007 02:40 AM
n00b
I Like Alkaloids Moonshiner Hey! Fri Jul 27 2007 11:37 AM
Fuck off SyrianRue!
SyrianRue . Thu Jul 26 2007 01:28 AM
You do know this site has an age requirement right?
JunkFood . Wed Jul 25 2007 10:10 PM
MyInnerChild EveryMum I'll be looking for.... Fri Jul 13 2007 08:22 AM
On the Road...at your reccomendation...Thanx! MIC
wutang fungi ............................................ Mon Jul 09 2007 04:16 PM
another future rock star. sex, drugs, and rock n roll!!!
notapillow I want to be afisherman o ya Fri Jul 06 2007 06:23 PM
fo sho
how have i never rated you????
Tech Antitheist Rating back Mon Jul 02 2007 11:06 AM
At last I got 50 posts, here's a five back at you.
centrum Another 1st class shroomery member Sun Jun 24 2007 12:35 PM
Keep jammin!
DRTMaverick Photographer and Stoner Have fun at the gathering! Sat Jun 16 2007 01:04 PM
I will be late but if you stick around till the 18th and 19th I'll be there!
LosAngelesGraff Dose me! <(((((((((@ light it up Wed May 02 2007 03:55 PM
Nice to see another californian!
Iron_Hymen Shake Hands withBeef A FIVER FORRRRRRRRRrrrrrrrr... Thu Apr 26 2007 08:12 PM
creating a 'play' out of the Australian Killer Bitches!
OldSpice Geritol Breath... Welcome to the Shroomery.... Wed Apr 25 2007 08:58 PM
I can already tell you will be a assett
boogertool cool dude Mon Apr 23 2007 01:52 AM
for his trippy nature pic.... only the enlightened will see
jenns_hot Hungry good post Sat Apr 21 2007 10:08 PM
http://www.shroomery.org/forums/showflat.php/Cat/0/Number/6817233/page/0/fpart/3/vc/1
Legend9123 5...4...U... Tue Apr 10 2007 05:21 PM
For being a chill guy and your Shroomery Minor Watch Program.
tiny_rabid_birds Nocturnal solid Sun Apr 08 2007 09:12 PM
been enjoying talking to you these past few days. also, you and laska make a great couple. it makes me happy seeing that
laska Baby Sat Apr 07 2007 12:52 PM
I Love You.
capliberty never Fri Sep 15 2006 12:53 AM
forget to return a bad rating,
danamine libriarian Five for you Sat May 06 2006 11:51 AM
For saving the hitman thread!
MrSinister Uncle T For the sandwiches Sun Apr 02 2006 04:45 PM
thanks for the welcome
Kerbouchard i've talked to you alot Sun Mar 26 2006 02:35 AM
over the years, at least enough to know that you are 'good people' as the 'in crowd' says. We need more good people. I wish you the best of luck in your rock star dreams, and shroom adventures. Stick around for a long time, brother of light! :o
Microcosmatrix Spiral staircasetechnician Your second bad rating... Tue Mar 14 2006 08:48 PM
i'll remove it after you make a thread about it!
Haha and you did!
rod Ψ 4u Tue Mar 14 2006 08:06 PM
TM The Mind, The Many, The Music. Yeah! Tue Mar 14 2006 07:27 PM
A positive influence. Great sense of humor. Any friend of Slothie's is a friend of mine.
KaptKid Spaced Pirate 5 Good Ones Tue Mar 14 2006 07:24 PM
To help off set that bad rating.I always thought you were cool
vinsue OLDFART 5 more Tue Mar 14 2006 07:08 PM
4...U.. ....coffee....
eris underground +5 Mon Mar 06 2006 04:32 AM
Late night poster.. good to have you around to talk to.
Koala Koolio TTAGGGTTAGGGTTAGGGTTAGGG bazang! Sat Mar 04 2006 12:08 PM
...bezangief
aNeway2sayHooray unsane,beyondsanity . Wed Feb 22 2006 09:06 PM
Boom Supervisor i thought Tue Feb 21 2006 09:26 AM
i did this already
tactik Too stoned forthis. cool dude Mon Feb 13 2006 10:30 PM
Always like reading your posts dude. Rock on
TheDude is waiting forthe peak . Mon Feb 13 2006 09:59 PM
surprised I haven't rated you yet, definitely a 5er.
Acidic_Sloth Acidic poly-Sided Di-slothamide kek! Mon Jan 30 2006 05:54 PM
taken me a while to rate ya .. but i had an AWESOME time chillin' with you. your bro has the best fucking laugh i've ever heard, and his cat is too cute. you most definitely have to come out to SoCal some time ... there is lots of shit to do, and lots of drugs to be had. although mushrooms can be hard to find.
Cutter other side guy Sweet Song! Sat Jan 28 2006 08:41 AM
Can't wait untill it's done
deryl . Wed Jan 25 2006 05:33 PM
.
lwo hunter, fighter, peaceman Fri Jan 20 2006 09:07 PM
It's a love affair with nature we must have. You can tell when people have it. OH nature! And all the little things that come with it. mad shrooms your way big boomers on your horizons
FractalDust Inspired by the mystery Good vibes Fri Jan 13 2006 09:37 PM
You seem like a cool kidd
In(di)go People of the sun. thanks Fri Jan 13 2006 07:35 AM
for the good vibes you sent when i was down...
five shrooms, peace and love to you
Dreamer987 The VerbalHerman Munster . Tue Jan 10 2006 03:34 PM
.
-------------------- ~TOTAL FREEDOM THROUGH TOTAL CONTROL~
The Ultimate Artistic ParradoxX
 
"There is never a wrong note, bend it." Jimi Hendrix
|
sui
I love you.



Registered: 08/20/04
Posts: 18,164
Loc: Cali, Contra Costa Co.
|
Re: Post your rating comments. [Re: sui]
#10924438 - 08/24/09 03:46 AM (3 years, 9 months ago) |
|
|
Viewing suimush's Ratings (General: 4.6 5/129 | Trade: 5.0/5) Display: [ All | General | Trade ] Sort: [ Rating | User | Date ] [ Add Rating ] [ See Ratings by suimush ] [ Rating Stats ] [ Opt Out ] Pages: < Back | 1 | 2 [show all] vandago Intensticular Good Taste Fri Jan 06 2006 05:59 PM
PeanutButter and Pickle sandwiches are the shit!
blissedout Lysergically Displaced Thank you Wed Jan 04 2006 09:11 AM
We really appreciated the good vibes you sent us during delivery. Much love to you, man.
BTW-I thought I had rated you long before now.
Fluxburn The Movement thanks Hunting Mon Jan 02 2006 10:51 AM
I go!
DLittle Lurker, mostly Thanks Fri Dec 30 2005 07:27 PM
Your arachnid friend was enjoyed to the fullest :p
GeoMcCheeseburgers one-eyed willie + Tue Dec 27 2005 09:34 PM
Enjoy your roll and those tasty looking fungi.
tahoe Noob Slayer future shitt Tue Dec 27 2005 08:31 PM
you are a rockstar
abrad84 Merry Christmas Fri Dec 23 2005 03:24 PM
daimyo Monticello Merry Christmas Fri Dec 23 2005 12:39 AM
Jesus loves you!
baycafe Urawa RedDiamonds Contra Costa Living... Thu Dec 22 2005 02:07 PM
My mentor
Christoph teh goat luvr Drugstore Cowboy Lucy found you..... Thu Dec 08 2005 02:59 PM
Now have fun with her! :p
Jfisher fungusaficionado Thanks! Mon Nov 28 2005 03:32 PM
For all the info
MasonsChild Fellow Traveler>^..^< Thanksgive breakup... Sat Nov 26 2005 01:23 PM
...Me too, me too. We will get by, but man its sure hurts loosing lovers.
Gog hapless andhappy Esteemed Explorer Sat Oct 08 2005 11:11 PM
5 (best) FIVE MUSHROOMS -------------- For discovering that I was a troll.
How did you know?
thegatewaydrug my burning sunwill some dayrise me? DEA? Sat Oct 01 2005 09:07 PM
naw it couldnt be...
could it
Banez nice Mon Sep 26 2005 05:26 PM
nice post.
dblaney Human Being Insightful and intelligen Mon Sep 26 2005 05:10 PM
intelligent. Great member of the community!
LuNaTiX Crazyness Thu Sep 01 2005 07:38 PM
yarrak LSD is the keyfor the universe:) hey Fri May 06 2005 11:12 PM
peace
swampthing audioboy thanks! Wed Mar 23 2005 07:31 PM
thank you duder i think you broke my shroom cherry
infamous LeArnin ThARoPes Yo Sun Jan 16 2005 01:23 AM
Good trader, delivered as promised!!
delta9 Active Ingredient You need another 5 Sat Jan 15 2005 08:28 AM
infamous LeArnin ThARoPes Nice hunt !!!!! Wed Jan 05 2005 01:25 AM
+5 for the sicc finds on the recent hunt
Toricious Theblunt-smokinglense-man. hey Thu Dec 30 2004 10:26 AM
nice talking to you :p
Frappy Strange 5 Shrooms for you! Thu Dec 30 2004 03:48 AM
For working with me on the Psilocybin, Psilocin, and Beocystin thread.
soulmotion Professor Cuz you represent'n... Thu Dec 30 2004 12:29 AM
...the Bay Area, and for making a newbie feel welcome: level 5 mushroom for you!
Jim InjectableAmpoule its about what you like Tue Dec 21 2004 03:45 PM
[+]
lykos A Stranger in aStrange Land Mon Dec 13 2004 10:38 PM
I owe it to this awesome guy for introducing me to the world of shrooms.
Thanks man! I had a great trip.
runnerup student good trade Sat Dec 11 2004 02:58 PM
showed me a very good spot!
TODAY Battletoad can't believe i haven't Sat Dec 11 2004 12:22 PM
rated you yet i dig your zest for making it known that the bay area is chock full o actives!
Silven I trip,therefore weare. Straight forward Mon Dec 06 2004 01:25 PM
stand up kinda guy trying to get things done!
I'm with you on the cause man. You got the west coast, I got the east. Lets get'er done.
Cheers bro.
Civ Pinning hey man Thu Nov 04 2004 01:11 AM
good guy, always trying to help. California pride!
deathcapcubensis hunter whuttsup Wed Nov 03 2004 05:07 PM
turned out to be a cool guy
Merkin neep. get used Mon Nov 01 2004 05:34 AM
to OTD
CaRnAgECaNdY NOVA's groupie This one.... Mon Nov 01 2004 01:55 AM
is from me! I like your posts!
runnerup student CA Sat Oct 30 2004 12:32 PM
hes from CA, gets a 5 from me
-------------------- ~TOTAL FREEDOM THROUGH TOTAL CONTROL~
The Ultimate Artistic ParradoxX
 
"There is never a wrong note, bend it." Jimi Hendrix
|
FeedingMyDreams
King of Cartoons


Registered: 08/30/08
Posts: 4,525
Loc: tabb, va
Last seen: 5 days, 15 hours
|
Re: Post your rating comments. [Re: DNKYD]
#10924443 - 08/24/09 03:47 AM (3 years, 9 months ago) |
|
|
Quote:
DNKYD said: I just don't understand the point of the thread. If I want to see ratings and comments for you or anybody else, I'll look at them. No need to make a thread about it.
I assumed ratings were more like PMs.
--------------------
"It's spaghetti time."
|
DNKYD
Turtle!

Registered: 09/24/04
Posts: 12,209
|
|
Click on anybody's mushrooms and you'll see their ratings. That's why they are there. Same with trade ratings. What would be the point if nobody could see them?
|
DieCommie
El Guapo

Registered: 12/11/03
Posts: 25,374
Loc: Street of Dreams
|
Re: Post your rating comments. [Re: skatealex2]
#10924457 - 08/24/09 03:54 AM (3 years, 9 months ago) |
|
|
heh, I get some respect but alot of people dont like me. Its understandable, I can be quite abrasive. (but IRL im not that bad, when I meet shroomerites they always say - you're not like I expected)
Quote:
not a nice person 07/08/04 03:45 PM
While most people on this board seem pretty cool, I still find myself taken aback by the number of closed-minded, judgemental, and angry people - such as this Diecommie character - that turn up and hurl insults at others that are basically minding their own business, or perhaps making a light-hearted comment.
(edited for poor typing skills)
Its true...
Quote:
Intelligent.... 02/19/07 08:47 AM
and knows a lot! Please keep posting in the science forum!
Someone thinks Im smart, thats always nice!
Quote:
on YMSB 04/22/08 02:32 PM
How are they basically a Dead cover band?
They aren't bluegrass, they are jam grass.
Here I got rated zero for my opinion on yonder. Sure, they are more than just a dead cover band. Oh well... (btw, wtf is jam grass?)
Quote:
You should limit yourself 08/24/08 11:00 AM
To P&S, that's the only place that buys your brand of skeptical bullshit.Get over you ego and watch events as they unfold, not as some government funded scientists told you it happened. The propaganda machine is at full steam, and youve been run over, along with the majority of the american people. Have fun when your beloved government fails you tremendously, and leaves you to accept the truth of the world we live in.
You fucking backwards ass idiot. Learn to read, troll.
M&P people dont like me much. Its ok, they need me more than they realize.
Quote:
5 shrooms 08/21/09 06:21 PM
I often dislike your tone, however I find your posts are almost always quite intelligent and informative.
I like this recent one. 5 shrooms even though I have a shittie tone.
|
|