|
 
Welcome to the Shroomery Message Board! Please  login or  register to post messages and view our members-only content. You'll gain access to additional forums, encrypted messages, file attachments, board customizations, and much more!
|
 veggie
Registered: 07/25/04
Posts: 5,800
|
 Banned liquor latest twist in cruise disappearance
#5210433 - 01/22/06 01:58 PM (2 years, 7 months ago) |
|
|
Banned liquor latest twist in cruise disappearance
Associated Press
January 22, 2006 - stamfordadvocate.com
STAMFORD, Conn. -- An illegal alcoholic drink that gained notoriety in the 19th century for its hallucinogenic effects is emerging as the latest twist in a modern mystery surrounding a Greenwich man who vanished from his honeymoon cruise last summer.
Passengers say that absinthe, made from grain alcohol and the common herb wormwood, was consumed by a group of men last seen with George Allen Smith IV on July 5, the day he disappeared from a Royal Caribbean cruise of the Mediterranean.
C. Keith Greer, the attorney for one member of that group, Josh Askin of California, said Smith also drank shots of absinthe.
Absinthe is banned in the United States because of harmful neurological effects caused by a toxic chemical called thujone, said Michael Herndon, spokesman for the U.S. Food and Drug Administration.
It is historically blamed for hallucinations and bizarre behavior dating back to Vincent van Gogh.
"In large amounts it would certainly make people see strange things and behave in a strange manner," said Jad Adams, author of the book, "Hideous Absinthe: A History of the Devil in a Bottle." "It gives people different, unusual ideas which they wouldn't have had on their own accord because of its stimulative effect on the mind."
Oscar Wilde, one of many 19th century artists and writers who enjoyed the drink, thought the floor was covered with flowers while drinking absinthe, Adams said.
The modern version of the drink has much smaller doses of thujone than the amounts suspected in van Gogh's day, some experts say. The drink is legal in some European countries, though London bars typically limit drinkers to two shots, Adams said.
The accounts of absinthe come after a series of unusual developments aboard the ship.
Witnesses say Smith and his bride, Jennifer Hagel-Smith, were heavily intoxicated and argued in the ship's bar the night Smith disappeared. Passengers say Smith called his wife names and she responded by kicking him in the groin hard enough to double him over.
Hagel-Smith has disputed those accounts, but said she doesn't recall what happened. She said she never experienced the effects of alcohol like she did that night.
Hagel-Smith was found passed out on the floor of a corridor far from the couple's cabin the night her husband disappeared. Hagel-Smith has said she passed an FBI polygraph test and federal authorities have said she has cooperated with the probe.
Smith was taken back to his cabin by a group of passengers that included Askin, Greer said. FBI agents have questioned the passengers, but no one has been charged and attorneys maintain their clients' innocence.
The passengers last seen with Smith are also being investigated in connection with reported rape of a female passenger three days after Smith's disappearance, the cruise line has said. No charges have been filed and the passengers have denied wrongdoing.
Greer said the passengers bought absinthe in Italy. The cruise line has said the young men were seen trying to sneak their own bottles of alcohol into the ship's disco before Smith's disappearance.
Two passengers on the cruise said the group of young men were drinking excessively.
"They drank the whole bottle," said Victorio Jove, a 25-year-old passenger from Mexico. "When I got there the bottle was empty."
In recent years, absinthe has made a comeback, enjoying an allure from its colorful history that was kept alive by later writers such as Ernest Hemingway. Defenders of the drink say it is safe and its harmful effects a myth.
"When you drink absinthe it seems for a while your mind stays remarkably clear," said Theodore Breaux, an environmental microbiologist and an absinthe researcher. "You feel like you are lucid and alert."
In 2000, researchers from the University of California, Berkeley reported that the 19th century absinthe popular with artists and writers contained a potent toxin that causes neurons to seriously malfunction.
"You'd start to get hyper excited and eventually convulsions if the dose is high enough," said Jeffrey Bloomquist, a professor of toxicology at Virginia Tech who reviewed the study.
Artists and writers such as Wilde and Edgar Allen Poe celebrated its hallucinatory effects, referring affectionately to absinthe as "the green fairy" or "holy water." But social critics, doctors and others of their era blamed the drink for madness.
Some symptoms described in Wilfred Niels Arnold's 1992 book on van Gogh and others who consumed absinthe included forms of bizarre and psychotic behavior, hallucinations, sudden delirium, convulsions, and even suicide and death.
"It was actually called at one time the devil in the bottle," Adams said. "It was widely perceived to be a dangerous substance."
|
Jim
InjectableAmpoule
Registered: 04/07/04
Posts: 19,200
|
Re: Banned liquor latest twist in cruise disappearance [Re: veggie]
#5211421 - 01/22/06 06:33 PM (2 years, 7 months ago) |
|
|
She either killed him, or had him killed.
--------------------
Use the Fucking Reply To Feature You Lazy Pieces of Shit!
afoaf said:
Jim, if you were in my city, I would let you fuck my wife.
|
 Madtowntripper
Sun-Beams out of Cucumbers
Registered: 03/06/03
Posts: 12,440
Last seen: 2 minutes, 40 seconds
|
Re: Banned liquor latest twist in cruise disappearance [Re: Jim]
#5211523 - 01/22/06 06:57 PM (2 years, 7 months ago) |
|
|
I'm pretty sure he fell off. She passed a lie detector....
--------------------
|
Jim
InjectableAmpoule
Registered: 04/07/04
Posts: 19,200
|
Re: Banned liquor latest twist in cruise disappearance [Re: Madtowntripper]
#5211532 - 01/22/06 06:59 PM (2 years, 7 months ago) |
|
|
anyone can pass a lie detector...
there is a reason they don't hold up in court.
--------------------
Use the Fucking Reply To Feature You Lazy Pieces of Shit!
afoaf said:
Jim, if you were in my city, I would let you fuck my wife.
|
 Seuss
Error: divide byzero
Registered: 04/27/01
Posts: 15,538
Loc: Caribbean
Last seen: 20 minutes, 8 seconds
|
Re: Banned liquor latest twist in cruise disappearance [Re: Jim]
#5213115 - 01/23/06 03:25 AM (2 years, 7 months ago) |
|
|
Quote:
anyone can pass a lie detector...
there is a reason they don't hold up in court.
That explains why the CIA uses them during the job interviews...
--------------------
Just another spore in the wind.
|
kindadank
Registered: 07/14/03
Posts: 683
Last seen: 2 days, 7 hours
|
Re: Banned liquor latest twist in cruise disappearance [Re: Jim]
#5213990 - 01/23/06 12:43 PM (2 years, 7 months ago) |
|
|
I don't know about anyone...I think it takes some intense concentration and ability to regulate your body's heart rate, bp, and a few other things. Sounds pretty hard to me.
|
blackout
Microwaver
Registered: 07/16/00
Posts: 3,052
Loc: Ireland
Last seen: 1 month, 19 days
|
Re: Banned liquor latest twist in cruise disappearance [Re: veggie]
#5214015 - 01/23/06 01:02 PM (2 years, 7 months ago) |
|
|
Quote:
veggie said:"It was actually called at one time the devil in the bottle," Adams said.
Yeah, the devil is the 70-80% ethanol not the trace amounts of thujone.
--------------------
Visit & Support Free Spore Ring Europe
Microwave Growlog
How to search this site, most of your questions are already answered
Sclerotia, the easiest thing for beginners to grow, high yielding, no fanning/misting/terrarium/light/humidity needed
|
RemainRandom50
Do You Need ToKnow Me?
Registered: 01/15/06
Posts: 1,551
Last seen: 1 day, 11 hours
|
Re: Banned liquor latest twist in cruise disappearance [Re: blackout]
#5214338 - 01/23/06 03:23 PM (2 years, 7 months ago) |
|
|
absinthe was the scapegoat in this murder 
--------------------
At times I get consumed by my everyday life and will leave the Shroomery. Yet, every time drugs come falling into my life for fun.....I always think about the Shroomery and then I'm back!
|
Seuss
Error: divide byzero
Registered: 04/27/01
Posts: 15,538
Loc: Caribbean
Last seen: 20 minutes, 8 seconds
|
Re: Banned liquor latest twist in cruise disappearance [Re: RemainRandom50]
#5216799 - 01/24/06 05:57 AM (2 years, 7 months ago) |
|
|
> absinthe was the scapegoat in this murder
*ding* we have a winner!
--------------------
Just another spore in the wind.
|
Koala Koolio
TTAGGGTTAGGGTTAGGGTTAGGG
Registered: 01/07/04
Posts: 7,727
|
Re: Banned liquor latest twist in cruise disappearance [Re: Seuss]
#5219829 - 01/24/06 10:04 PM (2 years, 7 months ago) |
|
|
Next time I commit a crime, I'll get wasted on absinthe first.
Hopefully I'll just get an exorcism instead of jail time.
--------------------
You're not like the others. You like the same things I do. Wax paper, boiled football leather... dog breath. We're not hitch-hiking anymore, we're riding!
| |
|
|
|
Previous
Index
Next
Threaded
Edit 
Reply 
Quote 
